ToxSci Advance Access originally published online on July 24, 2008
Toxicological Sciences 2008 106(1):113-123; doi:10.1093/toxsci/kfn151
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Altered Sexual Development in Roach (Rutilus rutilus) Exposed to Environmental Concentrations of the Pharmaceutical 17
-Ethinylestradiol and Associated Expression Dynamics of Aromatases and Estrogen Receptors



* School of Biosciences, University of Exeter, Exeter, Devon EX4 4PS, UK
Okazaki Institute for Integrative Bioscience, National Institute for Basic Biology, National Institutes of Natural Sciences, 5-1 Higashiyama, Myodaiji, Okazaki 444-8787, Japan
1 To whom correspondence should be addressed at School of Biosciences, University of Exeter, Prince of Wales Road, Exeter, Devon EX4 4PS, UK. Fax: +44-1392-263700. E-mail: a.lange{at}exeter.ac.uk.
Received May 2, 2008; accepted July 19, 2008
| ABSTRACT |
|---|
|
|
|---|
Wild roach (Rutilus rutilus) inhabiting UK rivers contaminated with estrogenic effluents from wastewater treatment works show altered sexual development, including intersex, and this can impact negatively on their reproductive capabilities. The molecular events underlying these disruptions in gender assignment, however, are still poorly understood. In this study, two isoforms of aromatase (cyp19a1a and cyp19a1b) were cloned from the roach, and effects of exposure to 17
-ethinylestradiol (EE2) during early life were determined on the expression of both aromatases and on the estrogen receptors (ERs) (subtypes esr1 and esr2b) and analyzed against effects on the progression of gonadal sex differentiation. Exposure to environmentally relevant concentrations of EE2 during the critical period of sex differentiation resulted in gonadal feminization and all roach exposed to 4 ng EE2/l were females. These effects on gonadal development were associated with alterations in the expression of both esr and cyp19a1 genes in bodies and heads of exposed fish with the most marked effects on the expression of esr1 and cyp19a1b. Our findings show that both aromatase isoforms and both ER subtypes are associated with sexual differentiation in roach, and alterations in their expression can signal for disruptions in sexual development.
Key Words: aromatases; developmental gene expression dynamics; endocrine disruption; estrogen receptors; 17
-ethinylestradiol; feminization.
| INTRODUCTION |
|---|
|
|
|---|
Estrogens are essential for normal ovarian development in all vertebrates (Simpson et al., 2002
/Esr1 and ERβ/Esr2b), and which function as ligand-activated transcription factors. ERs exhibit broad tissue expression, consistent with the diverse roles of estrogens. In fish, tissue expression of ER
and ERβ has been shown to differ between species, but generally they appear to be concentrated in the gonad and liver (Ma et al., 2000
The biosynthesis of estrogens is catalyzed by cytochrome P450 aromatase encoded by the cyp19 gene, a member of the cytochrome P450 superfamily. Cytochrome P450 aromatases convert C19 androgens into C18 estrogens and thus mediate the final and rate-limiting step in estrogen biosynthesis. Regulation of the cyp19 gene dictates the ratio of androgens to estrogens and is therefore critical in the processes of sex differentiation and in reproduction (Trant et al., 2001
). In vertebrates, including fish, although aromatases are predominantly expressed in gonads and brain, expression also occurs, albeit at lower levels, in nonsteroidogenic tissues such as skin fibroblasts, intestine, or fetal liver (Simpson et al., 2002
).
In most vertebrates, aromatase is encoded by a single cyp19 gene, and its tissue-specific expression is controlled by tissue-specific promoters. In teleost fish, however, the presence of two different aromatase isoforms, differentially expressed in the ovary (aromatase A/Cyp19a) and brain (aromatase B/Cyp19b), respectively, is now well established (reviewed in Cheshenko et al., 2008
). These two isoforms have their own regulatory mechanisms and are differentially programmed and regulated during early development. The isoforms have been shown to be encoded by two distinct cyp19 genes that show higher homologies between the same isoforms across species compared with the other isoform within the same species (reviewed in Cheshenko et al., 2008
).
Fish show a plasticity of germ cell differentiation along male or female developmental pathways and exposure to sex steroid hormones, their chemical mimics, and other environmental factors, such as temperature, during early life can result in functional sex changes against the genetic sex in fish (Devlin and Nagahama, 2002
; Strüssmann and Nakamura, 2002
). Estrogen treatment, for example, leads to feminized gonads (e.g., Fenske et al., 2005
; Katsu et al., 2007
; Nash et al., 2004
; van Aerle et al., 2002
). Disruption of aromatase activity during early life has also been shown to impair reproductive development (Cheshenko et al., 2008
).
Studies on wild populations of roach (Rutilus rutilus) inhabiting UK rivers have shown that exposure to estrogenic effluents emanating from wastewater treatment works (WwTWs) causes altered sexual development that can result in reduced fertility (Jobling et al., 2002
). Controlled exposures of roach to estrogenic effluents have demonstrated that early life stages are especially sensitive to feminizing effects (Liney et al., 2005
; Rodgers-Gray et al., 2001
), but the underlying molecular mechanisms of this disruption are not understood. Natural and synthetic steroidal estrogens (including the pharmaceutical 17
-ethinylestradiol [EE2]) are some of the major and more potent estrogenic contaminants in WwTW effluents and are believed to have a dominant role for the feminized effects seen in wild fish (Desbrow et al., 1998
; Jobling et al., 2006
).
