Skip Navigation


ToxSci Advance Access originally published online on September 15, 2008
Toxicological Sciences 2008 106(2):400-412; doi:10.1093/toxsci/kfn193
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
106/2/400    most recent
kfn193v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Pereira, Y.
Right arrow Articles by Labarre, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pereira, Y.
Right arrow Articles by Labarre, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please email: journals.permissions@oxfordjournals.org

Chromate Causes Sulfur Starvation in Yeast

Yannick Pereira*, Gilles Lagniel*, Emmanuel Godat*,{dagger}, Peggy Baudouin-Cornu*, Christophe Junot{dagger} and Jean Labarre*,1

* Laboratoire de Biologie Intégrative, SBIGeM/iBiTec-S, CEA/Saclay, F-91191 Gif-sur-Yvette Cedex, France {dagger} Service de Pharmacologie et d'Immunologie, SPI/iBiTec-S, CEA/Saclay, 91191 Gif-sur-Yvette Cedex, France

1 To whom correspondence should be addressed. Fax: +33-1-69-08-80-46. E-mail: jean.labarre{at}cea.fr.

Received April 25, 2008; accepted September 5, 2008


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Chromate is a widespread pollutant as a waste of human activities. However, the mechanisms underlying its high toxicity are not clearly understood. In this work, we used the yeast Saccharomyces cerevisiae to analyse the physiological effects of chromate exposure in a eukaryote cell model. We show that chromate causes a strong decrease of sulfate assimilation and sulfur metabolite pools suggesting that cells experience sulfur starvation. As a consequence, nearly all enzymes of the sulfur pathway are highly induced as well as enzymes of the sulfur-sparing response such as Pdc6, the sulfur-poor pyruvate decarboxylase. The induction of Pdc6 was regulated at the mRNA level and dependent upon Met32, a coactivator of Met4, the transcriptional activator of the sulfur pathway. Finally, we found that chromate enters the cells mainly through sulfate transporters and competitively inhibits sulfate uptake. Also consistent with a competition between the two substrates, sulfate supplementation relieves chromate toxicity. However, the data suggest that the chromate-mediated sulfur depletion is not simply due to this competitive uptake but would also be the consequence of competitive metabolism between the two compounds presumably at another step of the sulfur assimilation pathway.

Key Words: chromate; sulfate uptake; sulfur starvation; yeast; Saccharomyces cerevisiae.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Chromium is a very toxic metal shown as genotoxic and human carcinogen. It is used in metal industry and leather tanning, and environmental contaminations from these activities have made chromium a widespread pollutant. Chromium is mainly present in two forms: Cr(VI) (chromate, CrO42–), the most toxic form, and Cr(III) (chromite, Cr3+), which is considered less toxic (Dayan and Paine, 2001Go; Zhitkovich, 2005Go). The low toxicity of Cr(III) has generally been attributed to its ability to rapidly form complexes which poorly enter the cells, but this assumption is under debate (Beyersmann and Hartwig, 2008Go; Zhitkovich, 2005Go). Cr(VI) can readily cross cellular membranes and it is presumed that Cr(VI) is mainly transported via sulfate permeases (Alexander and Aaseth, 1995Go). Consistent with this notion, mutants defective in sulfate uptake are hyperresistant to chromate in a variety of organisms, such as bacteria (Ota et al., 1971Go), yeast (Cherest et al., 1997Go; Smith et al., 1995Go), other fungi (Roberts and Marzluf, 1971Go), and mammalian cells (Campbell et al., 1981Go). Furthermore, a competitive uptake between sulfate and chromate has been shown in Neurospora crassa (Roberts and Marzluf, 1971Go) and in plants (Skeffington et al., 1976Go). In the yeast Saccharomyces cerevisiae, two sulfate transporters of high affinity have been described (Cherest et al., 1997Go; Smith et al., 1995Go), Sul1 (Km = 4.5–7.5µM) and Sul2 (Km = 10µM), whose expression is supposed to be regulated by at least two transcriptional activators, Met4 (Thomas and Surdin-Kerjan, 1997Go) and Msn1 (Chang et al., 2003Go).

Once inside the cell, Cr(VI) is rapidly reduced to Cr(III) by intracellular reductants (i.e., ascorbate, cysteine, glutathione) producing short-life intermediates Cr (V) and Cr (IV). These intermediates are supposed to generate reactive oxygen species including hydroxyl radicals through Fenton-like reactions (Liu et al., 1997Go; Pourahmad and O'Brien, 2001Go; Shi and Dalal, 1990Go; Shi et al., 1994Go) leading to various oxidative damages including DNA damages, notably base oxidation (Slade et al., 2005Go; Sugden et al., 2001Go) and single-strand breaks (Casadevall and Kortenkamp, 1995Go). In addition, after reduction into the cells, Cr(III) has a strong tendency to form stable complexes with many cellular ligands, notably with DNA and small reductive ligands (L), ascorbate, histidine, glutathione, or cysteine (for review, see Salnikow and Zhitkowich, 2008). Such ternary Cr-DNA-L adducts are considered as the most relevant Cr-induced DNA damages since they have been shown responsible for most mutagenic damages (Quievryn et al., 2003Go; Zhitkovich et al., 2001Go).

Finally, a recent study in yeast identifies mRNA mistranslation as a major cause of Cr toxicity (Holland et al., 2007Go). This would lead to aberrant proteins prone to oxidation, carbonylation (Sumner et al., 2005Go), and aggregation (Holland et al., 2007Go).

Cadmium is another very toxic metal for which toxicity mechanism is still unclear (Tamas et al., 2006Go). In previous works (Fauchon et al., 2002Go; Vido et al., 2001Go), we showed that yeast cells elicit a strong induction of nearly all enzymes of the sulfur assimilation pathway and cysteine/glutathione synthesis pathway (Fig. 1) consistent with the importance of reduced glutathione (GSH) in cadmium detoxification (Li et al., 1997Go). The strong increase of GSH synthesis was further confirmed by metabolic analyses (Fauchon et al., 2002Go) (Lafaye et al., 2005aGo) revealing a good correlation between proteome and metabolome data.


Figure 1
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 1. The sulfur pathway in yeast. Sul1/Sul2: sulfate transporters; Met3: ATP sulfurylase; Met14: APS kinase; Met16: PAPS reductase; Met5/Met10: sulphite reductase; Met25: o-acetylhomoserine sulfydrylase; Met6: homocysteine methyl-transferase; Sam1/Sam2: S-adenosylmethionine synthase; Sah1: S-adenosylhomocysteinase; Cys4: cystathionine β-synthase; Cys3: cystathionine {gamma}-lyase; Gsh1: {gamma}-glutamyl-cysteine synthetase; Gsh2: glutathione synthetase.

