ToxSci Advance Access originally published online on January 8, 2008
Toxicological Sciences 2008 102(2):310-318; doi:10.1093/toxsci/kfn004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cadmium, Vectorial Active Transport, and MT-3–Dependent Regulation of Cadherin Expression in Human Proximal Tubular Cells
Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, North Dakota 58202
1 To whom correspondence should be addressed at Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, 501 N. Columbia Road, Grand Forks, ND 58202. Fax: (701) 777-3108. E-mail: ssomji{at}medicine.nodak.edu.
Received November 5, 2007; accepted December 31, 2007
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONFUNDINGREFERENCES |
|---|
Previous studies from this laboratory have implicated the expression of the third isoform of metallothionein (MT-3) in the maintenance of proximal tubular vectorial active ion transport. It was shown that HK-2 cells have no expression of MT-3 and do not form domes in culture; whereas, the human proximal tubular (HPT) cells and HK-2 cells stably transfected with MT-3 [HK-2(MT-3)] form these structures. In the present study, this association was further explored by determining the effect of MT-3 expression on the expression of the E -, P -, N -, K -, and Ksp-cadherins. It was demonstrated that the HPT cells and HK-2(MT-3) cells had significant elevations in the expression of messenger RNA and protein for the E -, P -, and Ksp-cadherins compared with that of the HK-2 cells transfected with the blank vector [HK-2(blank vector)]. In contrast, the HK-2(blank vector) cells had significantly elevated expression of N- and K-cadherin compared with both the HPT and HK-2(MT-3) cell lines. These patterns of cadherin expression provide strong evidence that MT-3 might be involved in epithelial to mesenchymal transition that is postulated to occur during several disease states and in the mesenchymal to epithelial transition that occurs during normal kidney morphogenesis. A final goal of the study was to determine if Cd+2 exposure influenced vectorial active transport of the proximal tubular cells and if this might occur through alterations in the expression of MT-3. It was shown that exposure to Cd+2 eliminated vectorial active transport by the proximal tubular cell lines, but that Cd+2 exposure did not reduce the expression of the MT-3 protein. The study shows that the level of MT-3 expression in HPT cells influences transepithelial resistance and cadherin expression but does not influence the Cd+2-induced loss of vectorial active transport.
Key Words: active transport; proximal tubular; cadmium; cadherins; tight junctions; metallothionein.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONFUNDINGREFERENCES |
|---|
The third isoform of metallothionein (MT-3) was first identified as a brain-specific MT possessing neuronal growth inhibitory properties (Palmiter et al., 1992
; Tsuji et al., 1992; Uchida et al., 1991). Subsequent studies by this laboratory demonstrated that MT-3 was also expressed in the human kidney (Garrett et al., 1999). A previous study by this laboratory has also shown that mortal cell cultures retaining properties of the human proximal tubular (HPT) cells have basal expression of MT-3 messenger RNA (mRNA) and protein, whereas, an HPV-immortalized model of HPT cells (HK-2) have no basal expression of MT-3 (Kim et al., 2002). It is the laboratory's assumption that the HK-2 cells had lost the expression of MT-3 due to immortalization by the E6/E7 genes of HPV because it can be shown that MT-3 is expressed in the human kidney in situ, and the expression is retained in mortal cultures of HPT cells (Garrett et al., 1999). The failure of the HK-2 cells to express MT-3 has allowed the laboratory to use a stable transfection strategy to determine the effects reintroduction of MT-3 expression has on the properties of the HK-2 cell line. This strategy was used successfully to demonstrate that MT-3 was involved in the ability of the proximal tubular cell to maintain vectorial active transport (Kim et al., 2002). In this study, it was shown that HPT cell cultures form "domes" whereas HK-2 cells do not form these structures (Kim et al., 2002). Domes are a hallmark of cell cultures derived from transporting epithelium that retain the in situ property of vectorial active transport. In this study, it was demonstrated that stable transfection of the HK-2 cells with MT-3, but not MT-1E, re-established dome formation by the HK-2 cells and enhanced the epithelial appearance of the cell monolayer. Dome formation in epithelial cell cultures is acceptable presumptive evidence of the following processes that are required for its expression: functional plasma membrane polarization, formation of occluding junctions (tight junctions), and vectorial transepithelial active ion transport. Each of these properties has been demonstrated for the HPT cells (Sens et al., 1999). The HK-2 cells have been shown to have two of these requirements, but functional tight junctions have not been identified in this cell line (Ryan et al., 1994). As such, the first goal of the present study was to determine if MT-3 expression mediates the formation of tight junctions between HK-2 cells. A second goal was to determine if MT-3 influenced the expression of the cadherins and related proteins known to be involved in the formation and maintenance of tight junctions, as well as in the mesenchymal to epithelial transition (MET) that occurs during kidney morphogenesis (Peinado et al., 2004). A final goal of the study was to determine if Cd+2 exposure influenced vectorial active transport of the proximal tubular cells and if this might occur through alterations in the expression of MT-3. |
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONFUNDINGREFERENCES |
|---|
Cell culture.