To further the understanding of the molecular mechanisms underlying sexual disruption in wild roach, cyp19a1a and cyp19a1b were first cloned, and then roach were exposed to a series of environmentally relevant concentrations of EE2 during early life (fertilization to 112 days post hatch, dph) and effects on the dynamics of expression of both aromatase isoforms and the ER subtypes assessed in body trunks and head and analyzed against effects on the progression of gonadal sex differentiation.
| MATERIAL AND METHODS |
|---|
|
|
|---|
Fish source, husbandry, and EE2 exposure.
Prespawning, sexually mature male and female roach were obtained from the Environment Agency's National Coarse Fish Farm (Calverton, Nottinghamshire, UK) and brought into the aquarium facility at the University of Exeter. Here they were induced to spawn artificially using established procedures with carp pituitary extract (see Jobling et al., 2002
Newly fertilized roach eggs were divided between tanks and maintained under flow-through conditions (exchanging one tank volume of dechlorinated tap water filtered to 5 µm every 24h) and maintained at 18°C ± 1°C with a fixed photoperiodic regime of 16 h:8 h light:dark. Immediately upon fertilization, embryos were placed into tanks that received EE2 (Sigma-Aldrich, Gillingham, UK) at nominal concentrations of 1.0 and 10 ng/l. Both treatments were run in duplicate, and duplicate water control tanks were run under the same conditions, without the addition of EE2. Water flow rates and EE2 dosing rates were monitored regularly during the course of the exposure.
Embryos hatched 7–10 days post fertilization, and the resulting fry were fed three times a day with Cyprico Crumble EX (Coppens International bv, Helmond, The Netherlands) dry food (0.01–0.2 mm until 35 dph, 0.2–0.3 mm until 64 dph followed by 0.5–0.8 mm) supplemented with freshly hatched Artemia sp. nauplii until satiation.
Chemical analysis of the water.
Water samples were taken from each tank to measure the concentrations of EE2 (as described in Katsu et al., 2007
). Briefly, samples were spiked with 5% (v/v) methanol and extracted onto preconditioned solid-phase Sep-Pack C18 cartridges (Waters Ltd, Elstree, Hertsfordshire, UK) following the manufacturer's protocol. The extract was subsequently eluted from the column with 100% methanol and stored at 4°C until required. EE2 concentrations were then measured by radioimmunoassay as reported by Katsu et al. (2007)
.
Biological sampling and measurement of physiological end points.
Juvenile roach were sampled at random from the duplicate treatment and control tanks at 28, 56, 84, and 112 dph, to cover the period of sexual differentiation and gonadogenesis up to a time when ovaries and testes were fully formed (determined histologically). Fish were sacrificed by terminal anesthesia (with an overdose of benzocaine (ethyl-p-aminobenzoate) as approved by the UK Home Office (Animals [Scientific Procedures] Act 1986)) and collected for each of the following analyses: gene expression studies (n = 10), gonad histology (n = 11–32), and VTG analyses (as a measure of the response to the estrogen treatment) (n = 16). Total length and wet weight were recorded for each fish at every sampling, with the exception for weight at 28 dph where the mass of fish was too small to be determined precisely.
For histological analysis of the gonad, fish were fixed in toto in Bouin's fixative and processed as described by (Katsu et al., 2007
). Stained samples were analyzed by light microscopy to examine for the presence of sex cells and for gonadal duct formation.
Fish sampled for VTG analysis were snap frozen in liquid nitrogen and stored at –80°C until analysis. These samples were subsequently homogenized in ice-cold phosphate-buffered saline buffer in a 1:1 ratio of wet weight:buffer volume, and the whole-body homogenates were centrifuged at 13,000 x g for 5 min at 4°C. The supernatants were collected and immediately analyzed using an ELISA originally established for carp (Cyprinus carpio) VTG, which has subsequently been validated for measuring VTG in roach (Tyler et al., 1996, 1999
).
For RNA extraction, fish were divided into head and body sections that were immediately snap frozen in liquid nitrogen and stored separately at –80°C until analysis.
Molecular cloning and characterization of roach cyp19a1a and cyp19a1b.
The methods and results for the cloning and sequence analysis of roach cyp19a1a and cyp19a1b are described in the supplementary data.
RNA extraction and gene expression analysis.
Total RNA was extracted using the RNeasy columns (Qiagen, Chatsworth, CA) according to the manufacturer's protocol. The extraction included a DNase treatment to ensure the complete removal of genomic DNA. In total, 2 µg of total RNA were reverse transcribed using SuperScript II transcriptase (Invitrogen, Carlsbad, CA) and oligo (dT) primers. Following reverse transcription, the levels of expression of cyp19a1a, cyp19a1b, esr1, and esr2b were established by quantitative real-time PCR using target-specific assays. The primers used for both esr assays and the "housekeeping" gene ribosomal protein L8 (rpl8) have been described previously (Katsu et al., 2007
). The primers used for the cyp19a assays were designed on the full-length sequences (see Supplementary Data) using the Primer Express software (Applied Biosystems, Foster City, CA). The primers used for the cyp19a assays were 5'- GTGTTGGAGATGTTGATCGCG -3' and 5'- TGCAGGATCTTCAACTCGACG -3' (cyp19a1a) and 5'- AGAACAGCGTTCCCAGTCGTT -3' and 5'- ACAACAGAGTCACCAGGATGGC -3' (cyp19a1b). Amplification was carried out according to Katsu et al. (2004)
, and the mRNA expression of each target gene was normalized with an endogenous reference gene, ribosomal protein L8 (rpl8). The results were calculated by the comparative CT method (Applied Biosystems, 1997
).
Expression of the target genes was quantified in heads and body trunks; gonads were too small to dissect out at the early life stages studied. Gene expression analyses were conducted on separate fish to those used for histological analysis of gonadal development, and thus the expression analyses could not be linked directly with the individual sexes.
Statistical analysis.
