Skip Navigation


ToxSci Advance Access originally published online on June 20, 2008
Toxicological Sciences 2008 105(2):286-294; doi:10.1093/toxsci/kfn122
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
105/2/286    most recent
kfn122v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zhou, L.
Right arrow Articles by Yang, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, L.
Right arrow Articles by Yang, Q.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please email: journals.permissions@oxfordjournals.org

Silencing of N-Ras Gene Expression Using shRNA Decreases Transformation Efficiency and Tumor Growth in Transformed Cells Induced by Anti-BPDE

Lanlan Zhou*, Yiguo Jiang*,1, Aijun Tan{dagger}, Anne R. Greenlee{ddagger}, Yuelan Shen*, Linhua Liu* and Qiaoyuan Yang*

* Institute for Chemical Carcinogenesis, State Key Laboratory of Respiratory Diseases, Guangzhou Medical College, Guangzhou 510182, China {dagger} Disease Control and Prevention Center of Zhuhai, Zhuhai 519000, China {ddagger} Eastern Oregon University and Center for Research on Occupational and Environmental Toxicology, La Grande, Oregon 97850

1 To whom correspondence should be addressed at Institute for Chemical Carcinogenesis, Guangzhou Medical College, 195 Dongfengxi Road, Guangzhou 510182, China. Fax: +86-20-8134-0724. E-mail: jiangyiguo{at}yahoo.com.

Received May 22, 2008; accepted June 11, 2008


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Anti-benzo[a]pyrene-trans-7,8-diol-9,10-epoxide (anti-BPDE) is the most important metabolite of benzo[a]pyrene which is a ubiquitous environmental pollutant, and may cause human cancer, especially of the lung. Ras genes (H, K, and N) are activated in 40% of human tumors and may contribute to carcinogenesis. Here, we used malignant human bronchial epithelial cells transformed by anti-BPDE (16HBE-T) to help characterize possible molecular mechanisms of carcinogenesis. We compared H-, K-, and N-Ras mRNA and protein expression levels in 16HBE-T cells and untransformed control 16HBE cells (16HBE-N), using reverse transcription–PCR (RT-PCR) and Western blotting. We further used short hairpin RNA to silence N-Ras gene expression in 16HBE-T cells to determine the effects of silencing on the cell cycle, transformation efficiency and tumor growth. We observed overexpression of H-, K-, and N-Ras genes at both mRNA and protein levels in 16HBE-T cells, compared with 16HBE-N cells. Silencing of N-Ras in 16HBE-T cells using stable RNA interference increased the proportion of cells in G0/G1 phase, decreased the proportion in S-phase, decreased transformation efficiency, and inhibited tumor growth. Our findings suggest that overexpression of N-Ras gene plays an important role in malignant transformation of 16HBE cells by anti-BPDE. N-Ras gene may be a useful target for gene therapy.

Key Words: anti-BPDE; short hairpin RNA; RNA interference; H-Ras, K-Ras, N-Ras; human bronchial epithelial cells; malignant transformation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Lung cancer is a major cause of death worldwide, with tobacco smoking being the primary risk factor. Each year, more than one million people are diagnosed with lung cancer, most of which is related to smoking (Parkin et al., 2001Go). Cigarette smoke contains numerous compounds, including components of benzo[a]pyrene (B[a]P). B[a]P is a polycyclic aromatic hydrocarbon generated by combustion and is found in significant amounts in tobacco smoke (Duarte and Paschoal, 2005Go; Pfeifer et al., 2002Go). B[a]P is a procarcinogen that requires metabolic activation by cytochrome P450–dependent oxidation and epoxide hydrolysis to form carcinogens (Chen et al., 2003Go; Kelley et al., 2005Go), including the metabolite anti-benzo[a]pyrene-trans-7,8-diol-9,10-epoxide (anti-BPDE). Animal studies have clearly shown that the tumorigenic activity of B[a]P is primarily attributable to its metabolite anti-BPDE. Studies by Gyorffy et al. (2004)Go, Li et al. (2001Go, 2007Go), and Rojas et al. (2001Go, 2004Go) suggest that anti-BPDE can bind to nuclear DNA and initiate carcinogenesis (Xie et al., 2003Go). However, the mechanism involved in anti-BPDE–induced tumorigenesis is not fully understood.

Human squamous cell carcinoma in the lung originates from bronchial epithelial cells. We have previously used the human bronchial epithelial cell line 16HBE to establish a malignant transformation model induced by anti-BPDE (Jiang et al., 2001Go). 16HBE cells retain the specific morphology and function of normal human bronchial epithelial cells (Gruenert et al., 1995Go), therefore, malignant 16HBE cells induced by anti-BPDE provide a suitable cell model system with which to study mechanisms of human lung carcinogenesis.

Molecular alterations that target inactivation of tumor suppressor genes and activation of proto-oncogenes play key roles in the development of multistage carcinogenesis (Spandidos, 2007Go). The Ras genes are an important family of proto-oncogenes, which is comprised of H-Ras, K-Ras, and N-Ras, all of which code for membrane-associated proteins with 188 amino acids (Friday and Adjei, 2005Go). These proteins act as "molecular switches" that link extracellular signals through membrane receptors to intracellular responses (Cox and Der, 2003Go; Downward, 2003Go). The Ras proteins cycle between inactive GDP-bound and biologically active GTP-bound forms in response to various signals. Activated Ras targets a number of downstream effectors and affects diverse cellular functions, including proliferation, differentiation, migration and apoptosis (Ehrhardt et al., 2002Go). Ras genes are activated in 40% of human tumors, including lung, pancreatic and colorectal cancer (Kim et al., 2002Go). Ras point mutations at codons 12, 13, and 61 alter the GTPase enzyme activity and may alter tumorigenic potential (Pronk and Bos, 1994Go). Most studies have focused on mutation analysis of the Ras gene family, especially K-Ras (Badalian et al., 2007Go; Ji et al., 2006Go; Keohavong et al., 2005Go). Point mutations play an important role in Ras gene activation. However, this is not the only means of promoting carcinogenesis. In vitro experiments have demonstrated that besides the mutation, the overproduction of Ras protein is sufficient to confer a transforming potential in cultured cells (Stacey and Kung, 1984Go). Moreover, experiments in human tumor specimens have shown that overexpression of Ras at the RNA and protein level is a consistent feature in a wide range of human cancers (Field and Spandidos, 1990Go). In addition, high expression of Ras genes has been detected in small-cell lung cancer cell lines (Khanzada et al., 2006Go) and cervical cancer (Mammas et al., 2004Go). However, no study has yet investigated the expression of the Ras gene family and its role in malignantly transformed human bronchial epithelial cells induced by the B[a]P metabolite anti-BPDE.