Stock cultures of HPT and HK-2 cells for use in experimental protocols were grown using serum-free conditions as previously described by this laboratory (Detrisac et al., 1984
; Kim et al., 2002). The growth formulation consisted of a 1:1 mixture of Dulbecco's modified Eagles’ medium and Ham's F-12 growth medium supplemented with selenium (5 ng/ml), insulin (5 µg/ml), transferrin (5 µg/ml), hydrocortisone (36 ng/ml), triiodothyronine (4 pg/ml), and epidermal growth factor (10 ng/ml). The cells were fed fresh growth medium every 3 days, and at confluence, the cells were subcultured using trypsin–ethylenediaminetetraacetic acid (0.05%, 0.02%). The procedures for the stable transfection of the HK-2 cells with the MT-3 and MT-1E coding sequences under the control of the CMV promoter have been detailed previously (Kim et al., 2002; Somji et al., 2004). For use in experimental protocols, cells were subcultured at a 1:2 (HPT) and a 1:4 (HK-2) ratio, allowed to reach confluence (9 days following subculture) and then used in the described experimental protocols. HK-2 cells stably transfected with MT-3 and MT-1E coding sequences are designated as HK-2(MT-3) and HK-2(MT-1E) respectively, whereas those transfected with the blank vector are designated as HK-2(blank vector).
siRNA-mediated gene silencing.
The small interfering RNA (siRNA) sequences used for MT-3 silencing, and the protocol used for transfection of the HPT cells, have been described previously (Somji et al., 2006). The sequences chosen to target reside far down the 3' untranslated region of the MT-3 mRNA. The siRNAs were transfected into HPT cells using the Amaxa Nucleofector apparatus with the Basic Nucleofection Kit for Primary Mammalian Epithelial cells (Amaxa, Cologne, Germany). Dome formation and MT-3 mRNA levels were determined 5 days after the cells had reached confluency by point counting the number of domes in 20 low power microscopic fields and by real-time PCR, respectively.
Measurement of transepithelial resistance.
HK-2(MT-3) cells were seeded at a 2:1 ratio in triplicate onto 30-mm-diameter cellulose ester membrane inserts (Corning) placed in six-well trays. For HPT cells, these filters were coated with collagen I similar to that reported previously (Sens et al., 1999). Beginning on the third day postseeding, transepithelial resistance (TER) was measured every other day with the EVOM Epithelial Voltohmmeter (World Precision Instruments, Sarasota, FL) with a STX2 electrode set according to the manufactures instructions. This instrument measures the resistance to an alternating current flow through the filter containing the monolayer of cells. The resistance of the bare filter containing medium was subtracted from that obtained from filters containing cell monolayers. Two sets of four readings were taken at two different locations on each filter. The development of the monolayer in parallel six-well trays was monitored for dome formation. Development of resistance routinely occurred 4-7 days postseeding in the MT-3 expressing HK-2 or HPT cells and generally correlated to the appearance of domes viewed in parallel cultures. The experiment was repeated twice in triplicate and the final result is reported as the mean ± SE.
Real-time analysis of MT-3 and cadherin mRNA expression.
The measurement of MT-3 mRNA expression was assessed with real-time reverse transcription PCR (RT-PCR) utilizing previously described MT-3 isoform-specific primers (Somji et al., 2006). The measurement of N-cadherin, E-cadherin, P-cadherin, K-cadherin, and Ksp-cadherin was also assessed using real-time RT-PCR and commercially available primers (Qiagen Company, Valencia, CA). The method for the preparation of total RNA using Tri Reagent (Molecular Research Center, Inc., Cincinnati, OH) has been described previously (Garrett et al., 1998). For analysis, 1 µg of total RNA was subjected to complimentary DNA (cDNA) synthesis using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules CA) in a total volume of 20 µl. Real-time PCR was performed utilizing the SYBR Green kit (Bio-Rad Laboratories) with 2 µl of cDNA, 0.2µM primers in a total volume of 20 µl in an iCycler iQ real-time detection system (Bio-Rad Laboratories). For MT-3, amplification was monitored by SYBR Green fluorescence and compared with that of a standard curve of the MT-3 isoform gene cloned into pcDNA3.1/hygro (+) and linearized with FspI. Cycling parameters consisted of denaturation at 95°C for 30 s and annealing at 65°C for 45 s, which gave optimal amplification efficiency of each standard. The level of MT-3 expression was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) assessed by the same assay with the primer sequences being sense: TCCTCTGACTTCAACAGCGACAC and antisense: CACCCTGTTGCTGTAGCCAAATTC with a product size of 126 base pairs. For the cadherins, amplification was monitored by SYBR Green fluorescence. Cycling parameters consisted of denaturation at 95°C for 15 s, annealing at 55°C for 30 s and extension at 72°C for 30 s, which gave optimal amplification efficiency of each cadherin isoform. The level of cadherin expression was compared with that of G3PDH using the primer sequence described above. The relative level of each cadherin gene was interpolated from a standard curve of one RNA sample (HK-2 [MT-3] except in case of E-cadherin where one sample of HPT was used instead) prepared by serially diluting the cDNA reaction. G3PDH was used for normalization and each cell line was analyzed as the mean ± SE of three parallel cell culture samples.