Unless stated otherwise, data are presented as mean ± SEM, with
set at 0.05. Data were examined for conformity with the assumptions of normality. If these were not met, data were transformed as appropriate. For VTG data, where data were non-normal even after transformation, between-treatment comparisons within each time point were carried out using a Kruskal-Wallis test, followed by Tukey's all pairwise multiple comparison procedures using SigmaStat 3.10 (Systat Software Inc., Hounslow, UK). Statistical analyses for growth and gene expression data were conducted using the software R 2.5.1. Data were analyzed using two-way ANOVAs to assess the effect of experimental duration and exposure concentration on the chosen end points and the interaction between the two factors (experimental duration and exposure concentration). Between-treatment comparisons within each time point were carried out using Tukey's Honest Significant Differences test.
| RESULTS |
|---|
|
|
|---|
Survival and Growth
No significant mortalities were observed during the course of the experiment.
Fish significantly increased in size progressively with time (age, F3,429 = 381.89; p < 0.0001); for the overall data set, treatment had a significant effect on length (F2,429 = 5.15; p < 0.01), and there also was a significant interaction for length between age of the fish and exposure (F6,429 = 3.77; p < 0.01). Post hoc analyses, however, revealed no significant differences in length between exposed and control fish within each sampling time point (Table 1).
|
Sexual Development in Control Fish
Gonadal development of fish analyzed at early life stages was determined by means of the shape of the gonad and the presence of presumptive male and female reproductive ducts (points of attachment to the peritoneal wall) and additionally for control fish the timing of sex cell differentiation. Progression of gonadal sex differentiation and development in the study population in relation to age are shown in Figure 1. Roach sampled at 56 dph had undifferentiated gonads, and these were often still closely associated with the liver (Fig. 1A). At 84 dph, the gonads consisted of a few primordial germ cells covered by a thin layer of somatic cells (Figs. 1B–D). Some fish at this life stage could be classified definitively as females and a few, less definitively, as presumptive males, and the remaining fish were sexually undifferentiated. The female gonad was characterized by a large elongate structure with two points of attachment to the mesentery/peritoneal wall forming the ovarian cavity. These presumptive ovaries contained somatic cells on the periphery of the gonad with germ cells positioned more centrally (Fig. 1C). The male gonad was distinguishable by a smaller and more oval structure with a single point of attachment to the peritoneal wall. These presumptive testes contained somatic cells dispersed among the germ cells (Fig. 1D). At 112 dph, many more females could be distinguished with the ovaries containing sex cells from germ cells up to the Balbiani body stage (Fig. 1E). Males at this stage were still difficult to distinguish definitively, and only a few more individuals could be classified as presumptive males (Fig. 1F).
|
Water Chemistry
As reported previously (Katsu et al., 2007
Effects of EE2 on VTG Induction
There was a significant induction of VTG in whole-body homogenates only at an exposure concentration of 4 ng EE2/l at all life stages (Fig. 2). At 56 dph, VTG concentrations were 9-fold higher in the 4 ng EE2/l treatment group compared with control fish and the level of induction increased with longevity of exposure (and age), with a 12-fold higher concentration at 84 dph and 53-fold higher concentration at 112 dph.
|
Effects of EE2 on Sexual Development
Gonads of exposed fish were analyzed to investigate for treatment effects histologically. At 56 dph, all fish (n = 12-25) appeared undifferentiated. No effects of any treatment was seen on gonadal development at these life stages with the exception of that in the 4.0 ng EE2/l treatment group, where although still undifferentiated, the gonads in all fish showed a female-like morphology. This was characterized by the presence of an ovarian-like cavity (Fig. 3A).
|
As reported previously (Katsu et al., 2007
At 112 dph, gonads of all control fish had differentiated fully (the gonad was clearly discernible as either a testis or an ovary) and there was a male bias in the population at this time (62% males vs. 38% female; n = 26). In contrast, fish exposed to 0.3 ng EE2/l showed a female bias with 64% females versus 36% males (n = 11). In fish exposed to 4.0 ng EE2/l, 30% were classified as definitively female (based on the presence and location of germ cells, Fig. 3C) and the remaining 70% all had a female-like morphology, but were not advanced enough in their development to distinguish them definitively as females through germ cell identification (n = 10) (Fig. 3D).
Developmental Expression of Target Genes
Between 28 and 112 dph, the expression of both esr mRNAs in control fish increased progressively with age in both head and body samples (Fig. 4). For esr1, there was no apparent bias in tissue (head/body) expression up to and including 112 dph, and esr1 expression in both tissues increased by 4-fold between 28 and 112 dph. esr2b similarly showed approximately a 3-fold increase in expression between 28 and 112 dph in both head and body tissues. Expression of esr2b in head tissue was approximately 10-fold lower compared with in the body trunk over the life period studied.
|
Expression of cyp19a1a and cyp19a1b was detected at all developmental stages investigated (Fig. 5). The expression of cyp19a1a mRNAs increased progressively with age with a 2.2-fold induction in body trunks and 1.8-fold induction in heads between 28 and 112 dph. Unexpectedly, the relative expression levels of cyp19a1a were higher in heads compared with the body trunks. For the neural isoform cyp19a1b, higher transcript levels were detected in head samples compared with body trunks, but there was no obvious change/pattern in the expression of cyp19a1b between 28 and 112 dph.
|
Effects of EE2 Exposure on the Developmental Expression of Target Genes
There were significant interactions of EE2 exposure concentration and duration of exposure for the expression of all targets in both heads and body trunks (Table 2).
|
Exposure to EE2 had significant effects on the expression of esr1 in both body trunks and (but less so) in heads, but not on the expression of esr2b in body trunks or heads (Table 2).