RNA interference (RNAi) is a sequence-specific posttranscriptional gene-silencing mechanism, which is triggered by double-stranded RNA (dsRNA), and causes degradation of mRNAs homologous in sequence to the dsRNA (Clark and Ding 2006Go; Willingham et al., 2004Go). RNAi is a powerful tool for studying gene function (Elbashir et al., 2002Go; Ovcharenko et al., 2005Go). In this study, we analyzed the expression of the Ras gene family in a malignantly transformed human bronchial epithelial cell line induced by anti-BPDE, and subsequently established an N-Ras-silencing model using short hairpin RNA (shRNA), to explore the role of N-Ras in carcinogenesis, by soft agar growth assay in vitro and tumor growth in vivo.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Cell culture.
The transformed 16HBE cells (16HBE-T), induced by anti-BPDE, and the untransformed control 16HBE cells (16HBE-N) were established in our laboratory as previously reported (Jiang et al., 2001Go). Briefly, to generate the 16HBE-T cell line, 16HBE cells (presented by Professor Jun Xu from Guangzhou Medical College, Guangzhou, China) received four 24-h treatments with anti-BPDE (98.3% purity, NCI Chemical Carcinogen Reference Standard Repository, Midwest Research Institute, Kansas City, MO) at a concentration of 2.0 µmol/l, followed by 30 passages in culture. The 16HBE-N control cells were treated with DMSO (Sigma, St Louis, MO) at a concentration equivalent to that used to create the 16HBE-T cells. The malignant features of 16HBE-T cells were assessed by culture on soft agar and tumorigenesis in nude mice. The 16HBE-N cells did not manifest these features (Jiang et al., 2001Go). Both cell lines were cultured in minimum essential medium (MEM; Gibco BRL, Grand Island, NY) supplemented with 10% calf serum, 100 IU penicillin G and 100 µg/ml streptomycin. The cells were maintained in 25-cm2 flasks in a humidified atmosphere containing 5% CO2 at 37°C. Cells were passaged by treating with 0.02% ethylenediaminetetraacetic acid and 0.25% trypsin (Gibco BRL) in D-Hanks buffer every 3 days.

Reverse transcription–PCR.
Total cellular RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. RNA concentration and quality were assessed by A260/280 (Eppendorf BioPhotometer, Germany), and the integrity was analyzed by electrophoresis on a 1% agarose gel. To determine the expression level of Ras genes in 16HBE-T cells, quantitative RT-PCR was used with the following isoform-specific primers: N-Ras (GenBank accession No. NM_002524 [GenBank] ) forward: 5'-GAAAAGCGCACTGACAATCC-3', reverse: 5'-CACCACACATGGCAATCCC-3'; H-Ras (NM_005343 [GenBank] ) forward: 5'-CAAGAGTGCGCTGACCATCC-3', reverse: 5'-CCGGATCTCACGCACCAAC-3'; K-Ras (M54968 [GenBank] ) forward: 5'-CACCATCTTCAGTGCCAGTC-3', reverse: 5'-TGTGGAAGGTAGGGAGGC-3'. As a control, the expression level of β-actin (NM_001101 [GenBank] ) was analyzed, using the following primers: forward 5'-CCATCGTCCACCGCAAAT-3', reverse 5'-TGCTCGCTCCAACCGACT-3'. The RT and amplification reactions were performed using a Promega Access RT-PCR kit (Promega, Southampton, UK). The RT conditions were 45°C for 45 min, followed by an initial denaturation step of 94°C for 2 min. The PCR conditions consisted of 30 cycles at 94°C for 30 s, 48.5°C (N-Ras and β-actin) or 52.5°C (H-Ras) or 47.5°C (K-Ras) for 1 min and 68°C for 2 min. The reaction ended with a final extension of 7 min at 68°C. The resultant PCR products were 510 bp (N-Ras), 448 bp (H-Ras), 123 bp (K-Ras), and 212 bp (β-actin). PCR products were electrophoresed on a 1.5% agarose gel and visualized by staining with ethidium bromide. For quantification, an image of the gel was captured, and the intensity of the bands was quantified using a Gel Doc 1000 gel analysis system (Tanon, Shanghai, China).

Western blotting and immunoprecipitation assay.
Total protein was extracted using cell lysis buffer (Cell Signaling Technology, Beverly, MA) from subconfluent cells growing in 75-cm2 plates. Adherent cells were washed with phosphate buffered saline (PBS) and lysed with 400 µl of 1x lysis buffer for 5 min on ice, then scraped into 1.5-ml centrifuge tubes and sonicated for 20 s. After removal of cell debris by centrifugation (4°C, 14,000 x g, 10 min), protein-containing supernatants were stored frozen or used immediately. Protein concentration was determined using the Bradford assay (Tiangen, Beijing, China) according to manufacturer's instructions. Fifty micrograms of protein were boiled for 5 min in loading buffer, separated using 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a PVDF membrane (Millipore Corp, Bedford, MA). The membrane was blocked with 5% nonfat dry milk in TBS-T buffer (20mM Tris, 500mM NaCl, 0.1% Tween 20) for 1 h at room temperature, with agitation. Target protein and β-actin were quantified on the same membrane by dividing the membrane into two pieces according to the molecular weight of prestained protein standards (Tiangen, Beijing, China). The membrane piece with higher molecular weight proteins was incubated with primary antibody against β-actin (Cell Signaling Technology) at 1:1000 dilution overnight at 4°C, whereas the other membrane piece was incubated with primary antibody against K-, H-, or N-Ras (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:100 dilution. After being washed three times with TBS-T for 10 min, the membranes were incubated with horseradish peroxidase (HRP)–labeled rabbit anti-mouse IgG (DakoCytomation, Ely, UK) at 1:1000 dilution, and HRP-conjugated goat anti-rabbit IgG (KPL, Baltimore, MD) at 1:250 dilution for 1 h at 37°C, with agitation, followed by three washes with TBS-T. Proteins were visualized using enhanced chemiluminescene (Cell Signaling Technology) and scanned with the Gel Doc 1000 gel analysis system (Tanon).