 
Cadmium also induces a sulfur-sparing phenomenon in the global proteome examplified by the repression of some sulfur-rich enzymes of glycolysis concomitant to the strong induction of sulfur depleted isoenzymes (Fauchon et al., 2002Go). A striking example of such isoenzyme couple is the pyruvate decarboxylase enzymes Pdc1 (sulfur rich) and Pdc6 (sulfur poor). The data suggested that the saving of sulfur in proteins increases the amount of sulfur available for GSH synthesis. Interestingly, the induction of the sulfur-sparing response was found dependent on Met4, the transactivator of the sulfur pathway which thus controls both GSH synthesis and the mechanisms to save sulfur in proteins providing more sulfur atoms for GSH synthesis (Fauchon et al., 2002Go).

Up to now, cadmium treatment was the sole condition showed to induce the sulfur-sparing response. Here we used the Pdc1/Pdc6 expression switch as a reporter for screening environmental conditions inducing the sulfur-sparing response. This allowed us to show that sulfur starvation and chromate treatment induced the sulfur-sparing response. The data presented below also indicate that chromate inhibits sulfate uptake and causes intracellular depletion of sulfur metabolites suggesting that the induction of the sulfur-sparing response by chromate would be the consequence of intracellular sulfur depletion.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Yeast strains and growth conditions.
Saccharomyces cerevisiae strains used in this study are S288C (MAT{alpha} SUC2 gal2 mal mel flo1 flo8-1 hap1 ho bio1 bio6) (Mortimer and Johnston, 1986Go), W303-1A (MATa leu2-1,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15) (Wallis et al., 1989Go), {Delta}sul1{Delta}sul2 strain (ade2 his3 leu2 trp1 ura3 sul1::LEU2 sul2::URA3) (Cherest et al., 1997Go), YPH98 (MATa ura3-52 lys2-801amber ade2-101ochre trp1-1 leu2-1) (Sikorski and Hieter, 1989Go), and {Delta}met31 and {Delta}met32 strains (see below).

Cells were grown at 30°C in minimal YNB medium (0.67% yeast nitrogen base) supplemented with 2% glucose as a carbon source and with auxotrophic requirements when necessary. The standard YNB medium contains 30 mM sulfate. YNB with 10mM, 1mM, and with 100µM sulfate were also used in some experiments as indicated.

Construction of strains.
Disruptions of MET31 or MET32 were carried out by one-step PCR-mediated gene disruption (Baudin et al., 1993Go) in the YPH98 strain. Amplification of an URA3 cassette from Kluiveromyces lactis (gift from Marc Blondel) was performed using primers constituted of 5' and 3' flanking sequences of the gene to delete followed by a stretch of nucleotides homologous to the URA3 marker. Gene disruptions were confirmed by PCR. The primers used for the disruption of MET31 were TCATTAA CAAGTTGGGCTCAATATACACAGTCGATAGTCTATATGTGCATACGTGA and ATATGTATGTGTAGGTGTGCTGATGGAGACAAATACGTTTTCCTCTA GCCGTAGTT. The primers used for the disruption of MET32 were ATATAGTGG AAAAAAGTCAAGAGGTATTATAAATTTCAAAAAAGTACCAAACGTGA and CAGATGAATATATATTTTCTTATTTGAGAAGATACACGCTATTTACTCTTGTAGTT. The primers used to confirm MET31 and MET32 disruption were 182Umet31 (CAGAACCATATCTTGCCTC) and 183Umet32 (GTCGCCCTCGGAACTTTCC), respectively, and ura3A (GGCGTTGGTGATATCAGACC).

Stress conditions tested.
The stress conditions tested in this study were heat shock (shift to 37°C for 15 min), oxidative stress caused by H2O2 (0.4mM, 15 min), tertiary-butylhydroperoxide (tBOOH) (1mM, 1 h), menadione (3mM, 1 h), diamide (2mM, 1 h), osmotic stress (NaCl, 0.7 M, 30 min), ultraviolet (UV) irradiation (100 J/m2), sulfur starvation (cells were grown without sulfate for 15 h, Lafaye et al., 2005aGo), nitrogen starvation (1mM ammonium), and treatment with different toxic metals. The metal ions tested were sodium arsenite (0.3mM), nickel chloride (1mM), cobalt nitrate (3mM), mercuric chloride (5µM), cupric chloride (1mM), potassium antimonyl tartrate (0.5mM), sodium selenite (5mM), potassium chromate (0.2mM), and sodium molybdate (5mM). The metal concentrations were chosen to lead to a significant growth inhibition during the 3 h following metal addition (generation time increased more than twofold). After 3-h treatment, YPH98 cells were labeled with [35S]methionine for 20 min and total proteins were extracted and separated by two-dimensional (2D) gel electrophoresis.

RNA isolation, cDNA synthesis, and microarray hybridization.
Exponentially growing YPH98 cells were cultivated for 135 min at 30°C in YNB medium with or without CrO42– (20µM), cells were collected, and total RNAs were extracted using the RNeasy purification kit (Qiagen, Courtaboeuf, France). Gene expression was monitored with DNA microarrays manufactured by the Service de Génomique Fonctionnelle (CEA, Evry, France) mainly as described previously (Fauchon et al., 2002Go). Except that cDNAs were indirectly labeled: cDNAs corresponding to the samples to compare were synthetized from 40 µg of total RNA by reverse transcription using Superscript II reverse transcriptase (Invitrogen, Cergy-Pontoise, France) in the presence of aa-dUTP (Sigma Aldrich, Lyon, France). The cDNAs were purified on YM-30 Microcon filters (Amicon, Beverley, MA). To allow dye swap hybridizations, the half of each cDNA sample was labeled using either NHS-dUTP Cy5 or NHS-dUTP Cy3 (Amersham, Saclay, France).

The microarrays were scanned with a GENEPIX 4000B scanner. Spot intensities and fluorescence ratios were measured using the GENEPIX 3.0 software (Molecular Devices France, Saint Grégoire). The spots were retained for further analysis when the median of the ratios of 70% or more of the pixels was above the median of the background fluorescence plus two SDs. The fluorescence ratios of all spots of a microarray were normalized to 1 with the median of ratio correction factor.