Exposure to 4 ng EE2/l resulted in a marked induction (between 3.4 and 17-fold compared with controls) in the expression of esr1 in body trunks of exposed roach at all life stages investigated, whereas exposure to 0.3 ng EE2/l resulted in an induction (2-fold) in body trunks at 56 dph only (Fig. 4A), relative to the controls. In heads, a trend of increasing esr1 expression with increasing EE2 exposure concentration was observed at 28 and 56 dph with 4.0- and 2.3-fold inductions, respectively, after exposure to 4 ng EE2/l. At 84 dph, there was no effect of EE2 on the expression of esr1 in heads, and at 112 dph, there was trend for a suppressive effect of increasing EE2 concentrations on the expression of esr1 (Fig. 4B).
There was an apparent, but less pronounced, stimulatory effect of EE2 on esr2b expression in body trunks during early life (28 and 56 dph), but at 112 dph, expression of esr2b was clearly suppressed (by 2.5-fold) in the body trunk of fish exposed to the highest concentration of EE2 compared with control fish (Fig. 4C). A similar pattern for the expression of esr2b in heads in EE2 exposed roach was seen as that for esr1 (Fig. 4D). At 28 and 56 dph, there was a concentration-related increase in esr2b expression with increasing EE2 exposure concentrations (3.0/2.5- and 5.1/2.7-fold after exposure to 0.3 and 4.0 ng EE2/l for 28 and 56 dph, respectively). No definitive changes in expression of esr2b were observed in heads at 84 dph, but there was a trend of a downregulation at 112 dph, with 3.3 times lower expression in heads of fish exposed to the highest concentration of EE2 compared with controls.
Exposure to EE2 had significant effects on the expression of cyp19a1b in both body trunks and heads and on the expression of cyp19a1a in the heads, but no significant effect of EE2 was observed for the expression of cyp19a1a in body trunks (Table 2).
At 28 and 84 dph, there were no effects of EE2 on the expression of cyp19a1a in either body trunks or head tissue (Figs. 5A + B). At 56 dph, in contrast, exposure to 0.3 and 4.0 ng EE2/l, respectively, induced the expression of cyp19a1a in both body trunks (3.6 and 2.9-fold) and in heads (between 2.4 and 2.6-fold higher) compared with their respective controls. The levels of expression for this target gene at 56 dph were the highest for any treatment group at any life stage for both tissues. At 112 dph, there was a downregulation in the expression of cyp19a1a in both body trunk and in heads of EE2-exposed fish with the highest suppression (2.5-fold) in the body trunks of fish exposed to 4 ng EE2/l (Figs. 5A + B).
For cyp19a1b, EE2 exposure induced an elevated expression in body trunks at 28, 56, and 112 dph, but not at 84 dph (Fig. 5C). At 28 and 112 dph, only the highest exposure concentration of EE2 induced an upregulation of cyp19a1b (by 2.8- and 3.8-fold, respectively), whereas at 56 dph, EE2 induced an upregulation in the expression of cyp19a1b and in a concentration-related manner (3.2- and 6.2-fold for EE2 exposures of 0.3 and 4 ng EE2/l, respectively). In the heads, exposure to 4 ng EE2/l induced an upregulation in expression of cyp19a1b at all time points, with changes of 6.5-fold at 28 dph, 8.0-fold at 56 dph, 4.8-fold at 84 dph, and 8.9–fold at 112 dph. Exposure to 0.3 ng EE2/l only induced the expression of cyp19a1b at 56 dph (3.2-fold) and 112 dph (2.3-fold) (Fig. 5D).
| DISCUSSION |
|---|
|
|
|---|
We show that in roach exposure to the pharmaceutical estrogen EE2, including at environmentally relevant concentrations (and present widely in WwTW effluents), during early life alters both the normal progression of gonadal sexual differentiation and the developmental expression patterns of aromatases and ERs. EE2 occurs at concentrations between <0.5 up to 7 ng/l in effluents and up to 5 ng/l in surface waters (Belfroid et al., 1999
Investigations in the control population into the timing of sexual development found that females progressed through gonadal sexual differentiation before the males, a pattern consistent with that reported previously (Paull et al., 2008
; Rodgers-Gray et al., 2001
). The expression profiles of esr1 and esr2b in roach body trunks, principally reflecting expression in the gonad and liver (e.g., Katsu et al., 2007
; Menuet et al., 2002
), increased progressively with development during early life, and the profiles were similar for these genes in the head. For esr2b, there was a marked increase in expression in both the body and head coinciding with the period of sexual differentiation in the females (between 84 and 112 dph). The higher overall level of esr2b expression seen in the whole body compared with esr1 has also been shown for zebrafish (Legler et al., 2000
) and may reflect a more widespread tissue expression of esr2b mRNA compared with esr1, rather than necessarily any specific differences in levels of expression between the two ER subtypes in the gonad at this time. Differences between the sexes in the expression of the esrs in the roach early life stages were not determined as the gonads could not be dissected out at these life stages, and the gonadal histology was conducted on different fish than for the gene expression analyses. Sex-related differences in esr expression (both esr1 and esr2b) have been shown to occur in some fish species (e.g., Menuet et al., 2002
), but not in others (e.g., Guiguen et al., 1999
). However, the significance of any differential expression patterns seen for the ER subtypes has not been established for any fish.