K- and H-Ras were immunoprecipitated using 500 µg whole-cell lysate protein by overnight incubation with anti-K-Ras or anti-H-Ras monoclonal antibody (1–2 µg antibody per 100–500 µg total protein), with gentle mixing on a shaker at 4°C. Immunocomplexes were collected following incubation with protein G plus/protein A agarose suspension (15 µl of suspension per microgram primary antibody) (Calbiochem, La Jolla, CA) for 1–3 h at 4°C. After washing four times with 1 ml of 1x lysis buffer, immunocomplexes were boiled for 5 min in 20 µl of 3x loading buffer. The samples were subjected to 15% SDS-PAGE, and Western blotting as described above.

Plasmid construction.
The cDNA sequence of N-Ras was obtained from Genbank (NM_002524 [GenBank] ) and four different targeting sequences were designed using Invitrogen's RNAi algorithm available on line (https://rnaidesigner.invitrogen.com/rnaiexpress/index.jsp). Sequences were verified using BLAST to avoid off-target gene silencing. The following oligonucleotides were inserted into the pGPU6/GFP/Neo plasmid vector (GenePharma Corporation, Shanghai, China) using the BbsI and BamHI restriction sites. The underlined sequences targeted the N-Ras gene, and the bold italic letters indicate the loop sequence. NRas-791 (nt 791–811) sense 5'-caccGGTTGTATGGGATTGCCATGTttcaagagaACATGGCAATCCCATACAACCTTTTTTg-3', antisense 5'-gatccAAAAAAGGTTGTATGGGATTGCCATGTtctcttgaaACATGGCAATCCCATACAACC-3'; NRas-613 (nt 613–633) sense 5'-caccGCCAACAAGGACAGTTGATACttcaagagaGTATCAACTGTCCTTGTTGGCTTTTTTg-3', antisense 5'-gatccAAAAAAGCCAACAAGGACAGTTGATACtctcttgaaGTATCAACTGTCCTTGTTGGC-3'; NRas-305 (nt 305–325) sense 5'-caccGCACTGACAATCCAGCTAATCttcaagagaGATTAGCTGGATTGTCAGTGCTTTTTTg-3', antisense 5'-gatccAAAAAAGCACTGACAATCCAGCTAATCtctcttgaaGATTAGCTGGATTGTCAGTGC-3'; NRas-566 (nt 566–585) sense 5'-caccGACTCGGATGATGTACCTATttcaagagaATAGGTACATCATCCGAGTCTTTTTTg-3', antisense 5'-gatccAAAAAAGACTCGGATGATGTACCTATtctcttgaaATAGGTACATCATCCGAGTC-3'. Near the end of all shRNA sense templates was a 6-nt poly(T) tract that is recognized as a termination signal by RNA pol III, which terminated shRNA synthesis. The 5' ends of the two oligonucleotides were non-complementary and formed the BbsI and BamHI restriction site overhangs that facilitated efficient directional cloning into the pGPU6/GFP/Neo plasmid vector.

Sense and antisense sequences were annealed in 10x shDNA Annealing Buffer (Promega, Southampton, UK) by incubating oligonucleotides for 5 min at 95°C, 5 min at 85°C, 5 min at 75°C, and 5 min at 70°C, followed by slow cooling to 4°C. The annealed DNA fragments were ligated into pGPU6/GFP/Neo vector, which was first cut with BbsI and BamHI.

Transient transfection of pGPU6/GFP/Neo-NRas shRNA.
Transfection was performed at approximately 80% confluency in six-well plates (Corning, NY) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Briefly, a total of 2.5 x 105 cells were seeded into each well in MEM containing 10% calf serum without antibiotics, the day before transfection. Four micrograms of purified pGPU6/GFP/Neo-shRNA expression vectors, which contained the N-Ras shRNA insert (pGPU6/GFP/Neo-NRas-791, pGPU6/GFP/Neo-NRas-613, pGPU6/GFP/Neo-NRas-305, and pGPU6/GFP/Neo-NRas-566) and two control vectors (pGPU6/GFP/Neo-shNC purchased from GenePharma, which targets GTTCTCCGAACGTGTCACGT sequences, and does not match any gene, and pGPU6/GFP/Neo, which does not contain an insert), were transfected into 16HBE-T cells with 10 µl of Lipofectamine 2000 reagent. After 48 h transfection, RT-PCR and Western blotting were done to assess the efficiency of N-Ras knockdown.

Stable transfection.
G418 is an analog of neomycin. For stable transfection, the optimal concentration of G418 for selection was determined by titration before transfection. About 2 x 104 cells were seeded into each well of a 24-well dish (Corning). After 24 h, cells were cultured with G418 concentrations of 0, 200, 400, 600, 800, 1000, 1200, and 1400 µg/ml. The lowest concentration of G418 initiated cell death in approximately 7–9 days and killed all cells within 2 weeks. After 24- to 48-h transfection as described above, cells were cultured with MEM with 10% fetal bovine serum (FBS) with the optimal concentration of G418. After 2 weeks, resistant cell clones were picked and transferred to 24-well plates and gradually expanded to six-well plates and 10-cm dishes. At 90% confluence, N-Ras expression was measured with Western blotting.

Cell-cycle detection.
Cells (1 x 106) were enzymatically harvested, washed twice using PBS, fixed in 4 ml of cold 70% ethanol at 4°C overnight, and washed twice using 0.1% Triton X-100 in PBS. The cells were stained with propidium iodide (20 µg/ml in PBS; Sigma) and RNase A (200 µg/ml in PBS; Sigma) at 37°C for 30 min, then analyzed immediately by flow cytometry (FACScan, BD Biosciences, San Jose, CA) (Song et al., 2006Go).

Soft agar assay.
Transformed and control cells (1 x 103) in MEM containing 10% serum were suspended in 2 ml of 0.35% low-melting-point agarose (Sigma), and seeded into six-well plates (Corning) coated with 0.6% low-melting-point agarose in MEM containing 10% serum. Colonies with at least 50 cells were counted at 14 days (Shevde et al., 2006Go; Wang et al., 2006Go).

Tumorigenicity.
Five-week-old BALB/c nude mice were provided by Guangzhou University of Traditional Chinese Medicine (Guangzhou, China). All animal protocols were reviewed and approved by the Animal Care and Use Committee. Transformed and control cells were removed by trypsinization, washed twice with PBS and suspended in MEM. A total of 5 x 106 cells in 0.2 ml of culture medium were injected subcutaneously in the right shoulder pads of nude mice. The mice were kept in a pathogen-free environment and monitored every 3 days for tumor formation. Tumor volume was calculated using the following formula: 1/2 x a x b2 as described previously (Hao et al., 2007Go; Sun et al., 2007Go), where a is tumor length, and b is tumor width. All mice were sacrificed after 4 weeks, and the tumors were removed, weighed and fixed in 10% buffered formalin for pathological examination.