Reverse Transcriptase–PCR analysis.
Total RNAs were extracted as described above and cDNAs synthesized by random hexanucleotide-primed reverse transcription from 1 µg of total RNA with Superscript II reverse transcriptase (Invitrogen) and random hexanucleotides (Roche Diagnostics, Meylan, France). Real-time quantitative PCR was performed using ABI PRISM 7000 (Applied Biosystems, Courtaboeuf, France) and using Sybr Green PCR master mix (Applied Biosystems), with PDC6, CYS3, SUL1, SUL2, or ACT1 specific primers, in triplicate. Relative gene expression was expressed as a ratio of PDC6 and CYS3 mRNA concentration to the mRNA of housekeeping gene (ACT1) concentration. For each gene, threshold cycle (Ct) was determined using 7000 software (Applied Biosystems). For each condition, relative gene expression ({Delta}Ct) was calculated as {Delta}Ct(gene X) = Ct(geneX) Ct(ACT1). Relative gene induction between control and experimental samples was calculated by the expression 2–({Delta}{Delta}Ct) were {Delta}{Delta}Ct is the difference of the two corresponding {Delta}Ct.

Chromate tolerance assays.
For chromate tolerance tests on plates, cells were grown exponentially (2 x 107 cells/ml) in YNB medium containing 100µM sulfate and 10-fold dilution series were spotted (5 µl) on YNB plates containing different concentrations of chromate and of sulfur sources (sulfate, homocysteine, methionine, oxidized glutathione). Plates were scanned after 4 days of incubation at 20°C. The experiments were repeated three times with essentially identical results.

Chromate was stable in the culture media used in this study, even in the presence of methionine or oxidized glutathione. In the presence of 0.5mM homocysteine, CrO42– was reduced to Cr3+ at low rate (less than 1µM of chromate reduction per hour).

The three reference strains used in this study (S288C, W303-1A, YPH98) show similar chromate tolerance levels though W303-1A cells were reproducibly slightly more resistant than S288C and YPH98 (data not shown).

35S efflux analysis.
S288C cells exponentially growing (2 x 107 cells/ml) in low sulfate minimum medium (100µM) were treated (or not) with 10µM chromate. After 30-min treatment, cells were labeled with 100 µCi of [35S]sulfate for 5 min. The culture was divided in two cell aliquots, each sample was spreaded onto filters and washed three times with water very quickly (in less than 1 min). The first filter was counted to determine the total radioactivity accumulated into the cells during the 35S preloading phase. The second filter was immediately resuspended in a fresh culture medium containing (or not) 10µM chromate. After 10-min incubation, the radioactivity released in the medium was measured: to avoid the counting of labeled cells that may separate from the filter during the incubation, the medium was centrifuged, and the supernatant was counted. The 35S efflux data presented are the percentage of the amount of the released radioactivity (measured in the supernatant) to the amount of total radioactivity accumulated into the cells after the 5 min [35S]sulfate labeling.

Concerning [35Cr]sulfate and [51Cr]chromate uptake experiments, the procedures are described in the legend of the corresponding figures.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Chromate and Sulfur Starvation Induces the Sulfur-Sparing Response
In response to cadmium, sulfur is saved in the yeast proteome. In this work, our aim was to identify other conditions inducing the sulfur-sparing response. We tested various stress conditions heat shock, oxidative stress (caused by H2O2, tBOOH, menadione, or diamide), NaCl stress, UV irradiation, sulfur starvation, nitrogen starvation, and treatments with different other toxic metals (Ni2+, As3+, Co2+, Hg2+, Cu2+, Ag3+, Sb3+, Formula, Formula, Formula). In these experiments, we used concentrations of metals that lead to a significant growth inhibition in the 3 h following addition of the metal (see MATERIALS AND METHODS). After 3-h treatment, cells were labeled with [35S]methionine for 20 min and total proteins were extracted and separated by 2D gel electrophoresis. The Pdc1/Pdc6 expression switch was used as a reporter to screen on 2D gels, the conditions leading to the sulfur-sparing response. Two conditions, sulfur starvation and chromate treatment corresponded to the criterium (Fig. 2A). In both cases, Cys3 (cystathionine-{gamma}-lyase), an enzyme of the sulfur amino acid pathway was also strongly induced as well as other enzymes of the sulfur pathway (Fig. 2B and not shown). Sulfur starvation is a physiological condition in which the saving of sulfur in proteins could be expected. Accordingly, the first example of sulfur-sparing response was evidenced in a bacterium under such conditions (Mazel and Marliere, 1989Go). In a previous study, we have indicated that sulfur limitation conditions were not able to induce the sulfur-sparing response (Fauchon et al., 2002Go), but we found later that in these previous experiments that sulfur limitation conditions were not effective due to the presence of an unidentified sulfur compound in the medium. The capacity of chromate to induce the sulfur-sparing response was more intriguing, and we next focused on chromate.


Figure 2
View larger version (133K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 2. Sulfur starvation and chromate treatment induce the expression of Pdc6. YPH98 cells growing exponentially (approximately 2 x 107 cells/ml) in standard YNB medium were exposed to different drugs and toxic metals (see MATERIALS AND METHODS) for 3 h and then labeled for 30 min with [35S]methionine. Protein extraction, 2D gel electrophoresis, and gel analysis were performed as previously described (Vido et al., 2001Go). (A) Screening for stressors that induce Pdc1/Pdc6 expression switch. The region of the autoradiograms containing Pdc1 and Pdc6 spots is shown. Are shown six of the stress conditions tested. Pdc1 and Pdc6 spots are indicated by an arrow. Only chromate exposure and sulfur starvation induced the Pdc1/Pdc6 expression switch. (B) Whole 2D gel autoradiograms obtained for the analysis of the response to chromate. Arrows indicate induced or repressed proteins in response to chromate, deduced from the comparison of autoradiograms obtained in standard (left) and chromate (right) conditions. Act1: actin; Cys3: cystathionine {gamma}-lyase; Eno1/2: enolase isoforms 1 and 2; Gre2: stress-responsive genes (3-methylbutanal reductase and NADPH-dependent methylglyoxal reductase); Met3: ATP sulfurylase; Met25: o-acetylhomoserine sulfydrylase; Oye3: old yellow enzyme; Pdc1/6: pyruvate decarboxylate isoforms 1 and 6. Act1 serves as internal standard protein.

 
Chromate Toxicity and Effects Depend on Sulfate Concentration
The chromate concentrations used in the preliminary experiment were high (200µM). We found that chromate toxicity is strongly dependent on the sulfur source and on the concentration of the sulfur source. Toxic chromate concentrations are in the range of 200–400µM when cells are grown in media containing high sulfate concentrations (e.g., 30mM in YNB medium). At a low sulfate concentration (100µM), which is not limiting for optimal yeast growth, doses of chromate of 5–20µM causes a marked growth inhibition. This toxicity can be relieved by increasing sulfate concentration in the medium (Fig. 3). We also observed that addition of 0.5mM methionine or of other sulfur sources in the medium has a similar effect (Fig. 3). These supplementations also abolish the proteomic response (not shown).