Expression of cyp19a1a increased progressively in both heads and body trunks of early life stage roach with marked elevations coinciding with the onset of ovarian differentiation (between 84 and 112 dph) and indicating a role in the gonadal sex differentiation process. In Nile tilapia (Oreochromis niloticus; Kwon et al., 2001
) and sea bass (Dicentrachus labrax; Piferrer et al., 2005
), higher levels of expression of cyp19a1a occur in females compared with males during sexual differentiation, and it may control gonadal sex differentiation by regulating estrogen synthesis in gonads (Cheshenko et al., 2008
). Expression of cyp19a1b was almost an order of magnitude higher in heads compared with body trunks in the control fish but showed no marked elevation during sexual differentiation. In other fish species, expression of cyp19a1b is closely correlated with aromatase activity (Gelinas et al., 1998
), and estrogen synthesis in the brain is required for neurogenesis and neuroregeneration that is retained throughout their life (Forlano et al., 2001
; Gelinas et al., 1998
). In zebrafish, it has been suggested that cyp19a1b may also play a role in the sex differentiation process (Kishida and Callard, 2001
; Trant et al., 2001
), but this hypothesis is controversial and Kallivretaki et al. (2007)
for instance describe a nonsexually dimorphic expression of cyp19a1b in the zebrafish brain during sexual differentiation. The present study did not detect a sexually dimorphic expression pattern of cyp19a1 in sexually differentiating roach, but such an existence cannot be excluded based on the number of samples analyzed.
The effective concentration of EE2 inducing the synthesis of VTG corresponds well with previous studies in other species of the carp family (Fenske et al., 2005
; Länge et al., 2001
), showing a comparable sensitivity. Exposure to EE2 during early life induced a concentration-related effect on the differentiation of the gonads with a strong feminizing effect. Exposure to 0.3 ng EE2/l, a concentration of EE2 found widely in effluents and in surface waters, resulted in a female bias (at 112 dph, compared with the slight male bias; 62% males vs. 38% females in the controls), and at 4 ng EE2/l, all of the roach population had a female gonadal phenotype. Early life exposures of other cyprinids to comparable concentrations of EE2 have been shown to induce similar feminizing effects, some of which have subsequently resulted in disruption of reproduction in sexually maturing/mature fish (e.g., Fenske et al., 2005
; Länge et al., 2001
; Nash et al., 2004
; Parrott and Blunt, 2005
; Segner et al., 2003
). Given the responsiveness of roach to EE2 during their early life stages and the levels of total steroid estrogen known to occur in WwTWs discharging in to UK rivers, there is a high likelihood that sexual development/function in wild populations of roach is being disrupted by steroidal estrogens in the environment.
The marked induction in the expression of esr1 in body trunks of roach exposed to 4 ng EE2/l shows that this gene is responsive to estrogen in the body trunks throughout early life and even before the process of gonadal differentiation occurs. At 56 dph, 0.3 ng EE2/l also induced an upregulation in esr1 in body trunks, suggesting that at this time, and just prior to gonadal sexual differentiation, there may be a heightened sensitivity of this transcript to estrogen. esr2b expression in body trunks was less responsive to EE2 during early life (28 and 56 dph) compared with that for esr1, and there was a concentration-related suppression in its expression at 112 dph. The concentration-dependent induction of esr1 expression by EE2 in the body trunks of roach will reflect elevations not only in the gonad (as shown in adult medaka, Contractor et al., 2004
, and mature male zebrafish Legler et al., 2000
) but also in the liver as part of the VTG induction process (rainbow trout, Pakdel et al., 1991
, chicken Ninomiya et al., 1992
). A recent in vitro characterization of ERs in rainbow trout has suggested that VTG production is predominantly mediated through esr2b (Leaños-Castañeda and Van Der Kraak, 2007
), but the response dynamics for esr2b in the body trunks of roach exposed to EE2 in this study would not necessarily support this case for roach, where a stimulatory response was lacking. The higher responsiveness of esr1 compared with esr2b in bodies of roach exposed to EE2 compares favorably with studies in other fish species (Menuet et al., 2004
; Sabo-Attwood et al., 2004
).
In heads, esr1 and esr2b were also responsive to EE2, with developmental stage-specific effects, and for both genes exposure had a stimulatory effect during early life (28 and 56 dph), followed by a refractory period to stimulation (84 dph), and then a suppressive effect (in a concentration related manner) after gonadal sex differentiation at 112 dph. Through the use of ER knockout mice, in mammals both ER subtypes have been shown to be involved in the regulation of LH (Couse et al., 1999
). In studies on fish, both esrs have been shown to be expressed in the brain-pituitary complex of fish (Tchoudakova et al., 1999
), but their specific roles in the brain have not been determined for any animal. Clearly, however, expression of esr in the brain-pituitary complex is a very likely target for the effects of estrogenic endocrine disrupting compounds (EDCs) in fish, as it is in mammals. The effects of EE2 on esr expression in the brain are likely to cause behavioral changes as has been established for exposures to EE2 in sexually mature three-spnied stickleback (Gasterosteus aculeatus; Brian et al., 2006
). Similarly, Larsen et al. (2008)
recently speculated that regulation of reproductive behavior and gonadal development might be mediated by different ER subtypes that have different sensitivities to estrogen because of differences in their binding affinity for EE2 and the different tissue distribution patterns of ERs.
cyp19a1a and cyp19a1b not only appear to have different developmental programs between tissues and across life stages in roach but they also responded differently to estrogen exposure, as has been shown for the zebrafish (Callard et al., 2001
). cyp19a1b was more clearly and consistently responsive to EE2 with elevations in expression in head at all life stages and in body trunks at most life stages studied. The differences in responsiveness are explained by the likely presence of an estrogen-responsive elements (ERE) in the promoter of the cyp19a1b, but not the cyp19a1a, shown to occur in other closely allied cyprinid fish, such as the zebrafish and goldfish (Kazeto et al., 2001
; Tchoudakova et al., 2001
).