Statistical analysis.
Values were expressed as mean ± SD from three separate experiments, and analyzed using SPSS 15.0 for Windows (SPSS, Inc, Chicago, IL). Comparison of Ras expression at the mRNA and protein levels between 16HBE-T and 16HBE-N cells was made using Student's t-test. Comparison of N-Ras mRNA and protein expression after N-Ras silencing, proportion of cells at each phase, colony formation rate, tumor volume and tumor weight were assessed with one-way ANOVA. Differences were considered significant at p < 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Overexpression of Ras Gene Family
Total RNA was electrophoresed on a 1% agarose gel and showed two bright bands that corresponded to 28S and 18S RNA, with a ratio of intensities of 1.8–2.2:1. The quality of RNA was suitable for use in the following experiments. Figure 1 shows H-, K-, and N-Ras expression at the mRNA and protein levels in 16HBE-T and 16HBE-N cells. Compared with control 16HBE-N cells, the levels of H-, K-, and N-Ras mRNA transcripts analyzed with RT-PCR were increased by 2.2 ± 0.4, 1.3 ± 0.1, and 3.6 ± 0.7-fold in 16HBE-T cells, respectively (all p < 0.05) (Fig. 1A). Western blotting indicated that H-, K-, and N-Ras protein expression in 16HBE-T cells was increased by 1.3 ± 0.1, 1.5 ± 0.2, and 1.6 ± 0.2-fold compared with 16HBE-N cells, respectively (all p < 0.05) (Figs. 1B and 1C). Because N-Ras expression at both mRNA and protein levels in 16HBE-T cells was the highest, we focused on the role of N-Ras in malignant transformation induced by anti-BPDE.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 1. Expression of Ras gene family in 16HBE-T and 16HBE-N cells. (A) H-, K-, and N-Ras mRNA expression was analyzed by RT-PCR. H-, K-, and N-Ras mRNA level in 16HBE-T cells normalized to β-actin was increased compared with that in 16HBE-N cells (all p < 0.05). (B) H-, K-, and N-Ras protein expression were analyzed by Western blotting. (C) Quantitative analysis of proteins showed that H-, K-, and N-Ras protein levels in 16HBE-T cells normalized to β-actin were higher than those in 16HBE-N cells (all p < 0.05). Each bar represents the mean ± SD of three independent experiments.

 
Silencing of N-Ras Expression with shRNAs
To gain further insight into the specific function of N-Ras in malignantly transformed 16HBE cells, we developed a shRNA interference approach to selectively downregulate cellular N-Ras expression. Four plasmids were constructed and designated as pGPU6/GFP/Neo-NRas-791, pGPU6/GFP/Neo-NRas-613, pGPU6/GFP/Neo-NRas-305, and pGPU6/GFP/Neo-NRas-566. Proper construction of the plasmids was confirmed by cutting with restriction enzymes. Positive clones were verified by DNA sequencing. The mRNA levels of N-Ras were compared in the parental cell line, two transfection control cell lines and four N-Ras–silencing cell lines. As shown in Figure 2A, mRNA expression in 16HBE-T cells transfected with pGPU6/GFP/Neo-NRas-791, pGPU6/GFP/Neo-NRas-613, pGPU6/GFP/Neo-NRas-305, and pGPU6/GFP/Neo-NRas-566 was reduced by 60, 92, 69, and 95%, respectively, in comparison with parental 16HBE-T cells (all p < 0.05). There was no difference in N-Ras expression among parental groups and two control groups (p > 0.05). To evaluate inhibition of N-Ras protein synthesis, Western blotting was done. N-Ras proteins were strongly expressed in cells of both parental and control groups. However, 16HBE-T cells transfected with pGPU6/GFP/Neo-NRas-613 and pGPU6/GFP/Neo-NRas-566 plasmids decreased N-Ras protein expression level by 58 and 93%, respectively, whereas 16HBE-T cells transfected with pGPU6/GFP/Neo-NRas-791 and pGPU6/GFP/Neo-NRas-305 reduced protein expression by 34 and 45%, respectively (all p < 0.05) (Figs. 2B and 2C). The silencing effect was specific, as β-actin levels did not differ significantly among the silencing cells and controls. pGPU6/GFP/Neo-NRas-566 with greatest silencing efficiency was selected for further study.


Figure 2
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 2. Silencing of N-Ras expression in 16HBE-T cells with shRNA interference. (A) N-Ras mRNA expression in 16HBE-T cells at 48 h post-transfection was examined by RT-PCR. N-Ras mRNA levels in 16HBE-T cells transfected with pGPU6/GFP/Neo-NRas-791, pGPU6/GFP/Neo-NRas-613, pGPU6/GFP/Neo-NRas-305, and pGPU6/GFP/Neo-NRas-566 were reduced by 60, 92, 69, and 95%, respectively, in comparison with parental 16HBE-T cells (all p < 0.05). (B) N-Ras protein expression in 16HBE-T cells at 48 h post-transfection was examined by Western blotting. (C) Quantitative analysis of N-Ras protein showed that N-Ras protein level in 16HBE-T cells transfected with pGPU6/GFP/Neo-NRas-791, pGPU6/GFP/Neo-NRas-613, pGPU6/GFP/Neo-NRas-305 and pGPU6/GFP/Neo-NRas-566 were reduced by 34, 58, 45, and 93%, respectively, in comparison with parental 16HBE-T cells (all p < 0.05). Each bar represents the mean ± SD of three independent experiments.