Figure 3
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 3. Sulfate or other sulfur sources relieve chromate toxicity. Yeast cells (2 x 107 cells/ml) were grown in YNB medium containing 100µM sulfate and 10-fold dilution series were spotted on YNB plates containing different concentrations of chromate and of sulfur sources as indicated. Plates were scanned after 4 days of incubation at 20°C. Essentially identical results were obtained with strains S288C, YPH98, and W303-1A. A representative result from three repetitions is presented for S288C strain.

 
We thus pursued the study using low sulfate media. We analysed the yeast proteome in response to different concentrations of chromate ranging from nontoxic (0 and 2.5µM) to toxic (5, 10, and 20µM) doses. After 3-h treatment, cells were labeled with [35S]methionine and total yeast proteins were extracted for 2D gel electrophoresis. As shown in Figure 4, the Pdc1/Pdc6 isoenzyme switch was clearly visible at concentration as low as 5µM. Another isoenzyme switch was also evidenced: the sulfur-rich enolase Eno2 (nine-sulfur amino acids) was repressed and the sulfur-poor isoenzyme Eno1 (five-sulfur amino acids) was induced, a result reminiscent to previous observations in response to cadmium (Fauchon et al., 2002Go). In addition to these isoenzyme switches, the analysis showed the induction of enzymes of the sulfur pathway (Met3, Met25, Cys3, Cys4) and of enzymes (Oye3, Gre2, YNL134c) whose function is not clear but previously shown to be induced under oxidative stress conditions (Godon et al., 1998). Globally, the protein expression pattern of cells treated with 5–20µM chromate under low sulfate conditions (Fig. 4) was very similar to that of 200µM chromate-treated cells under high sulfate conditions (Fig. 2B).


Figure 4
View larger version (59K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 4. Proteome response to chromate treatment. YPH98 cells exponentially growing (approximately 2 x 107 cells/ml) in low sulfate minimum medium (100µM) were treated with the indicated doses of chromate. After 3-h treatment, cells were labeled with [35S]methionine for 20 min and total proteins were extracted and separated by 2D gel electrophoresis as previously described (Vido et al., 2001Go). The central part of the 2D gels and a blown up of the Pdc6/Pdc1 region are presented. Induced proteins are indicated by an arrow. Are also shown the repressed isoenzymes Pdc1 and Eno2 and Act1 which serves as internal standard protein. Protein functions are indicated in the legend of Figure 2B.

 
The Chromate Response Is Regulated at the mRNA Level
We analysed whether the induction of Pdc6 by chromate was regulated at the mRNA level. PDC6 messenger level was measured by reverse transcriptase (RT)–PCR under the same experimental conditions as in the proteome analysis experiment (Fig. 4). PDC6 mRNA level was increased more than 100-fold following chromate treatment with toxic doses (5, 10, and 20µM) but remained unchanged at the lower dose (2.5µM) (Fig. 5A). CYS3 mRNA level was also strongly increased by the highest doses of chromate (Fig. 5B). These results largely correlated with proteome data. We also analysed the transcriptome (microarray analysis) of yeast cells grown in low sulfate medium in response to 20µM chromate treatment. The 40-most induced genes in response to chromate are listed in Table 1. Nearly 50% of these genes encode enzymes of the sulfur pathway and transporters of sulfur-containing compounds. Interestingly, PDC6, CYS3, CYS4, MET3, MET25, and YNL134C whose gene products were found induced on 2D gels (Fig. 4) belong to this list. We thus conclude to a good correlation between transcriptome and proteome data indicating that the proteomic response to chromate is mainly regulated at the mRNA level.


Figure 5
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 5. RT-PCR analysis of PDC6, CYS3, SUL1, and SUL2 mRNA levels in chromate-treated cells. Chomate dose-response profiles of (A) PDC6 mRNA, (B) CYS3 mRNA, (C) SUL1 mRNA, and (D) SUL2 mRNA. YPH98 cells exponentially growing (approximately 2 x 107 cells/ml) in low sulfate minimum medium (100µM) were treated with the indicated doses of chromate for 3 h (A–D) and collected for RNA extraction and RT-PCR analysis (MATERIALS AND METHODS). Expression levels are given as a percentage of induction level obtained for the 20µM dose of chromate (A–D). Data are the mean of two independent experiments performed with independent RNA preparations. SD is shown. (E) PDC6 and CYS3 mRNA levels in {Delta}met31 and {Delta}met32 mutant strains. Expression levels determined in the mutant-treated cells are relative to wild-type treated cells (arbitrarily standardized to 100). The strains were grown in 100µM sulfate medium and were treated with 20µM chromate for 135 min before analysis.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1 List of the 40-Most Induced Genes by Chromate Treatment

 
In microarray data, we noticed the high induction of SUL1, encoding one of the two high-affinity sulfate transporters. As this transporter may be critical for chromate uptake and toxicity, we reanalyzed SUL1 messengers by RT-PCR (Fig. 5C) and also included SUL2 (encoding the second sulfate transporter) mRNAs in the experiment. These RT-PCR analyses confirmed the high induction not only of SUL1 by chromate treatment but also of SUL2 (Fig. 5D). Surprisingly, this result suggests that chromate stimulates the expression of the sulfate uptake systems that are supposed to participate to chromate transport into the cell. Note that Sul1 and Sul2 proteins, which are highly hydrophobic, are not detectable on 2D gels.