Contrary to cyp19a1b, the situation is less clear for cyp19a1a. Whereas EE2 had a stimulatory effect on the expression of cyp19a1a during early life (at 56 dph only) in both body trunks and heads, it appeared to have a suppressive effect on the expression of cyp19a1a in both body trunk and in heads after the completion of gonadal sex differentiation. This effect is more difficult to explain, but may include an indirect effect of the EE2 exposure. Different responses to estrogen for the expression of cyp19a1a have been described for different life stages (e.g., Cheshenko et al., 2007
; Hinfray et al., 2006
), but these studies are compounded by the use of high exposure concentrations that bear no physiological or environmental relevance.
The results from the present study show that early life exposure to environmental concentrations of EE2 impacts on sexual development in the roach resulting in gonadal feminization, and at 4 ng EE2/l, in an all-female population. These effects on sexual differentiation were signaled by alterations in the expression of both esrs and cyp19a1 genes in the body and head, with the most pronounced effects of EE2 on expression of esr1 and cyp19a1b. The greater responsiveness of cyp19a1b to EE2 compared with cyp19a1a is consistent with the presence of EREs in the gene promoter of cyp19a1b in other cyprinid fish. The high sensitivity of the ERs and cyp19a1b in roach to EE2 at concentrations present widely in the aquatic environment emphasizes further the vulnerability of wild populations of roach in UK rivers to disruptions in sexual development.
| SUPPLEMENTARY DATA |
|---|
|
|
|---|
The supplementary data describe the Material and Methods applied to clone both aromatase isoforms from the roach, followed by their characterization. Supplementary Data are available online at http://toxsci.oxfordjournals.org/.
| FUNDING |
|---|
|
|
|---|
UK Natural Environmental Research Council (NE/D002818/1 and within the Environmental Genomics Programme (NER/T/S/2002/00182)) and the UK Environment Agency (Project number SC030299) to C.R.T.; Ministry of Environment, Japan, and Grants-in-Aid for Scientific Research B from the Ministry of Education, Culture, Sports, Science, and Technology, Japan, to T.I.
| ACKNOWLEDGMENTS |
|---|
We thank members of the Environmental and Molecular Fish Biology group at the University of Exeter that supported this project and Alan Henshaw and staff at Calverton Fish Farm (UK Environment Agency) for supplying the prespawning, sexually mature roach, and their continued support.
| REFERENCES |
|---|
|
|
|---|
Applied Biosystems. Comparative CT method. In: User Bulletin #2 ABI Prism 7700 Sequence Detection System (1997) Foster City, CA: Applied Biosystems. 11–15.
Baroiller JF, Guigen Y, Fostier A. Endocrine and environmental aspects of sex differentiation in fish. Cell. Mol. Life Sci. (1999) 55:910–931.[CrossRef][Web of Science]
Belfroid AC, Van der Horst A, Vethaak AD, Schafer AJ, Rijs GBJ, Wegener J, Cofino WP. Analysis and occurrence of estrogenic hormones and their glucuronides in surface water and waste water in The Netherlands. Sci. Total Environ. (1999) 225:101–108.[CrossRef][Medline]
Brian JV, Augley JJ, Braithwaite VA. Endocrine disrupting effects on the nesting behaviour of male three-spined stickleback Gasterosteus aculeatus L. J. Fish Biol. (2006) 68:1883–1890.[CrossRef][Web of Science]
Callard GV, Tchoudakova AV, Kishida M, Wood E. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish. J. Steroid Biochem. Mol. Biol. (2001) 79:305–314.[CrossRef][Web of Science][Medline]
Cheshenko K, Brion F, Le Page Y, Hinfray N, Pakdel F, Kah O, Segner H, Eggen RIL. Expression of zebrafish aromatase cyp19a and cyp19b genes in response to the ligands of estrogen receptor and aryl hydrocarbon receptor. Toxicol. Sci. (2007) 96:255–267.
Cheshenko K, Pakdel F, Segner H, Kah O, Eggen RIL. Interference of endocrine disrupting chemicals with aromatase CYP19 expression or activity, and consequences for reproduction of teleost fish. Gen. Comp. Endocrinol. (2008) 155:31–62.[CrossRef][Web of Science][Medline]
Contractor RG, Foran CM, Li SF, Willett KL. Evidence of gender- and tissue-specific promoter methylation and the potential for ethinylestradiol-induced changes in Japanese medaka (Oryzias latipes) estrogen receptor and aromatase genes. J. Toxicol. Environ. Health A (2004) 67:1–22.[Web of Science][Medline]
Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis BJ, Korach KS. Postnatal sex reversal of the ovaries in mice lacking estrogen receptors a and b. Science (1999) 286:2328–2331.
Desbrow C, Routledge EJ, Brighty GC, Sumpter JP, Waldock M. Identification of estrogenic chemicals in STW effluent. 1. Chemical fractionation and in vitro biological screening. Environ. Sci. Technol. (1998) 32:1549–1558.
Devlin RH, Nagahama Y. Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture (2002) 208:191–364.[CrossRef][Web of Science]
Eddy EM, Washburn TF, Bunch DO, Goulding EH, Gladen BC, Lubahn DB, Korach KS. Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology (1996) 137:4796–4805.[Abstract]
Fenske M, Maack G, Schäfers C, Segner H. An environmentally relevant concentration of estrogen induces arrest of male gonad development in zebrafish, Danio rerio. Environ. Toxicol. Chem. (2005) 24:1088–1098.[CrossRef][Web of Science][Medline]
Forlano PM, Deitcher DL, Myers DA, Bass AH. Anatomical distribution and cellular basis for high levels of aromatase activity in the brain of teleost fish: Aromatase enzyme and mRNA expression identify glia as source. J. Neurosci. (2001) 21:8943–8955.