 
Establishment of Stable N-Ras–Downregulated Clonal Cell Line
After 2 weeks G418 titration, 400 µg/ml G418 was identified as the effective selection concentration. pGPU6/GFP/Neo-NRas-566 transfected cells were cultured for 2 weeks in MEM containing 10% FBS and 400 µg/ml G418. Three clonal cell lines of pGPU6/GFP/Neo-NRas-566-1, pGPU6/GFP/Neo-NRas-566-2, and pGPU6/GFP/Neo-NRas-566-3 were picked and cultured for 2 months. The persistence of N-Ras silencing in clonal cell lines was assessed. Although there were no differences in expression levels between parental groups transiently transfected with pGPU6/GFP/Neo-shNC and pGPU6/GFP/Neo, three clones pGPU6/GFP/Neo-shNC-1, pGPU6/GFP/Neo-shNC-2, and pGPU6/GFP/Neo-shNC-3 from pGPU6/GFP/Neo-shNC remained negative for N-Ras protein expression following stable transfection. Western blotting analysis of the clones demonstrated that N-Ras protein expression decreased by 29% (pGPU6/GFP/Neo-NRas-566-1), 86% (pGPU6/GFP/Neo-NRas-566-2) and 82% (pGPU6/GFP/Neo-NRas-566-3) as compared with parental 16HBE-T cells (all p < 0.05). Clones pGPU6/GFP/Neo-shNC-1, pGPU6/GFP/Neo-shNC-2, and pGPU6/GFP/Neo-shNC-3 showed similar N-Ras protein levels when compared with parental 16HBE-T cells (all p > 0.05) (Fig. 3). Based on these results, pGPU6/GFP/Neo-NRas-566-2 and pGPU6/GFP/Neo-shNC-2 clonal cell lines were cultured and designated as 16HBE-T-NRas and 16HBE-T-Neg, respectively, and used for further study.


Figure 3
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 3. Stable suppression of N-Ras protein in 16HBE-T cells with pGPU6/GFP/Neo-NRas-566. pGPU6/GFP/Neo-NRas-566 and pGPU6/GFP/Neo-shNC transfected cells were selected with G418 for 2 weeks, and three clones of both cells were cultured for 2 months. Western blotting showed that three clonal cell lines from pGPU6/GFP/Neo-NRas-566 decreased the N-Ras protein in 16HBE-T cells. Moreover, the pGPU6/GFP/Neo-NRas-566-2 was the clone that reduced the N-Ras protein expression most. The test was performed three times.

 
Change of Cell Cycle by N-Ras Gene Silencing
To monitor the effect of N-Ras shRNA targeting on the cell cycle, the DNA content of shRNA-transfected 16HBE-T cells was analyzed by FACS after stable transfection. In comparison to 16HBE-T, 16HBE-T-NRas showed cell accumulation in the G0/G1 phase (73.5 ± 9.0%) and reduction in the S-phase (18.0 ± 4.1%) (p < 0.05), whereas 16HBE-T-Neg showed no significant differences in cell-cycle distribution in comparison with 16HBE-T (p > 0.05) (Fig. 4). These results suggest that RNAi-mediated silencing of N-Ras led to G0/G1 phase arrest in 16HBE-T cells.


Figure 4
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 4. Cell-cycle distribution of stable transfected cells. (A) Representative FACS image of transfected and control cells from three independent experiments, which shows that silencing of N-Ras increased the number of cells in G0/G1 phase, and decreased those in S-phase. (B) Percentage of cells in G0/G1, S, and G2/M phase. Data represents the mean ± SD of three independent experiments. (*p < 0.05 vs. 16HBE-T or 16HBE-T-Neg; #p < 0.05 vs. 16HBE-T or 16HBE-T-Neg)

 
Decrease of Transformation Efficiency In Vitro and Inhibition of Tumor Growth In Vivo
We examined if N-Ras shRNA transfection would affect transformation efficiency of 16HBE-T cells in vitro and tumor growth in vivo. The transfected 16HBE-T-NRas cells formed markedly smaller colonies in soft agar than 16HBE-T or 16HBE-T-Neg cells, and the rate of their anchorage-independent colony growth was markedly decreased by 47% (Fig. 5). One mouse in the group inoculated with 16HBE-T cells died 1 day after injection. Four mice in each group injected with 16HBE-T or 16HBE-T-Neg cells grew tumors 7 days after inoculation. The group of mice inoculated with 16HBE-T cells all showed tumor growth by day 9, and the mice injected with 16HBE-T-Neg cells all grew tumors by day 11. In contrast, only one mouse in the group injected with 16HBE-T-NRas cells grew tumors by day 9, and five of eight mice were monitored for tumor growth until the study ended. Tumor growth was measured every 3 days. As shown in Figures 6A and 6B, the group of mice inoculated with 16HBE-T-NRas cells grew smaller tumors more slowly than the other two groups treated with 16HBE-T or 16HBE-T-Neg cells (p < 0.01). Tumor growth in mice receiving 16HBE-T and 16HBE-T-Neg cells was not significantly different (p > 0.05). Pathological examination indicated that the mice that received 16HBE-T, 16HBE-T-Neg, and 16HBE-T-NRas cells showed growth of squamous cell carcinoma. Compared with the other two groups, the 16HBE-T-NRas group showed smaller cancer nests, less pathological karyokineses and sinusoids, with richer interstitial tissues and more necrosis (Fig. 6C).


Figure 5
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 5. Anchorage-independent growth of 16HBE-T cells silenced for N-Ras. (A) Microscopic growth of colonies in soft agar. Fewer and smaller-sized colonies were observed in cultures of 16HBE-T-NRas cells (original magnification x100). (B) Colony formation rate of 16HBE-T-NRas cells was significantly lower than that of 16HBE-T and 16HBE-T-Neg cells. Data represents the mean ± SD of three independent experiments. (*p < 0.01 vs. 16HBE-T or 16HBE-T-Neg).

 

Figure 6
View larger version (55K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 6. Tumorigenicity of 16HBE-T cells silenced for N-Ras. Five-week-old BALB/c nude mice (n = 24) were randomly divided into three groups, and injected with 16HBE-T, 16HBE-T-Neg, and 16HBE-T-NRas cells, respectively. (A) Tumor volume was measured every 3 days. Mice injected with 16HBE-T-NRas cells grew subcutaneous tumors more slowly than the other two groups. The curve is mean ± SD tumor volume for each group (*p < 0.05 vs. 16HBE-T or 16HBE-T-Neg). (B) Four weeks after tumor cell injection, mice were sacrificed and tumor weight was recorded. Compared with mice receiving 16HBE-T and 16HBE-T-Neg cells, mice inoculated with 16HBE-T-NRas cells grew smaller tumors. Data represents the mean ± SD tumor weight (*p < 0.05 vs. 16HBE-T or 16HBE-T-Neg). (C) Pathological examination of tumors using HE staining. The insert images are shown at original magnification x400 to highlight pathological karyokineses in 16HBE-T tumor mice, sinusoids in 16HBE-T-Neg tumor mice, and necrosis in 16HBE-T-NRas tumor mice (original magnification x200).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
The Ras family of genes, composed of H-, K-, and N-Ras, coordinate multiple biological outcomes, including cell proliferation, transformation, cell-cycle progression, differentiation, migration, apoptosis, cell survival and immune responses (Wolfman et al., 2002Go). Previous studies have characterized Ras mutations, particularly K-Ras mutations, which are frequently found in lung cancer (Okudela et al., 2004Go; Petmitr et al., 2003Go). However, few studies have examined expression patterns of Ras genes in lung epithelium, and little is understood concerning the precise role of N-Ras in carcinogenesis.