Met32 Is a Main Regulator of the Sulfur-Sparing Response
The high induction of enzymes of the sulfur amino acid pathway in response to chromate strongly suggested the involvement of Met4, the transactivator of the pathway. However, it was impossible to test whether PDC6 induction was impaired in a {Delta}met4 strain since the addition of methionine for growth of this methionine auxotroph strain relieves chromate toxicity and abolishes the chromate response (above mentioned). However, it was possible to test the importance of two coactivators of Met4, Met31, and Met32. These factors are related zinc finger proteins belonging to the Met4 transactivation complex (Blaiseau and Thomas, 1998Go; Blaiseau et al., 1997Go). Though they are important in transcriptional regulation of MET genes, strains deprived of either factor are methionine prototroph (Blaiseau et al., 1997Go). Two other coactivators of Met4 have been described, Met28 and Cbf1, but the strains deleted for either factor are methionine auxotroph (Thomas and Surdin-Kerjan, 1997Go). The wild-type and the two mutant strains {Delta}met31 and {Delta}met32 were grown in low sulfate medium, treated with 20µM chromate and processed for 2D gel analysis (not shown), RT-PCR analysis (Fig. 5E), and microarray analysis (Table 1). Interestingly, the induction of PDC6 (Pdc6) was abolished specifically in {Delta}met32 strain indicating that the sulfur-sparing response is controled by Met32 and then probably depends on Met4 activity. Microarray experiments indicate that Met32 is important for the induction of some genes with functions involved in assimilation of extracellular sulfur sources (i.e., JLP1, SUL1, DAL5, YCT1, BDS1). Notably, Met32 also controls the induction of genes whose function does not seem to be directly related to sulfur metabolism, Pdc6 as shown below, Hsp26 which is totally devoid of sulfur amino acid, and Crf1 which is a factor involved in the transcriptional repression of ribosomal protein genes (Martin et al., 2004Go). These three proteins are presumed to be involved in sulfur-sparing since Pdc6 and Hsp26 are sulfur-poor enzymes and Crf1 have a negative effect on the expression of sulfur-rich proteins (ribosomal proteins). In contrast to the clear effects observed in {Delta}met32 strain, no significant defect was observed in the {Delta}met31 strain (Fig. 5E). Interestingly, the same experiments (2D gel analysis, RT-PCR analysis, and microarray analysis) were performed under cadmium conditions and confirmed that the sulfur-sparing response induced by this metal is also dependent on the presence of the coactivator Met32 but not of Met31 (data not shown).

Chromate Causes Sulfur Starvation
Whereas induction of the sulfur-sparing response was easy to interpret in the case of sulfur starvation, the physiological meaning of this response was less clear in the case of chromate intoxication. However, a relationship between chromate and sulfur metabolism could be inferred from three different observations. First, most mutants resistant to chromate are mutants of the sulfur assimilation pathway (Cherest et al., 1997Go). Second, we observed that chromate toxicity is strongly dependent on sulfate concentration in the medium (above mentioned). Third, the strong induction of genes (Table 1) and enzymes (Fig. 4) of the sulfur amino acid pathway also suggested that sulfur metabolite pools may be modified under chromate conditions. We thus examined the effect of chromate treatment on the pools of the different sulfur metabolites. Cells grown in minimum medium with low sulfate concentration (100µM) were treated with 10 and 20µM chromate and processed after 4-h treatment for measurement of sulfur metabolite concentrations as previously described (Lafaye et al., 2005aGo, see MATERIALS AND METHODS). All metabolite pools of the sulfur pathway were decreased by chromate treatment, some of them such as homocysteine, {gamma}Glu-Cys, and both reduced (GSH) and oxidized (GSSG) glutathione were reduced to a large extend (Table 2). This intracellular depletion of sulfur metabolites is similar to the depletion observed when cells are starved for sulfur source (Lafaye et al., 2005aGo) suggesting that one effect of chromate is to cause sulfur starvation. As these experiments were performed in a specific medium with low sulfate concentration (100µM) which could have artifactually enhanced the depletion of sulfur metabolites, we also analysed sulfur metabolic pools in a sulfate-rich medium (1mM). Cells were treated with 50 and 100µM chromate for 4 h, and metabolite pools were extracted and analysed. Very similar to the precedent results, all sulfur metabolite pools were strongly decreased (Table 2), indicating that chromate causes sulfur depletion even in sulfate-rich media. Note that the observed depletion of sulfur metabolites is not a trivial consequence of cell growth inhibition since other stress conditions (H2O2, cadmium, or arsenite treatment) also inhibiting growth rate do not result in significant changes in sulfur metabolite pools (H2O2) or result in an increase in sulfur metabolite pools (cadmium, arsenite) (Lafaye et al., 2005aGo; Thorsen et al., 2007Go).


View this table:
[in this window]
[in a new window]

 
TABLE 2 Chromate Causes a Strong Decrease Sulfur Metabolite Pools

 
Competitive Transport between Sulfate and Chromate
A hypothesis to explain the observed chromate-induced sulfur depletion would be that chromate interferes with sulfate uptake or metabolism. A competitive uptake between chromate and sulfate has been shown in plants (Skeffington et al., 1976Go) and fungi (Roberts and Marzluf, 1971Go). We thus analysed whether chromate also inhibits sulfate transport into yeast cells. We determined the apparent Km of sulfate uptake in the presence of increasing concentration of chromate (0, 50, and 200µM) using Michaelis-Menten representation (Fig. 6A) and nonlinear regression (see MATERIALS AND METHODS). The apparent Km for sulfate increased from 5µM in the absence of chromate to 52 and 280µM in the presence of chromate 50 and 200µM, respectively. The results were plotted in Linewaver-Burk representation (Fig. 6B) demonstrating a typical competition behavior between the two substrates. The Km for sulfate was 5 ± 1µM consistent with previous results (Cherest et al., 1997Go; Smith et al., 1995Go), and the Km for chromate was found in the same range: 4.5 ± 1 µM. Sulfate and chromate have thus a similar affinity for the sulfate transporters.


Figure 6
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 6. Chromate competitively inhibits sulfate uptake. (A) Rate of sulfate uptake as function of sulfate concentration. S288C cells exponentially growing (approximately 2 x 107 cells/ml) in low sulfate minimum medium (100µM) were washed and resuspended in minimum medium containing different concentrations of sulfate (2, 5, 10, 20, 50, 100, 200 and 500µM). For each sulfate concentration, 20 µCi of [35S]sulfate was added to 1 ml culture simultaneously with different chromate concentrations (0, 50, 200µM). Cells were incubated 5 min (preliminary experiments have shown that the amount of sulfate transported into the cells increases linearly for at least the first 6 min of incubation) at 30°C, filtrated and washed three times with water, and counted on liquid scintillation counter. Determination of Formula as been performed using a nonlinear regression algorithm. Sulfate uptake is expressed in arbitrary units (counts per minute x total sulfate concentration). (B) Linewaver-Burk representation of the data presented in (A). This representation evidences a typical subtract competition pattern. The Ki (or Km) for chromate was deduced from the measurement of Formula for sulfate in the presence of 50 and 200 µM chromate and assuming a competition mechanism between the two substrates. The two deduced Ki values were respectively 5.2 and 3.7 µM. Based on these data, Ki for chromate was 4.5 ± 1µM.