Gelinas D, Pitoc GA, Callard GV. Isolation of a goldfish brain cytochrome P450 aromatase cDNA: mRNA expression during the seasonal cycle and after steroid treatment. Mol. Cell. Endocrinol. (1998) 138:81–93.[CrossRef][Web of Science][Medline]
Guiguen Y, Baroiller JF, Ricordel MJ, Iseki K, McMeel OM, Martin SAM, Fostier A. Involvement of estrogens in the process of sex differentiation in two fish species: The rainbow trout (Oncorhynchus mykiss) and a Tilapia (Oreochromis niloticus). Mol. Reprod. Dev. (1999) 54:154–162.[CrossRef][Web of Science][Medline]
Hinfray N, Palluel O, Turies C, Cousin C, Porcher JM, Brion F. Brain and gonadal aromatase as potential targets of endocrine disrupting chemicals in a model species, the zebrafish (Danio rerio). Environ. Toxicol. (2006) 21:332–337.[CrossRef][Web of Science][Medline]
Jobling S, Coey S, Whitmore JG, Kime DE, Van Look KJW, McAllister BG, Beresford N, Henshaw AC, Brighty G, Tyler CR, et al. Wild intersex roach (Rutilus rutilus) have reduced fertility. Biol. Reprod. (2002) 67:515–524.
Jobling S, Williams R, Johnson A, Taylor A, Gross-Sorokin M, Nolan M, Tyler CR, van Aerle R, Santos E, Brighty G. Predicted exposures to steroid estrogens in U.K. rivers correlate with widespread sexual disruption in wild fish populations. Environ. Health Perspect. (2006) 114:32–39.[CrossRef][Web of Science][Medline]
Kallivretaki E, Eggen RIL, Neuhauss SCF, Kah O, Segner H. The zebrafish, brain-specific, aromatase cyp19a2 is neither expressed nor distributed in a sexually dimorphic manner during sexual differentiation. Dev. Dyn. (2007) 236:3155–3166.[CrossRef][Web of Science][Medline]
Katsu Y, Bermudez DS, Braun EL, Helbing C, Miyagawa S, Gunderson MP, Kohno S, Bryan TA, Guillette LJ, Iguchi T. Molecular cloning of the estrogen and progesterone receptors of the American alligator. Gen. Comp. Endocrinol. (2004) 136:122–133.[CrossRef][Web of Science][Medline]
Katsu Y, Lange A, Ichikawa R, Urushitani H, Paull GC, Cahill LL, Jobling S, Tyler CR, Iguchi T. Functional associations between two estrogen receptors, environmental estrogens and sexual disruption in the roach (Rutilus rutilus). Environ. Sci. Technol. (2007) 41:3368–3374.[Medline]
Kazeto YK, Ijiri S, Place AR, Zohar Y, Trant JM. The 5'-flanking regions of CYP19A1 and CYP19A2 in zebrafish. Biochem. Biophys. Res. Commun. (2001) 288:503–508.[CrossRef][Web of Science][Medline]
Kishida M, Callard GV. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology (2001) 142:740–750.
Kwon JY, McAndrew BJ, Penman DJ. Cloning of brain aromatase gene and expression of brain and ovarian aromatase genes during sexual differentiation in genetic male and female Nile tilapia Oreochromis niloticus. Mol. Reprod. Dev. (2001) 59:359–370.[CrossRef][Web of Science][Medline]
Länge R, Hutchinson TH, Croudace CP, Siegmund F, Schweinfurth H, Hampe P, Panter GH, Sumpter JP. Effects of the synthetic estrogen 17
-ethinylestradiol on the life-cycle of the fathead minnow (Pimephales promelas). Environ. Toxicol. Chem. (2001) 20:1216–1227.[CrossRef][Web of Science][Medline]
Larsen MG, Hansen KB, Henriksen PG, Baatrup E. Male zebrafish (Danio rerio) courtship behaviour resists the feminising effects of 17
-ethinyloestradiol - morphological sexual characteristics do not. Aquat. Toxicol. (2008) 87:234–244.[CrossRef][Web of Science][Medline]
Larsson DGJ, Adolfsson-Erici M, Parkkonen J, Pettersson M, Berg AH, Olsson PE, Forlin L. Ethinyloestradiol—an undesired fish contraceptive? Aquat. Toxicol. (1999) 45:91–97.[Medline]
Leaños-Castañeda O, Van Der Kraak G. Functional characterization of estrogen receptor subtypes, ER
and ERβ, mediating vitellogenin production in the liver of rainbow trout. Toxicol. Appl. Pharmacol. (2007) 224:116–125.[CrossRef][Web of Science][Medline]
Legler J, Broekhof JLM, Brouwer A, Lanser PH, Murk AJ, Van der Saag PT, Vethaak AD, Wester P, Zivkovic D, Van der Burg B. A novel in vivo bioassay for (xeno-)estrogens using transgenic zebrafish. Environ. Sci. Technol. (2000) 34:4439–4444.
Liney KE, Jobling S, Shears JA, Simpson P, Tyler CR. Assessing the sensitivity of different life stages for sexual disruption in roach (Rutilus rutilus) exposed to effluents from wastewater treatment works. Environ. Health Perspect. (2005) 113:1299–1307.[Web of Science][Medline]
Ma CH, Dong KW, Yu KL. cDNA cloning and expression of a novel estrogen receptor beta- subtype in goldfish (Carassius auratus). Biochim. Biophys. Acta-Gene Struct. Expression (2000) 1490:145–152.
Menuet A, Le Page Y, Torres O, Kern L, Kah O, Pakdel F. Analysis of the estrogen regulation of the zebrafish estrogen receptor (ER) reveals distinct effects of ERalpha, ERbeta1 and ERbeta2. J. Mol. Endocrinol. (2004) 32:975–986.[Abstract]
Menuet A, Pellegrini E, Anglade I, Blaise O, Laudet V, Kah O, Pakdel F. Molecular characterization of three estrogen receptor forms in zebrafish: Binding characteristics, transactivation properties, and tissue distributions. Biol. Reprod. (2002) 66:1881–1892.