MT protein determination.
The immunoblot protocol used for the determination of the levels of MT-3 protein in cell lysates has been described previously by this laboratory (Garrett et al., 1999).
Western analysis of cadherin expression.
Confluent cultures were harvested in 2% sodium dodecyl sulfate (SDS) and 50mM Tris–HCl, pH 6.8, followed by boiling for 10 min and DNA shearing through a 23-gauge needle. Protein concentration was determined by the bicinchoninic acid protein assay (Pierce Chemical, Rockford, IL) before 100mM dithiotreitol was added to each sample. Twenty micrograms of total cellular protein was separated on an SDS–polyacrylamide gel electrophoresis gel and transferred to a hybond-P Polyvinylidene difluoride membrane (Amersham Biosciences, UK). Membranes were blocked in antibody dilution buffer (Tris-buffered saline containing 0.1% Tween-20 [TBS-T] and 5% [wt/vol] nonfat dry milk) for 1 h at room temperature. After blocking, the membranes were probed with the appropriate primary antibody in blocking buffer: N-cadherin, 0.5 µg/ml (Zymed Laboratories, San Francisco, CA); E-cadherin, 1:250 (Santa Cruz Biotechnology, Santa Cruz, CA); P-cadherin 1:250 (Santa Cruz Biotechnology); K-cadherin, 1:250 (Abcam, Cambridge, MA); and Ksp-cadherin, 1 µg/ml (Zymed Laboratories) overnight. After washing three times in TBS-T, membranes were incubated with the appropriate antimouse or anti-rabbit antibody (1:2000) in antibody dilution buffer for one h. The blots were visualized using the Phototope-HRP Western blot detection system (Cell Signaling Technology, Beverly, MA).
Statistical analysis.
All experiments were performed in triplicate and the results are expressed as the standard error of the mean. Statistical analyses were performed using Systat software using separate variance t-tests, analysis of variance with Tukey post hoc testing. Unless otherwise stated, the level of significance was p < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONFUNDINGREFERENCES |
|---|
Inhibition of MT-3 Expression Reduces Dome Formation by HPT Cells
The laboratory has previously shown that the reintroduction of MT-3 by stable transfection into HK-2 cells induced dome formation, but it had not been determined if a reduction of MT-3 expression would inhibit dome formation in HPT cells. The goal of this determination was to perform this corollary experiment and determine if the inhibition of MT-3 expression would reduce dome formation by the HPT cells. Inhibition of MT-3 was achieved using siRNA directed against the 3' nontranslated region of the MT-3 gene. Anti-laminin siRNA was used as a control. The HPT cells were allowed to attain confluency and then removed from the culture dish by trypsin treatment and siRNA introduced by electroporation. The treated cells were then replated at confluency and dome formation monitored using an inverted microscope over a 7-day period. Preliminary studies demonstrated that dome formation reached a peak by day 4 for all treatment groups and remained at this level for 3 additional days. At day 5, the number of domes was determined by point counting of 20 low power microscopic fields for each well. Following the determination of the number of domes, the cultures were used for the isolation of total RNA. The results demonstrated that expression of MT-3 isoform-specific mRNA was reduced 2.5-fold by anti-MT-3 siRNA treatment (Fig. 1A). The control which used anti-lamin siRNA had no effect on the expression of MT-3 mRNA. It was also shown that dome formation was reduced 3.0 fold by anti MT-3 siRNA and that control siRNA had no effect on dome formation (Fig. 1B). This experiment was made possible by the fact that siRNA can remain effective for up to three weeks in nondividing cells (Bartlett and Davis, 2006
).
|
TER of HK-2(blank vector), HK-2(MT-3), HK-2(MT-1E), and HPT Cells
The TER was determined on confluent cultures of HPT cells, HK-2 cells transfected with the blank vector and HK-2 cells transfected with the MT-3 and MT-1E coding sequences. The results demonstrated that both the HPT cells and the HK-2(MT-3) cells displayed TERs of 480 and 572 Ohms·cm2, respectively (Table 1). In contrast, HK-2(blank vector) and HK-2(MT-1E) cells displayed markedly reduced values of TER that were not significantly different from those obtained using a filter with no cells (Table 1).