The malignant transformation model of 16HBE cells induced by anti-BPDE was successfully established in our institute and used to explore the mechanisms of anti-BPDE–induced tumorigenesis. In the current study, we showed that the expression of Ras genes at the mRNA and protein levels was higher in transformed cells than that in untransformed control 16HBE cells, which implies that the overexpression of Ras genes may have a potential role in the carcinogenesis of anti-BPDE. Ras gene overexpression has been reported in other studies of lung cancer cell lines and other cancers (Khanzada et al., 2006Go; Kim et al., 1997Go; Mammas et al., 2004Go). Our results showed that N-Ras expression at both the mRNA and protein levels was highest in malignantly transformed cells. This finding is consistent with that of Kim et al., who found that N-Ras protein level is higher than either K- or N-Ras protein level in colon carcinoma (Kim et al., 1997Go). Causes of gene overexpression may include mutation and misamplication. The specific mechanism responsible for N-ras overexpression in anti-BPDE–transformed cells will be the focus of future studies. Because N-Ras expression is elevated more than H- and K-Ras, we paid close attention to N-Ras and explored its role in malignantly transformed 16HBE cells induced by anti-BPDE, using RNAi.

RNAi is an effective experimental tool for studying gene function. Posttranscriptional gene expression can be mediated by 21-nt short interfering RNA (siRNA). However, the effect of siRNA that is transfected transiently into cells is restricted because of low transfection efficiency and the short-term persistence of silencing effects. Recently, the vector-based approach of shRNA interference has been developed in order to achieve stable, long-term, and highly specific suppression of gene expression in mammalian cells (Siolas et al., 2005Go). The short hairpin dsRNA can be cleaved by Dicer in cells to generate siRNA, which provides the active form of RNAi. In our study, we used a plasmid vector that was ligated with shRNA and expressed siRNA against N-Ras, and established stable, N-Ras downregulated clonal cell lines. This assured exploring N-Ras function in anti-BPDE–induced transformed cells and made it is feasible to assess phenotypic change in transformed cells.

Some studies have suggested that overexpression of Ras genes leads to enhancement in malignant phenotype (Asamoto et al., 2002Go; Ota et al, 2000Go; Tsuda et al, 2001Go). Moreover, study by Zhang et al. (2006)Go suggests that K-Ras knockdown using adenovirus-mediated siRNA inhibits the growth of lung cancer cells in vitro and in vivo. Additionally, Yang et al. (2003)Go have shown that silencing of H-Ras expression by retrovirus-mediated siRNA decreases transformation efficiency and tumor growth in a human ovarian cancer cell line. In our study, soft agar growth and tumorigenicity assays, both in vitro and in vivo, revealed that N-Ras knockdown resulted in the inhibition of transformation growth and tumorigenicity of malignant transformation cells. This suggests that, although N-Ras expression was elevated by only 3.6- and 1.6-fold, at the mRNA and protein levels in malignant transformed cells, respectively, N-Ras may function as a key mediator of cell growth and tumorigenicity, and is a promising target for lung cancer treatment.

One of the mechanisms of N-Ras in tumorigenesis is likely involved in cell-cycle arrest. Cell-cycle arrest can be induced in G1, G2, and S-phase. Cells passing through S-phase are the most susceptible to genotoxic stress (Zhou and Bartek, 2004Go). The S-phase checkpoint causes only transient, reversible delay in cell-cycle progression, mainly by inhibition of new replicon initiation and thereby slowing down DNA replication (Lukas et al., 2004Go). In G1 and G2 phase, cell-cycle arrest allows DNA repair, and in S-phase arrest, DNA replication slows down as a consequence of repair processes. Our results showed that downregulation of N-Ras induced G0/G1 cell arrest and decreased the number of cells in S-phase, which suggests that N-Ras overexpression provides a proliferative advantage to malignant transformation cells. Similarly, it has previously been shown that suppression of H-Ras in a human ovarian cancer cell line can increase G0/G1 cell arrest and decrease the number of cells in S-phase (Yang et al., 2003Go). Tumors develop because of an imbalance between cellular proliferation and death. Increased cellular proliferation has long been regarded as the predominant cause of tumors; however, cancer cells survive if they fail to undergo apoptosis, or programmed cell death. Thus, further studies are also needed to detect apoptosis and elucidate the exact mechanism of cell-cycle regulation revealed in this study and to determine whether N-Ras-knockdown-induced cell-cycle arrest is a general phenomenon in chemically induced oncogenesis.

In conclusion, this is believed to be the first report of the differential expression of the Ras gene family in malignantly transformed cells induced by anti-BPDE. This indicates that overexpression of Ras genes plays an important role in chemically induced oncogenesis. In addition, we developed a stable, long-term N-Ras shRNA interference system in human bronchial epithelial cells. This system enabled us to provide definitive evidence that N-Ras silencing resulted in G0/G1 arrest, decreased efficiency of transformation, and, more importantly, impeded tumor growth. Therefore, N-Ras may become a potential target for gene therapy, and shRNA interference may be a powerful tool against oncogene expression, and may be used therapeutically against human lung cancer.


    FUNDING
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
National Natural Science Foundation of China (30571546, 30771780) to Y.J.; the Scientific Research Foundation of the State Education Ministry for Returned Overseas Chinese Scholars (2007–24) to Y.J.; the Natural Science Foundation of Guangdong Province (07117550) to Y.J.; and the Natural Science Key Program of Higher Education Institutions of Guangdong Province, China (06Z021) to Y.J.