 
Consistent with a competition between sulfate and chromate for transporters, we also observed a strong inhibition of chromate uptake in the presence of sulfate (Fig. 7A). This result is good accordance with the observation that chromate tolerance is dependent upon sulfate concentration in the culture medium as mentioned above. In order to definitively assess the involvement of sulfate transporters in chromate uptake, we measured the chromate uptake in {Delta}sul1{Delta}sul2 mutant cells. This strain is devoid of the two high-affinity sulfate transporters (Cherest et al., 1997Go). Since this mutant is unable to grow with sulfate as sole sulfur source, the experiment should be performed in a medium supplemented with an organic sulfur source. Methionine could not be used since its presence in the medium dramatically decreased sulfate uptake (Breton and Surdin-Kerjan, 1977Go) and chromate uptake in the wild-type strain (Fig. 7B). We presumed that this is due to the repression of SUL1 and SUL2 by methionine (Cherest et al., 1997Go). We thus used homocysteine (200µM) as sulfur source since this sulfur compound allows a comparable growth rate for both strains and does not totally stop sulfate uptake (not shown). Accordingly, the transport of chromate in the wild-type strain was less affected when cells were grown in the presence of homocysteine (Fig. 7B). In these conditions, the transport of chromate was markedly decreased in the {Delta}sul1{Delta}sul2 mutant (Fig. 7C), indicating a large contribution of sulfate transporters in chromate uptake. The residual part of chromate uptake is independent of the presence of Sul1/2 transporters and corresponds to the chromate uptake observed in cells grown in methionine for which expression of SUL1 and SUL2 are totally repressed. Consistent with the diminished level of chromate entry, the {Delta}sul1{Delta}sul2 mutant strain is hyperresistant to chromate (Cherest et al., 1997Go, Fig. 7D).


Figure 7
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 7. Chromate enters the cells through sulfate transporters. (A) Inhibition of chromate transport by sulfate. W303-1A cells were grown to exponential phase (approximately 2 x 107 cells/ml) in the presence of homocysteine 200µM. Different aliquots of the culture were supplemented with different sulfate concentrations and with 100 µCi of [51Cr]chromate (8µM final concentration). After a 20-min incubation at 30°C, cells were filtrated, washed three times with water, and counted on liquid scintillation counter. (B) Repression of chromate transport by methionine and homocysteine. W303-1A cells were grown to exponential phase in the presence of different sulfur sources: 30µM sulfate or 30µM sulfate + 200µM methionine, 30µM sulfate + 200µM homocysteine. [51Cr]chromate was added at 8µM final concentration, and the rate of [51Cr]chromate transport was measured. (C) Chromate uptake is decreased in strains deprived of sulfate transporters. W303-1A and {Delta}sul1{Delta}sul2 strains were grown to exponential phase in the presence of 30µM sulfate + 200µM homocysteine. [51Cr]-chromate was added at 50µM final concentration, and the rate of [51Cr]chromate transport was measured. Mean values and SDs of two independent experiments are presented. (D) {Delta}sul1{Delta}sul2 strain is resistant to chromate. W303-1A and {Delta}sul1{Delta}sul2 strains were grown to exponential phase in low sulfate (100µM) minimum medium containing 0.2mM oxidized glutathione (GSSG). Ten-fold dilution series were spotted on minimum medium plates containing 100µM sulfate, 0.2mM GSSG, and the indicated concentrations of chromate. Plates were scanned after 4 days of incubation at 20°C. A representative result from three repetitions is presented.

 
Chromate Induces the Efflux of a Sulfur Compound and Strongly Decreases the Flux in the Sulfate Assimilation Pathway
According to the sulfate transporter properties, that is, a Michaelis-Menten behavior with global Km for sulfate and chromate close to 5µM and a competition between the two substrates, the addition of 10µM chromate in the presence of 100µM sulfate should reduce the sulfate uptake by less than 10%. It seems unlikely that such a small reduction in sulfate uptake would cause the strong depletion of sulfur metabolites observed in Table 2. However, in these experiments, chromate was added simultaneously with [35S]sulfate for uptake analysis, and it cannot be excluded that chromate affects sulfate uptake to a larger extend after some time of treatment. We thus performed a kinetics of sulfate uptake after chromate treatment. Cells growing in the presence of 100µM sulfate medium were treated with 20µM chromate, and uptake of [35S]sulfate (3-min labeling) was tested at different times after chromate addition (Fig. 8A). As expected, immediately after chromate addition, the 20% decrease in sulfate transport is consistent with a competition between the two compounds. This rate of sulfate uptake did not change significantly with time of chromate treatment. In the course of this experiment, we also measured 35S radioactivity accumulated into the cells as a function of the labeling duration (Fig. 8B). Whereas untreated cells accumulated sulfur 35 proportionally to the labeling duration, the accumulation of radioactivity was linear only during the first minutes in chromate treated cells. As soon as 15 min and 30 min after the beginning of the labeling for respectively 20 and 10µM chromate-treated cells, the amount of incorporated sulfur 35 reaches a plateau. As the [35S]sulfate uptake rate is unchanged in the course of chromate treatment (Fig. 8A), these saturation curves suggest a high efflux of a 35S-compound in chromate-treated samples. We developed an assay to confirm this hypothesis in a more direct manner. Briefly, chromate-treated and untreated cells shortly labeled with [35S]sulfate (5 min) were quickly washed and reincubated in the same medium, followed by a radioactive counting of the supernatant (for detailed procedure, see MATERIALS AND METHODS). While the level of 35S efflux was low in untreated cells (7.8% of preloaded [35S]sulfate), it reached 73% for chromate treated cells (Fig. 8C). We were unable to characterize the exported sulfur compound. It can be sulfate itself or another sulfur compound of the assimilation pathway. As a consequence, the metabolic flux in the sulfur pathway of chromate-treated cells is strongly reduced (Fig. 8B) consistent with the chromate-induced depletion of most sulfur metabolite pools.


Figure 8
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 8. Chromate treatment strongly reduces the flux in the sulfur pathway. (A) Analysis of sulfate uptake after chromate treatment. S288C cells exponentially growing (2 x 107 cells/ml) in low sulfate minimum medium (100µM) were treated with 20µM chromate or untreated. [35S]sulfate (10 µCi) was added to 1 ml of treated and untreated cultures 1, 10, 20, 30, and 40 min after the beginning of chromate treatment. The amount of radioactivity present into the cells was measured after 3 min labeling and was expressed in counts per minute (cpm). Mean values and SDs of two independent experiments are presented. (B) Kinetics of 35SO4 incorporation in chromate-treated cells. S288C cells grown as in (A) were dispatched in three cultures of 8 ml and were treated with respectively 0, 10, and 20µM chromate. After 30 min of treatment, 160 µCi of [35S]sulfate was added to each culture. The amount of radioactivity accumulated into the cells was measured (in cpm) at the indicated time after [35S]sulfate addition : 3, 5, 10, 15, 20, 30, and 40 min. (C) Estimation of 35S efflux from chromate-treated cells. Chromate-treated (and untreated) cells were preloaded with [35S]sulfate, and 35S efflux was measured as described in MATERIALS AND METHODS. Mean values and SDs of two independent experiments are presented.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
We show that chromate enters yeast cells mainly through sulfate transporters and inhibits the sulfate assimilation pathway. Consistently, it causes a strong decrease of sulfur metabolite pools suggesting that cells treated with chromate experience sulfur starvation. As a consequence, nearly all enzymes of the sulfur pathway are highly induced as well as enzymes involved in sparing sulfur in proteins.