|
Cadherin mRNA Expression by HPT, HK-2(blank vector), and HK-2(MT-3) Cells
Five cadherin family members were analyzed for mRNA expression using real-time PCR and total RNA from confluent cultures of the HPT, HK-2(blank vector), and HK-2(MT-3) cell lines; N-cadherin, E-cadherin, P-cadherin, K-cadherin, and Ksp-cadherin. The expression of mRNA for N-cadherin was near the limit of detection for both the HPT and HK-2(MT-3) cell lines (Fig. 2A); however, the HK-2(blank vector) cells exhibited markedly increased levels of N-cadherin mRNA compared with either the HPT or HK-2(MT-3) cells (Fig. 2A). In contrast, the expression of E-cadherin mRNA was near the limit of detection for HK-2(blank vector) cells (Fig. 2B). The expression of E-cadherin mRNA was significantly increased in the HK-2(MT-3) cells compared with the HK-2(blank vector) cells, but significantly below the levels noted in HPT cells (Fig. 2B). The E-cadherin mRNA expression in HPT cells was significantly elevated compared with both HK-2(blank vector) cells and the HK-2(MT-3) cells (Fig. 2B). The expression pattern of P-cadherin was similar to that of E-cadherin, being found at a very low level in HK-2(blank vector) cells, and significantly elevated level in both HPT and HK-2(MT-3) cells, with expression in HPT cells being significantly higher than either that of the HK-2(blank vector) or HK-2(MT-3) cells (Fig. 2C). The expression of K-cadherin was significantly elevated in HK-2(blank vector) cells compared with both the HPT and HK-2(MT-3) cells (Fig. 2D). The expression of K-cadherin was similar between the HPT and HK-2(MT-3) cells. The expression of Ksp-cadherin was significantly elevated in HK-2(MT-3) cells compared with both HK-2(blank vector) and HPT cells (Fig. 2E). The expression of Ksp-cadherin in HPT cells was significantly reduced compared with the HK-2(MT-3) cells and significantly elevated compared with HK-2(blank vector) cells.
|
Cadherin Protein Expression by HPT, HK-2(blank vector), and HK-2(MT-3) Cells
The above five cadherin family members were also analyzed for protein expression by western analysis of protein lysates prepared from confluent cultures of HPT, HK-2(blank vector), and HK-2(MT-3) cells. The level of N-cadherin protein was shown to be markedly elevated in the HK-2(blank vector) cells compared with both HPT and HK-2(MT-3) cells (Fig. 3A). In contrast, both E-cadherin and P-cadherin protein levels were shown to be markedly elevated in the HPT and HK-2(MT-3) cells compared with the HK-2(blank vector) cells (Figs. 3B and 3C). The level of K-cadherin protein was elevated in the HK-2(blank vector) cells compared with both the HPT cells and the HK-2(MT-3) cells (Fig. 3D). It was also demonstrated that K-cadherin levels were elevated in HK-2(MT-3) cells compared with that found in the HPT cells. There was clear expression of Ksp-cadherin in all three cell lines with the HK-2(MT-3) cells having a higher level of expression than the HK-2(blank vector) or HPT cells (Fig. 3E).
|
Effect of Cd+2 Exposure on HK-2(MT-3) Dome Formation and TER
The HK-2(MT-3) cells were exposed to a nontoxic dose of Cd+2 to determine if exposure would have an effect on dome formation and TER of the cells. The cells were exposed to 0.45 and 0.90µM Cd+2 for four serial passages. The cells were fed fresh growth medium containing Cd+2 every 3 days and subcultured 4 days after reaching confluency. The number of domes and light microscopic pictures of the monolayers were determined the day of subculture, or for the final passage, the day the cells would have been normally subcultured to new flasks. The results showed that exposure to 0.45µM Cd+2 had no effect on the ability of the HK-2(MT-3) cells to form domes for the initial three subcultures, but caused a complete loss of dome formation of the fourth passage (Table 2). The HK-2(MT-3) cells exposed to 0.9µM Cd+2 exhibited reduced dome formation during the initial exposure to Cd+2 and no dome formation at subsequent passages (Table 2). The TER of the HK-2(MT-3) monolayers exposed to Cd+2 paralleled the degree of dome formation (Table 2). Cultures having few or no domes displayed reduced or no TER compared with control cells and those displaying domes had resistance values in the range of 500 Ohms·cm2 similar to control cells (Table 2). The light level morphology of the cells was recorded at the end point of passages 1 and 4 for the control cells and those exposed to 0.45 and 0.9µM Cd+2 (Figs. 4A-F). The light micrographs show that the reduction in dome formation due to Cd+2 exposure occurred even though the cells were at confluency and had no evidence of any loss in cell viability (i.e., rounded or floating cells). The only alteration in light level morphology was that the cells on the highest level of Cd+2 at passage 4 (Fig. 4F) appear to form a cell monolayer that is less tightly packed than control cells or Cd+2-treated cells able to form domes.