    ACKNOWLEDGMENTS
 
We thank Dr Qi-cai Liu, Dr Juan Fu, and Dr Wei-dong Ji for technical support. Thanks are also given to Hui-qiu Zhang for pathological slice and Yong Liu (Third Affiliated Hospital of Sun Yat-sen University) for pathological diagnosis.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Asamoto M, Toriyama-Baba H, Ohnishi T, Naito A, Ota T, Ando A, Ochiya T, Tsuda H. Transgenic rats carrying human c-Ha-ras proto-oncogene are highly susceptible to N-nitrosomethylbenzylamine induction of esophageal tumorigenesis. Jpn. J. Cancer Res. (2002) 93:744–751.[CrossRef][Web of Science]

Badalian G, Barbai T, Rásó E, Derecskei K, Szendrôi M, Tímár J. Phenotype of bone metastases of non-small cell lung cancer: Epidermal growth factor receptor expression and K-RAS mutational status. Pathol. Oncol. Res. (2007) 13:99–104.[Web of Science][Medline]

Chen S, Nguyen N, Tamura K, Karin M, Tukey RH. The role of the Ah receptor and p38 in Benzo[a]pyrene-7, 8-dihydrodiol and benzo[a] pyrene-7, 8-dihydrodiol-9,10-epoxide-induced apoptosis. J. Biol. Chem. (2003) 278:19526–19533.[Abstract/Free Full Text]

Clark J, Ding S. Generation of RNAi libraries for high-throughput screens. J. Biomed. Biotechnol. (2006) 2006:45716–45722.[Medline]

Cox AD, Der CJ. The dark side of Ras: Regulation of apoptosis. Oncogene (2003) 22:8999–9006.[CrossRef][Web of Science][Medline]

Downward J. Targeting RAS signalling pathways in cancer therapy. Nat. Rev. Cancer. (2003) 3:11–22.[CrossRef][Web of Science][Medline]

Duarte RL, Paschoal ME. Molecular markers in lung cancer: Prognostic role and relationship to smoking. J. Bras. Pneumol. (2005) 32:56–65.

Ehrhardt A, Ehrhardt GR, Guo X, Schrader JW. Ras and relatives-job sharing and networking keep an old family together. Exp. Hematol. (2002) 30:1089–1106.[CrossRef][Web of Science][Medline]

Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods (2002) 26:199–213.[CrossRef][Web of Science][Medline]

Field JK, Spandidos DA. The role of ras and myc oncogenes in human solid tumors and their relevance in diagnosis and prognosis. Anticancer Res. (1990) 10:1–22.[Web of Science][Medline]

Friday BB, Adjei AA. K-ras as a target for cancer therapy. Biochim. Biophys. Acta. (2005) 1756:127–144.[Medline]

Gruenert DC, Finkbeiner WE, Widdicombe JH. Culture and transformation of human airway epithelial cells. Am. J. Physiol. (1995) 268:L347–L360.[Web of Science][Medline]

Gyorffy E, Anna L, Gyori Z, Segesdi J, Minárovits J, Soltész I, Kostic S, Csekeo A, Poirier MC, Schoket B. DNA adducts in tumour, normal peripheral lung and bronchus, and peripheral blood lymphocytes from smoking and non-smoking lung cancer patients: Correlations between tissues and detection by 32P-postlabelling and immunoassay. Carcinogenesis (2004) 25:1201–1209.[Abstract/Free Full Text]

Hao JH, Gu QL, Liu BY, Li JF, Chen XH, Ji YB, Zhu ZG, Lin YZ. Inhibition of the proliferation of human gastric cancer cells SGC-7901 in vitro and in vivo using Bcl-2 siRNA. Chin. Med. J. (2007) 120:2105–2111.[Web of Science][Medline]

Ji H, Houghton AM, Mariani TJ, Perera S, Kim CB, Padera R, Tonon G, McNamara K, Marconcini LA, Hezel A, et al. K-ras activation generates an inflammatory response in lung tumors. Oncogene (2006) 25:2105–2112.[CrossRef][Web of Science][Medline]

Jiang YG, Chen JK, Chen XM. Malignant transformation of human bronchial epithelial cells induced by benzo(a)pyrene metabolite dihydroxyepoxy benzo pyrene. Wei Sheng Yan Jiu (2001) 30:129–131.[Medline]

Kelley MJ, Glaser EM, Herndon JE, Becker F, Bhagat R, Zhang YJ, Santella RM, Carmella SG, Hecht SS, Gallot L, et al. Safety and efficacy of weekly oral oltipraz in chronic smokers. Cancer Epidemiol. Biomarkers Prev. (2005) 14:892–899.[Abstract/Free Full Text]

Keohavong P, Lan Q, Gao WM, Zheng KC, Mady HH, Melhem MF, Mumford JL. Detection of p53 and K-ras mutations in sputum of individuals exposed to smoky coal emissions in Xuan Wei Country, China. Carcinogenesis (2005) 26:303–308.[Abstract/Free Full Text]

Khanzada UK, Pardo OE, Meier C, Downward J, Seckl MJ, Arcaro A. Potent inhabitation of small-cell lung cancer cell growth by simvastatin reveals selective functions of Ras isforms in growth factor signalling. Oncogene (2006) 25:877–887.[CrossRef][Web of Science][Medline]

Kim K, Kuo T, Cai J, Shuja S, Murnane MJ. N-ras protein: Frequent quantitative and qualitative changes occur in human colorectal carcinomas. Int. J. Cancer. (1997) 71:767–775.[CrossRef][Web of Science][Medline]

Kim K, Lindstrom MJ, Gould MN. Regions of H- and K-Ras that provide organ specificity/potency in mammary cancer induction. Cancer Res. (2002) 62:1241–1245.[Abstract/Free Full Text]

Li D, Firozi PF, Wang LE, Bosken CH, Spitz MR, Hong WK, Wei Q. Sensitivity to DNA damage induced by benzo(a)pyrene diol epoxide and risk of lung cancer: A case-control analysis. Cancer Res. (2001) 61:1445–1450.[Abstract/Free Full Text]

Li D, Wang LE, Chang P, El-Naggar AK, Sturgis EM, Wei Q. In vitro benzo[a]pyrene diol epoxide-induced DNA adducts and risk of squamous cell carcinoma of head and neck. Cancer Res. (2007) 67:5628–5634.[Abstract/Free Full Text]

Lukas J, Claudia Lukas C, Bartek J. Mammalian cell cycle checkpoints: Signalling pathways and their organization in space and time. DNA Rep. (2004) 3:97–1007.