Nash JP, Kime DE, Van der Ven LTM, Wester PW, Brion F, Maack G, Stahlschmidt-Allner P, Tyler CR. Long-term exposure to environmental concentrations of the pharmaceutical ethynylestradiol causes reproductive failure in fish. Environ. Health Perspect. (2004) 112:1725–1733.[Web of Science][Medline]
Ninomiya Y, Mochii M, Eguchi G, Hasegawa T, Masushige S, Kato S. Tissue-specific response of estrogen receptor gene expression to estrogen in chick. Biochem. Biophys. Res. Commun. (1992) 187:1374–1380.[CrossRef][Web of Science][Medline]
Pakdel F, Feon S, Legac F, Lemenn F, Valotaire Y. In vivo estrogen induction of hepatic estrogen receptor mRNA and correlation with vitellogenin mRNA in rainbow trout. Mol. Cell. Endocrinol. (1991) 75:205–212.[CrossRef][Web of Science][Medline]
Parrott JL, Blunt BR. Life-cycle exposure of fathead minnows (Pimephales promelas) to an ethinylestradiol concentration below 1 ng/L reduces egg fertilization success and demasculinizes males. Environ. Toxicol. (2005) 20:131–141.[CrossRef][Web of Science][Medline]
Paull GC, Lange A, Henshaw AC, Tyler CR. Ontogeny of sexual development in the roach (Rutilus rutilus) and its interrelationships with growth and age. J. Morphol. (2008) 269:884–895.[CrossRef][Web of Science][Medline]
Piferrer F, Blazquez M, Navarro L, Gonzalez A. Genetic, endocrine, and environmental components of sex determination and differentiation in the European sea bass (Dicentrarchus labrax L.). Gen. Comp. Endocrinol. (2005) 142:102–110.[CrossRef][Web of Science][Medline]
Rodgers-Gray TP, Jobling S, Kelly C, Morris S, Brighty G, Waldock MJ, Sumpter JP, Tyler CR. Exposure of juvenile roach (Rutilus rutilus) to treated sewage effluent induces dose-dependent and persistent disruption in gonadal duct development. Environ. Sci. Technol. (2001) 35:462–470.[Medline]
Sabo-Attwood T, Kroll KJ, Denslow ND. Differential expression of largemouth bass (Micropterus salmoides) estrogen receptor isotypes alpha, beta, and gamma by estradiol. Mol. Cell. Endocrinol. (2004) 218:107–118.[CrossRef][Web of Science][Medline]
Segner H, Caroll K, Fenske M, Janssen CR, Maack G, Pascoe D, Schäfers C, Vandenbergh GF, Watts M, Wenzel A. Identification of endocrine-disrupting effects in aquatic vertebrates and invertebrates: Report from the European IDEA project. Ecotoxicol. Environ. Saf. (2003) 54:302–314.[CrossRef][Web of Science][Medline]
Simpson ER, Clyne C, Rubin G, Boon WC, Robertson K, Britt K, Speed C, Jones M. Aromatase—A brief overview. Annu. Rev. Physiol. (2002) 64:93–127.[CrossRef][Web of Science][Medline]
Socorro S, Power DM, Olsson PE, Canario AVM. Two estrogen receptors expressed in the teleost fish, Sparus aurata: cDNA cloning, characterization and tissue distribution. J. Endocrinol. (2000) 166:293–306.[Abstract]
Strüssmann CA, Nakamura M. Morphology, endocrinology, and environmental modulation of gonadal sex differentiation in teleost fishes. Fish Physiol. Biochem. (2002) 26:13–29.[CrossRef]
Tchoudakova A, Kishida M, Wood E, Callard GV. Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish. J. Steroid Biochem. Mol. Biol. (2001) 78:427–439.[CrossRef][Web of Science][Medline]
Tchoudakova A, Pathak S, Callard GV. Molecular cloning of an estrogen receptor b subtype from the goldfish, Carassius auratus. Gen. Comp. Endocrinol. (1999) 113:388–400.[CrossRef][Web of Science][Medline]
Ternes TA, Stumpf M, Mueller J, Haberer K, Wilken RD, Servos M. Behavior and occurrence of estrogens in municipal sewage treatment plants—I. Investigations in Germany, Canada and Brazil. Sci. Total Environ. (1999) 225:81–90.[CrossRef][Medline]
Trant JM, Gavasso S, Ackers J, Chung BC, Place AR. Developmental expression of cytochrome P450 aromatase genes (CYP19a and CYP19b) in zebrafish fry (Danio rerio). J. Exp. Zool. (2001) 290:475–483.[CrossRef][Web of Science][Medline]
Tyler CR, van Aerle R, Hutchinson TH, Maddix S, Trip H. An in vivo testing system for endocrine disruptors in fish early life stages using induction of vitellogenin. Environ. Toxicol. Chem. (1999) 18:337–347.[CrossRef][Web of Science]
Tyler CR, van der Eerden B, Jobling S, Panter G, Sumpter JP. Measurement of vitellogenin, a biomarker for exposure to oestrogenic chemicals, in a wide variety of cyprinid fish. J. Comp. Physiol. B-Biochem. Syst. Environ. Physiol. (1996) 166:418–426.[CrossRef]
van Aerle R, Pounds N, Hutchinson TH, Maddix S, Tyler CR. Window of sensitivity for the estrogenic effects of ethinylestradiol in early life-stages of fathead minnow, Pimephales promelas. Ecotoxicology (2002) 11:423–434.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

, points of attachment to pw. Bar: 50 µm.