|
|
Effect of Cd+2 Exposure on the Expression of MT-3 in HK-2(MT-3) Cells
Total RNA and protein were prepared from the HK-2(MT-3) cells exposed to 0.45 and 0.9µM Cd+2 over the four passage time course described above for the examination of dome formation and TER. An analysis of MT-3 mRNA expression demonstrated that exposure to Cd+2 had no consistent effect on the expression of MT-3 mRNA (Figs. 5A–C). For cells at passage 1 (P1), the MT-3 mRNA levels were not significantly different between control and Cd+2 exposed cells (Fig. 5A). For cells at passage 2 (P2), MT-3 mRNA was significantly elevated in cells exposed to 0.9µM Cd+2 (Fig. 5B). For cells at passage 3 (P3), MT-3 mRNA was reduced significantly for cells exposed to both concentrations of Cd+2 (Fig. 5C). For cells at passage 4 (P4), MT-3 mRNA was significantly increased for cells exposed to 0.9µM Cd+2 (Fig. 5D). A corresponding analysis of MT-3 protein expression showed no significant differences in expression at any of the four passages or Cd+2 concentrations, with expression varying between 5.10 and 7.16 ng MT-3 protein/µg total protein (data not shown).
|
Effect of Cd+2 Exposure on Dome Formation, TER, and the Expression of MT-3 in HPT Cells
Previous studies from this laboratory have shown that the level of MT-3 mRNA and protein in HPT cells is transiently induced by exposure to Cd+2 with a return to control values over a 16-day period of exposure (Garrett et al., 2002
). In the present experiment, the goal was to determine if a similar exposure of the HPT cells to Cd+2 resulted in a loss of dome formation and TER without any alteration in the level of MT-3 mRNA and protein expression. The number of domes and the TER was determined following 7 days of exposure to 1.0, 4.5, or 9.0µM Cd+2. The results showed that the number of domes formed by the HPT cells was reduced compared with control for all three concentrations of Cd+2 (Fig. 6). The TER was also reduced compared with control for all three concentrations of Cd+2 (Fig. 6). A corresponding analysis of MT-3 mRNA and protein expression confirmed the previous study which showed no reduction in MT-3 mRNA and protein expression compared with control over a 16-day period of Cd+2 exposure (data not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONFUNDINGREFERENCES |
|---|
This laboratory has previously shown that reintroduction of MT-3 into the HK-2 cell line leads to the formation of domes, structures that are accepted evidence for the retainment of vectorial active ion transport. The requirements for dome formation are functional plasma membrane polarization, the presence of occluding junctions and vectorial transepithelial active ion transport. The HK-2 cell line was derived from primary cultures of HPT cells and immortalized by transfection with the HPV E6/E7 genes (Ryan et al., 1994
). These cells have been shown to be immortal, nontumorigenic, and to produce monolayer cell cultures. They have also been shown to retain many features expected of cells derived from the proximal tubule, including sodium dependent glucose transport, the expected response to cyclic adenosine monophosphate stimulation by PTH and arginine vasopressin, as well as the specialized proteins expected to be present on the apical membrane of the proximal tubule. The HK-2 cells have not been shown to possess tight junctions between adjacent cells and this might account for the inability of these cells to form domes. The finding in the present study that stable transfection with MT-3 resulted in an increase in transepithelial electrical resistance of the cell monolayer confirms that dome formation was due to the re-establishment of tight junctions in the HK-2(MT-3) cell line. The determination of TER is a well-established method to measure tight junction presence and ionic permeability (Diamond, 1977; Stevenson et al., 1988). It was also shown that the transepithelial electrical resistance developed by the HK-2(MT-3) cells was similar to that of the HPT cells. It has been shown previously that the HPT and HK-2(MT-3) cells express 0.9 and 8.1 ng MT-3 per µg total protein, respectively (Somji et al., 2004). Specificity for MT-3 was also suggested by the finding that HK-2 cells transfected with the MT-1E coding sequence developed no transepithelial electrical resistance. That dome formation in the HPT cells is likewise influenced by MT-3 expression was shown by the reduction in dome formation found when MT-3 expression was inhibited by treatment with siRNA.