Chromate Enters Yeast Cells Mainly through Sulfate Transporters
Uptake of chromate by sulfate transporters has been suggested in different organisms. In bacteria (Ota et al., 1971Go), yeast (Cherest et al., 1997Go; Smith et al., 1995Go), fungi (Roberts and Marzluf, 1971Go), and mammalian cells (Campbell et al., 1981Go), mutants defective in sulfate uptake are hyperresistant to chromate. Moreover, a competitive uptake between sulfate and chromate has been shown in N. crassa (Roberts and Marzluf, 1971Go) and in barley seedlings (Skeffington et al., 1976Go).

In yeast, no direct proof of chromate entry through endogenous sulfate transporters has been provided although previous reports are consistent with this idea (Breton and Surdin-Kerjan, 1977Go; Cherest et al., 1997Go; Kim et al., 2006Go). We show here a competitive uptake between chromate and sulfate with similar affinity for both substrates, and we identify the involvement of the sulfate transporters Sul1 and Sul2 in this process. These results are consistent with the observation that chromate toxicity is strongly dependent upon sulfate concentration in the medium. The uptake of chromate by sulfate transporters would also explain why methionine supplementation relieves chromate toxicity: methionine addition represses Met4 activity and MET gene expression (for review, Thomas and Surdin-Kerjan, 1997Go) including SUL1 and SUL2, leading to a decreased sulfate (and chromate) transport (observed in Fig. 7B).

Our data also establish that another system contributes to the transport of significant amounts of chromate. It is not a third sulfate transporter since sulfate uptake is completely abolished in {Delta}sul1{Delta}sul2 mutant cells (Cherest et al., 1997Go, data not shown). The chromate transport remaining in the mutant may correspond to diffusion or to the contribution of another permease transporting compounds structurally similar to chromate (e.g., molybdate or phosphate).

Chromate Causes Sulfur Starvation
We also showed in this work that chromate causes a strong decrease of sulfur assimilation flux and of sulfur metabolite pools including GSH. It is tempting to consider that this sulfur depletion can be a direct consequence of the inhibition of sulfate uptake by chromate. However, it seems not obvious that a simple competition between two substrates (sulfate and chromate) for which the transporter exhibits a similar Km, with a 10/20-fold lower concentration of chromate versus sulfate, would lead to a striking decrease of the flux in the sulfur pathway and to the dramatic depletion of sulfur metabolites. A block in another enzymatic step of the sulfur assimilation pathway can also be envisaged. Interestingly, chromate has been described to strongly compete with sulfate for ATP-sulfurylase from rat (Yu et al., 1989Go). The Km of this enzyme for chromate and sulfate were respectively 12 and 210 µM indicating a higher affinity for chromate. If Met3, the ATP-sulfurylase from yeast (Fig. 1) has similar properties, the preferred metabolization of chromate at this step would strongly reduce the flux in the sulfur assimilation pathway, as observed in our experiments. According to this hypothesis, the exported sulfur compound would be nonmetabolized sulfate, substrate of ATP-sulfurylase.

Interestingly, selection of chromate-resistant mutants has led to the identification of SUL1, SUL2, MET3, MET14, and MET16 (Breton and Surdin-Kerjan, 1977Go) corresponding to the first steps in the sulfur assimilation pathway (Fig. 1). A hypothesis is that the resistance of these mutant strains may be due to the absence of metabolization of chromate into a more toxic product through the pathway. Another possibility is an indirect effect of these mutations on chromate/sulfate transport activity. In these mutants, the presumed intracellular accumulation of intermediate metabolites, sulfate, or APS may have an inhibitory effect on sulfate permeases as suggested previously (Breton and Surdin-Kerjan, 1977Go).

Chromate Toxicity
According to literature, three main hypotheses have been proposed for chromate toxicity: (1) its reduction to Cr(V)/Cr(IV) leading to Fenton reactions and oxidative damages, (2) the formation of Cr(III)-DNA-L adducts, and (3) protein oxidation and aggregation. The three hypotheses are not exclusive.

We show here that chromate also causes intracellular sulfur depletion but we do not know whether the sulfur depletion state in the cells contributes effectively to chromate toxicity. The addition of methionine relieves chromate toxicity, but we cannot establish if this protecting effect is only due to the decreased chromate uptake (observed in Fig. 7B) or if the expected repletion of sulfur metabolite pools by methionine has also a contribution for yeast survival. Conversely, a decrease of cysteine and particularly GSH pools may also be an appropriate response since GSH is supposed to be the main cellular reductant in yeast responsible for the generation of oxidative damages (according to the first hypothesis) or/and for production of Cr(III)-DNA-L adducts (hypothesis 2). However, we observed that {Delta}gsh1 strains (with GSH pool decreased to 1/100 of the pool in the wild type strain, Spector et al., 2001Go) have the same level of chromate resistance as the wild-type strain (data not shown).

A puzzling observation is the high induction of SUL1 and SUL2 by chromate (Figs. 5C and D). If SUL1 and SUL2 mRNAs are translated into active sulfate/chromate transporters, this would result in the amplification of the chromate intoxication process. It is not known whether Sul1 and Sul2 proteins are expressed but this can be suggested from the good correlation between mRNA inductions and protein inductions shown in this work. However, concerning their functionality, we have no evidence that the transporters neo-synthesized under chromate conditions are active since the treatment does not increase sulfate transport activity (Fig. 8A). This observation may be consistent with a recent study in yeast showing that chromate increases the level of mistranslation leading to aggregation of neo-synthesized proteins (Holland et al., 2007Go).

Cadmium, Chromate, and Sulfur Starvation Induce the Sulfur-Sparing Response
The sulfur-sparing response was first evidenced in response to cadmium and linked to the necessity to increase the synthesis of GSH (Fauchon et al., 2002Go). We have identified in this work two other conditions inducing this response, sulfur starvation, and chromate treatment. In both cases, sulfur metabolite levels and particularly GSH are dramatically decreased (Lafaye et al., 2005aGo, this work). We thus presume that the sulfur-sparing response is induced in the two last different conditions as the result of intracellular sulfur deprivation. Among these three conditions, sulfur starvation is probably more often experienced by S. cerevisiae cells in their natural environment than the presence of cadmium or chromate in relevant concentrations. Interestingly, the only other example of a sulfur-sparing (described for cyanobacteria) has been observed in sulfur starvation conditions (Mazel and Marliere, 1989Go).