Mammas IN, Zafiropoulos A, Koumantakis E, Sifakis S, Spandidos DA. Transcriptional activation of H- and N-ras oncogenes in human cervical cancer. Gynecol. Oncol. (2004) 92:941–948.[CrossRef][Web of Science][Medline]

Okudela K, Hayashi H, Ito T, Yazawa T, Suzuki T, Nakane Y, Sato H, Ishi H, KeQin X, Masuda A, et al. K-ras gene mutation enhances motility of immortalized airway cells and lung adenocarcinoma cells via Akt activation: Possible contribution to non-invasive expansion of lung adenocarcinoma. Am. J. Pathol. (2004) 164:91–100.[Abstract/Free Full Text]

Ota T, Asamoto M, Toriyama-Baba H, Yamamoto F, Matsuoka Y, Ochiya T, Sekiya T, Terada M, Akaza H, Tsuda H. Transgenic rats carrying copies of the human c-Ha-ras proto-oncogene exhibit enhanced susceptibility to N-butyl-N-(4-hydroxybutyl)nitrosamine bladder carcinogenesis. Carcinogenesis (2000) 21:1391–1396.[Abstract/Free Full Text]

Ovcharenko D, Jarvis R, Hunicke-Smith S, Kelnar K, Brown D. High-throughput RNAi screening in vitro: From cell lines to primary cells. RNA (2005) 11:985–993.[Abstract/Free Full Text]

Parkin DM, Bray FI, Devesa SS. Cancer burden in the year 2000. The global picture. Eur. J. Cancer. (2001) 37:S4–S66.[Web of Science][Medline]

Petmitr S, Wongsommart D, Chaksangchaichot P, Pakeetoot T, Sutinont P, Sirivaidyapong P, Karalak A. Mutational analysis of ras gene family in lung cancer in Thai. Oncol. Rep. (2003) 10:1497–1501.[Web of Science][Medline]

Pfeifer GP, Denissenko MF, Olivier M, Tretyakova N, Hecht SS, Hainaut P. Tobacco smoke carcinogens, DNA damage and p53 mutations in smoking-associated cancers. Oncogene (2002) 21:7435–7451.[CrossRef][Web of Science][Medline]

Pronk GJ, Bos JL. The role of p21ras in receptor tyrosine kinase signaling. Biochim. Biophys. Acta. (1994) 1198:131–147.[Medline]

Rojas M, Godschalk R, Alexandrov K, Cascorbi I, Kriek E, Ostertag J, Van Schooten FJ, Bartsch H. Myeloperoxidase-463A variant reduces benzo[a]pyrene diol epoxide DNA adducts in skin of coal tar treated patients. Carcinogenesis (2001) 22:1015–1018.[Abstract/Free Full Text]

Rojas M, Marie B, Vignaud JM, Martinet N, Siat J, Grosdidier G, Cascorbi I, Alexandrov K. High DNA damage by benzo[a]pyrene 7,8-diol-9,10-epoxide in bronchial epithelial cells from patients with lung cancer: Comparison with lung parenchyma. Cancer Lett. (2004) 207:157–163.[CrossRef][Web of Science][Medline]

Shevde LA, Samant RS, Paik JC, Metge BJ, Chambers AF, Casey G, Frost AR, Welch DR. Osteopontin knockdown suppresses tumorigenicity of human metastatic breast carcinoma, MDA-MB-435. Clin. Exp. Metastasis. (2006) 23:123–133.[CrossRef][Web of Science][Medline]

Siolas D, Lerner C, Burchard J, Ge W, Linsley PS, Paddison PJ, Hannon GJ, Cleary MA. Synthetic shRNAs as potent RNAi triggers. Nat. Biotechnol. (2005) 23:227–231.[CrossRef][Web of Science][Medline]

Song JG, Xie HH, Lian ZR, Yang GT, Du R, Du YL, Zou X, Jin HF, Gao J, Liu J, et al. Enhanced cell survival of gastric cancer cells by a novel gene URG4. Neoplasia (2006) 8:995–1002.[CrossRef][Web of Science][Medline]

Spandidos DA. Oncogenes and tumor suppressor genes as paradigms in oncogenesis. J. BUON. (2007) 12:S9–12.

Stacey DW, Kung HF. Transformation of NIH 3T3 cells by microinjection of Ha-ras p21 protein. Nature (1984) 310:508–511.[CrossRef][Web of Science][Medline]

Sun HW, Tong SL, He J, Wang Q, Zou L, Ma SJ, Tan HY, Luo JF, Wu HX. RhoA and RhoC-siRNA inhibit the proliferation and invasiveness activity of human gastric carcinoma by Rho/PI3K/Akt pathway. World J. Gastroenterol. (2007) 13:3517–3522.[Web of Science][Medline]

Tsuda H, Asamoto M, Ochiya T, Toriyama-Baba H, Naito A, Ota T, Sekiya T, Terada M. High susceptibility of transgenic rats carrying the human c-Ha-ras proto-oncogene to chemically-induced mammary carcinogenesis. Mutat. Res. (2001) 477:173–182.[Web of Science][Medline]

Wang YW, Qu Y, Li JF, Chen XH, Liu BY, Gu QL, Zhu ZG. In vitro and in vivo evidence of metallopanstimulin-1 in gastric cancer progression and tumorigenicity. Clin. Cancer Res. (2006) 12:4965–4973.[Abstract/Free Full Text]

Willingham AT, Deveraux QL, Hampton GM, Aza-Blanc P. RNAi and HTS: Exploring cancer by systematic loss-of-function. Oncogene (2004) 23:8392–8400.[CrossRef][Web of Science][Medline]

Wolfman JC, Palmby T, Der CJ, Wolfman A. Cellular N-Ras promotes cell survival by downregulation of Jun N-Terminal protein kinase and p38. Mol. Cell. Biol. (2002) 22:1589–1606.[Abstract/Free Full Text]

Xie Z, Braithwaite E, Guo D, Zhao B, Geacintov NE, Wang Z. Mutagenesis of benzo[a]pyrene diol epoxide in yeast: Requirement for DNA polymerase zeta and involvement of DNA polymerase eta. Biochemistry (2003) 42:11253–11262.[CrossRef][Web of Science][Medline]

Yang G, Thompson JA, Fang B, Liu J. Silencing of H-ras gene expression by retrovirus-mediated siRNA decreases transformation efficiency and tumorgrowth in a model of human ovarian cancer. Oncogene (2003) 22:5694–5701.[CrossRef][Web of Science][Medline]

Zhang Z, Jiang G, Yang F, Wang J. Knockdown of mutant K-ras expression by adenovirus-mediated siRNA inhibits the in vitro and in vivo growth of lung cancer cells. Cancer Biol. Ther. (2006) 5:1481–1486.[Web of Science][Medline]

Zhou BB, Bartek J. Targeting the checkpoint kinases: Chemosensitization versus chemoprotection. Nat. Rev. Cancer. (2004) 4:216–225.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
105/2/286    most recent
kfn122v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zhou, L.
Right arrow Articles by Yang, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, L.
Right arrow Articles by Yang, Q.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?