The apical junction complex, which mediates paracellular permeability and polarity of the proximal tubule, is composed of the tight junction, the adherens junction, and the desmosome (Miyoshi and Takai, 2005). As a first step in attempting to define a role for MT-3 in the formation and/or maintenance of the apical junction complex it was decided to examine the expression of E-cadherin. The cadherins are a protein family consisting of over 80 members and are key transmembrane proteins of the adherens junction (Perez-Moreno et al., 2003). E-cadherin was chosen for examination because it is primarily expressed in epithelia and is the prototype and best characterized member of the cadherin family (Miyoshi and Takai, 2005). E-cadherin is involved in the development of the adherens junctions and is involved in the initial cell–cell contacts, serves as a precursor for the establishment of the tight junctions at the apical side of the adherens junctions and as a gathering point for companion molecules in epithelial cells (Miyoshi and Takai, 2005; Nagafuchi, 2001). The finding in the present study that E-cadherin was not expressed in HK-2 cells, but was expressed in both HK-2(MT-3) cells and HPT cells suggested that MT-3 might be involved in epithelial to mesenchymal transition (EMT) that is postulated to occur during disease states such as cancer or renal fibrosis (Lee et al., 2006; Peinado et al., 2004) and in the MET that occurs during normal kidney morphogenesis (Peinado et al., 2004). The simplest view of cadherin expression and EMT is that the E- and N-cadherins are historically considered the prototypic cadherins in epithelial and mesenchymal cells, respectively. During development E-cadherin is maintained in all epithelial tissues but is silenced during the process of EMT and in established mesenchymal cells where it is replaced by the expression of N-cadherin (Nakagawa and Takeichi, 1995). Loss of function studies have demonstrated that E-cadherin is crucial for early mouse development and the maintenance of epithelial morphology (Larue et al., 1996). Similar studies on N-cadherin have shown that it is required for cardiogenesis, somitogenesis, and the correct development of the nervous system (Larue et al., 1996; Radice et al., 1997). The finding the N-cadherin was highly expressed in HK-2(blank vector) cells but not HK-2(MT-3) and HPT cells would be consistent with proposing a role of MT-3 in the process of EMT and MET. This would also be consistent with the absence of tight junctions in HK-2(blank vector) cells and their less polarized morphology when compared with the HK-2(MT-3) cells and the HPT cells (Kim et al., 2002). However, the HK-2 cells cannot be viewed as fully stromal (mesenchymal) because they do retain many differentiated features of the proximal tubule. As such, they may also serve as a useful model in determining the intermediate steps that occur in EMT and MET.
The expression of K-cadherin, Ksp-cadherin and P-cadherin were also analyzed in the HK-2(blank vector), HK-2(MT-3), and HPT cells and results were consistent with a role for MT-3 in EMT and MET. The expression of K-cadherin protein was elevated in HK-2(blank vector) cells, moderate in HK-2(MT-3) cells and low in HPT cells. This is in agreement with studies showing K-cadherin to be the major adhesion molecule involved in the conversion of mesenchymal cells into an epithelium in the kidney with the expression induced during the late mesenchymal stage, extending to the proximal tubule progenitor cells and the expression down regulated in mature proximal tubular cells (Cho et al., 1998). Apparently the requirement for this cadherin is during the early phases of the MET (Dahl et al., 2002; Mah et al., 2000). The expression of K-cadherin is often induced again during renal cell carcinoma and has been proposed as a prognostic indicator for this cancer (Dahl et al., 2002; Peinado et al., 2004). The Ksp-cadherin has also been shown to be involved in epithelial kidney morphogenesis and is specifically expressed in renal tubular epithelial cells (Dahl et al., 2002). The HK-2(MT-3) and HPT cells were shown to have enhanced expression of Ksp-cadherin compared with the HK-2 cells. The expression of P-cadherin was similar to that of E-cadherin among the cell lines and P-cadherin has been found to be coexpressed with E-cadherin in MDCK cells (Wu et al., 1993). The only major difference noted in the expression of the five cadherins between the HPT and HK-2(MT-3) cells was that the abundance of mRNAs for the E- and P-cadherins were much lower in the HK-2(MT-3) cells compared with the HPT cells. This difference was not apparent in the expression of the respective proteins. These results provide evidence that MT-3 may have a yet to be defined role in EMT and MET of the human kidney.
The final goal of the study was to determine if Cd+2 exposure reduced the TER of the proximal tubular cells, and if so, if MT-3 expression might be involved in the reduced transepithelial transport. Past studies have defined the effect of Cd+2 exposure on the expression of MT-3 mRNA and protein in the HK-2 and HPT cells as well as the effects of exposure on necrotic and apoptotic cell death (Garrett et al., 2002; Kim et al., 2002; Somji et al., 2004). The results of the study clearly demonstrated that Cd+2 exposure did result in the loss of the ability of the proximal tubular cells to form domes and a corresponding loss of TER of the cell monolayers. The results were also conclusive that the reductions in dome formation and TER due to Cd+2 exposure were independent of the expression level of the MT-3 protein. The results showed that Cd+2 exposure elicited no reduction in the expression of the MT-3 protein in either HPT cells or HK-2 cells stably transfected to overexpress the MT-3 gene over several serial passages of exposure to Cd+2. In both instances, the loss of dome formation and TER occurred early in the time course of exposure. The present study does not rule out a potential role for MT-3 that might involve the replacement of Zn+2 by Cd+2 in the molecule and a subsequent effect of this metal substitution on the expression or interaction with the junctional proteins. The MT's are well-known for their role as metal-binding proteins and for their protective affects against heavy metal induced toxicity, including Cd+2-induced nephrotoxicity (Andrews, 2000). One of the earliest signs of acute cadmium toxicity in proximal tubular cell cultures is the separation of cells from one another with a loss of E-cadherin from the cell-to-cell contacts (Prozialeck and Niewenhuis, 1991a, b). These, and many subsequent studies, have shown that acute Cd+2 exposure can disrupt cadherin dependent cell–cell junctions in a variety of cells (Prozialeck, 2000). These observations have led to the hypothesis that the cadherin–catenin complex may be a primary target of Cd+2-induced toxicity (Prozialeck et al., 2002). However, the exact mechanisms by which Cd+2 might affect the cadherin–catenin complex have not been elucidated to date. The current observations that MT-3 can influence the expression of the cadherins and the EMT status of the proximal tubular cell may provide an additional mechanism through which MT-3 can also influence the expression of E-cadherin when the cell monolayer is exposed to Cd+2. It has been shown previously that MT-3 undergoes a transient induction shortly after exposure to Cd+2 and then returns to control levels (Kim et al., 2002). The transient induction of MT-3 by Cd+2 also follows closely the time scale of the corresponding induction of the early response genes (Garrett et al., 2002). The induction of the early response genes has also been shown to correlate with the Cd+2-induced reorganization of E-cadherin in renal epithelial cells (Prozialeck et al., 2002). One can hypothesize that the transient induction of MT-3 expression would provide the opportunity for newly synthesized MT-3 to bind Cd+2 instead of Zn+2. This new pool of MT-3, where Zn+2 is replaced by Cd+2, might affect the properties of MT-3 that could interact with junctional proteins, and in doing so, alter the cadherin expression and polarity of the proximal tubular cell. This mechanism is attractive because it would provide an intracellular route for Cd+2 to influence E-cadherin function in heavy metal toxicity. A recent study has defined the binding partners of MT-3 in neural tissue (Lahti et al., 2005), however, the testing of our hypothesis will require the definition of the binding partners of MT-3 in the renal system.
|
FUNDING |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONFUNDINGREFERENCES |
|---|
National Institutes of Environmental Health Sciences, National Institutes of Health grants (R01 ES11333, R01 ES015100).
|
ACKNOWLEDGMENTS |
|---|
This project's contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Institutes of Environmental Health Sciences, National Institutes of Health.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONFUNDINGREFERENCES |
|---|
Andrews GK. Regulation of metallothionein gene expression by oxidative stress and metal ions. Biochem. Pharmacol. (2000) 59:95–104.[CrossRef][Web of Science][Medline]
Bartlett DW, Davis ME. Insights into the kinetics of siRNA-mediating silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res. (2006) 34:322–333.
Cho EA, Patterson LT, Brookhiser WT, Mah S, Kintner C, Dressler GR. Differential expression and function of cadherin-6 during renal epithelial cell development. Development (1998) 125:803–812.[Abstract]
Dahl U, Sjodin A, Larue L, Radice GL, Cajander S, Takeichi M, Kemler R, Semb H. Genetic dissection of cadherin function during nephrogenesis. Mol. Cell. Biol. (2002) 22:1474–1487.
Detrisac CJ, Sens MA, Garvin AJ, Spicer SS, Sens DA. Tissue culture of human kidney epithelial cells of proximal tubule origin. Kidney Int. (1984) 25:383–390.[Web of Science][Medline]
Diamond J. Twenty-first Bowditch lecture. The epithelial junction: Bridge, gate and fence. Physiologist (1977) 20:10–18.[Medline]
Garrett SH, Sens MA, Todd JH, Somji S, Sens DA. Expression of MT-3 protein in the human kidney. Toxicol. Lett. (1999) 105:207–214.[CrossRef][Web of Science][Medline]
Garrett SH, Phillips V, Somji S, Sens MA, Dutta R, Park S, Kim D, Sens DA. Transient induction of metallothionein isoform 3 (MT-3), c-fos, c-jun and c-myc in human proximal tubule cells exposed to cadmium. Toxicol. Lett. (2002) 126:69–80.[CrossRef][Web of Science][Medline]
Garrett SH, Somji S, Todd JH, Sens DA. Exposure of human proximal tubule cells to Cd+2, Zn+2, and Cu+2 induces metallothionein protein accumulation, but not metallothionein isoform 2 mRNA. Environ. Health Perspect. (1998) 106:587–595.[Web of Science][Medline]
Kim D, Garrett SH, Sens MA, Somji S, Sens DA. Metallothionein isoform 3 and proximal tubule vectorial active transport. Kidney Int. (2002) 61:464–472.[CrossRef][Web of Science][Medline]
Lahti DW, Hoekman JD, Tokheim AM, Martin BL, Armitage IM. Identification of mouse brain proteins associated with isoform 3 of metallothionein. Protein Sci. (2005) 14:1115–1157.[CrossRef][Web of Science][Medline]
Larue L, Antos C, Butz S, Huber O, Delmas V, Dominis M, Kemler R. A role for cadherins in tissue formation. Development (1996) 122:3185–3194.[Abstract]
Lee DBN, Huang E, Ward HJ. Tight junction biology and kidney dysfunction. Am. J. Physiol. (2006) 290:F20–F34.[Web of Science]
Mah SP, Saueressing H, Goulding M, Kintner C, Dressler GR. Kidney development in cadherin-6 mutants: Delayed mesenchyme-to-epithelial conversion and loss of nephrons. Dev. Biol. (2000) 223:38–53.[CrossRef][Web of Science][Medline]
Miyoshi J, Takai Y. Molecular perspective on tight junction assembly and epithelial polarity. Adv. Drug Deliv. Rev. (2005) 57:815–855.[CrossRef][Web of Science][Medline]
Nagafuchi A. Molecular architecture of adherens junctions. Curr. Opin. Cell Biol. (2001) 13:600–603.[CrossRef][Web of Science][Medline]
Nakagawa S, Takeichi M. Neural crest cell-cell adhesion controlled by sequential and subpopulation-specific expression of novel cadherins. Development (1995) 121:1321–1332.[Abstract]
Palmiter RD, Findley SD, Whitmore TE, Durnam DM. MT-III, a brain-specific member of the metallothionein gene family. Proc. Natl. Acad. Sci. U. S. A. (1992) 89:6333–6337.
Peinado H, Portillo F, Cano A. Transcriptional regulation of cadherins during development and carcinogenesis. Int. J. Dev. Biol. (2004) 48:365–375.[CrossRef][Web of Science][Medline]
Perez-Moreno M, Jamora C, Fuchs E. Sticky business: Orchestrating cellular signals at adherens junctions. Cell (2003) 112:535–548.[CrossRef][Web of Science][Medline]
Prozialeck WC. Evidence that E-cadherin may be a target for cadmium toxicity in epithelial cells. Toxicol. Appl. Pharmacol. (2000) 164:231–249.[CrossRef][Web of Science][Medline]
Prozialeck WC, Grunwald GB, Dey PM, Reuhl KR, Parrish AR. Cadherins and NCAM as potential targets in metal toxicity. Toxicol. Appl. Pharmacol. (2002) 182:255–265.[CrossRef][Web of Science][Medline]
Prozialeck WC, Niewenhuis RJ. Cadmium (Cd+2) disrupts intercellular junctions and actin filaments in LLC-PK1 cells. Toxicol. Appl. Pharmacol. (1991a) 107:81–97.[CrossRef][Web of Science][Medline]
Prozialeck WC, Niewenhuis RJ. Cadmium disrupts Ca+2 dependent cell-cell junctions and alters the pattern of E-cadherin immunofluorescence in LLC-PK1 cells. Biochem. Biophys. Res. Commun. (1991b) 181:1118–1124.[CrossRef][Web of Science][Medline]
Radice GL, Rayburn H, Matsunami H, Knudsen KA, Takeichi M, Hynes RO. Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol. (1997) 181:64–87.[CrossRef][Web of Science][Medline]
Ryan MJ, Johnson G, Kirk J, Fuerstenberg SM, Zager RA, Torok-Storb B. HK-2: An immortalized proximal tubule epithelial cell line from normal adult human kidney. Kidney Int. (1994) 45:48–57.[Web of Science][Medline]
Sens DA, Detrisac CJ, Sens MA, Rossi MR, Wenger SL, Todd JH. Tissue culture of human renal epithelial cells using a defined serum-free formulation. Exp. Nephrol. (1999) 7:344–352.[CrossRef][Web of Science][Medline]
Somji S, Garrett SH, Sens MA, Gurel V, Sens DA. Expression of metallothionein isoform 3 (MT-3) determines the choice between apoptotic or necrotic cell death in Cd+2-exposed human proximal tubule cells. Toxicol. Sci. (2004) 80:358–366.
Somji S, Garrett SH, Sens MA, Sens DA. The unique N-terminal sequence of metallothionein-3 is required to regulate the choice between apoptotic or necrotic cell death of human proximal tubule cells exposed to Cd+2. Toxicol. Sci. (2006) 90:369–376.
Stevenson BR, Anderson JM, Bullivant S. The epithelial tight junction: Structure, function and preliminary biochemical characterization. Mol. Cell. Biochem. (1988) 83:129–145.[Web of Science][Medline]
Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T. Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. (1992) 11:4843–4850.[Web of Science][Medline]
Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M. The growth inhibitory factor that is deficient in Alzheimer's disease is a 68 amino acid metallothionein-like protein. Neuron (1991) 7:337–347.[CrossRef][Web of Science][Medline]
Wu J-C, Gregory CW, DePhilip RM. P-cadherin and E-cadherin are co-expressed in MDCK cells. Biochem. Biophys. Res. Commun. (1993) 195:1329–1335.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||