The transcriptional activator Met4 was found to play an important role in the induction of the sulfur-sparing response under cadmium conditions. Our data suggest that Met4 is also implicated in this response under chromate conditions. Met4, which controls the expression of all enzymes of the sulfur pathway, would also coordinate sulfur-sparing in proteins in response to both metals. However, the comparison between the two metals points out a fundamental difference: while both metals highly induce enzymes of sulfur metabolism, these inductions fully correlate to the increased flux in the sulfur pathway in the case of cadmium and negatively correlate with flux data in the case of chromate. This difference is probably the direct consequence of substrate availability, augmented under cadmium conditions and dramatically decreased under chromate conditions as shown in this work. This analysis thus shows that in same metabolic pathway, proteome and metabolome data can be positively or negatively correlated depending on the toxicological conditions used.


    FUNDING
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Commissariat à l'Energie Atomique (Programme de Toxicologie Nucléaire) and Agence Nationale de la Recherche (ANR, programme blanc 2005).


    ACKNOWLEDGMENTS
 
We thank Yolande Kerjan for providing {Delta}sul1{Delta}sul2 strain and for critical reading of the manuscript and Laurent Kuras and Dominique Thomas for critical discussions and review of the paper. We are grateful to Alexandra Lafaye for her preliminary metabolome experiments with chromate-treated cell extracts and Marie-Claude Gaillard for advices on RT-PCR analyses.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 FUNDING
 REFERENCES
 
Alexander J, Aaseth J. Uptake of chromate in human red blood cells and isolated rat liver cells: The role of the anion carrier. Analyst (1995) 120:931–933.[CrossRef][Medline]

Baudin A, Ozier-Kalogeropoulos O, Denouel A, Lacroute F, Cullin C. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. (1993) 21:3329–3330.[Free Full Text]

Beyersmann D, Hartwig A. Carcinogenic metal compounds: Recent insight into molecular and cellular mechanisms. Arch. Toxicol. (2008) 493–512.

Blaiseau PL, Isnard AD, Surdin-Kerjan Y, Thomas D. Met31p and Met32p, two related zinc finger proteins, are involved in transcriptional regulation of yeast sulfur amino acid metabolism. Mol. Cell Biol. (1997) 17:3640–3648.[Abstract/Free Full Text]

Blaiseau PL, Thomas D. Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA. Embo J (1998) 17:6327–6336.[CrossRef][Web of Science][Medline]

Breton A, Surdin-Kerjan Y. Sulfate uptake in Saccharomyces cerevisiae: Biochemical and genetic study. J. Bacteriol. (1977) 132:224–232.[Abstract/Free Full Text]

Campbell CE, Gravel RA, Worton RG. Isolation and characterization of Chinese hamster cell mutants resistant to the cytotoxic effects of chromate. Somatic Cell Genet. (1981) 7:535–546.[CrossRef][Web of Science][Medline]

Casadevall M, Kortenkamp A. The formation of both apurinic/apyrimidinic sites and single-strand breaks by chromate and glutathione arises from attack by the same single reactive species and is dependent on molecular oxygen. Carcinogenesis (1995) 16:805–809.[Abstract/Free Full Text]

Chang KS, Won JI, Lee MR, Lee CE, Kim KH, Park KY, Kim SK, Lee JS, Hwang S. The putative transcriptional activator MSN1 promotes chromium accumulation in Saccharomyces cerevisiae. Mol. Cells (2003) 16:291–296.[Web of Science][Medline]

Cherest H, Davidian JC, Thomas D, Benes V, Ansorge W, Surdin-Kerjan Y. Molecular characterization of two high affinity sulfate transporters in Saccharomyces cerevisiae. Genetics (1997) 145:627–635.[Abstract]

Dayan AD, Paine AJ. Mechanisms of chromium toxicity, carcinogenicity and allergenicity: Review of the literature from 1985 to 2000. Hum. Exp. Toxicol. (2001) 20:439–451.[Abstract/Free Full Text]

Fauchon M, Lagniel G, Aude JC, Lombardia L, Soularue P, Petat C, Marguerie G, Sentenac A, Werner M, Labarre J. Sulfur sparing in the yeast proteome in response to sulfur demand. Mol. Cell (2002) 9:713–723.[CrossRef][Web of Science][Medline]

Godon C, Lagniel G, Lee J, Buhler JM, Kieffer S, Perrot M, Boucherie H, Toledano MB, Labarre J. The H2O2 stimulon in Saccharomyces cerevisiae. J. Biol. Chem. (1998) 273:22480–22489.[Abstract/Free Full Text]

Holland S, Lodwig E, Sideri T, Reader T, Clarke I, Gkargkas K, Hoyle DC, Delneri D, Oliver SG, Avery SV. Application of the comprehensive set of heterozygous yeast deletion mutants to elucidate the molecular basis of cellular chromium toxicity. Genome Biol. (2007) 8:R268.[CrossRef][Medline]

Kim YJ, Kim JH, Lee CE, Mok YG, Choi JS, Shin HS, Hwang S. Expression of yeast transcriptional activator MSN1 promotes accumulation of chromium and sulfur by enhancing sulfate transporter level in plants. FEBS Lett. (2006) 580:206–210.[CrossRef][Web of Science][Medline]

Lafaye A, Junot C, Pereira Y, Lagniel G, Tabet JC, Ezan E, Labarre J. Combined proteome and metabolite-profiling analyses reveal surprising insights into yeast sulfur metabolism. J. Biol. Chem. (2005a) 280:24723–24730.[Abstract/Free Full Text]

Lafaye A, Labarre J, Tabet JC, Ezan E, Junot C. Liquid chromatography-mass spectrometry and 15N metabolic labeling for quantitative metabolic profiling. Anal. Chem. (2005b) 77:2026–2033.[Medline]

Li ZS, Lu YP, Zhen RG, Szczypka M, Thiele DJ, Rea PA. A new pathway for vacuolar cadmium sequestration in Saccharomyces cerevisiae: YCF1-catalyzed transport of bis(glutathionato)cadmium. Proc. Natl. Acad. Sci. U S A. (1997) 94:42–47.[Abstract/Free Full Text]

Liu KJ, Shi X, Dalal NS. Synthesis of Cr(IV)-GSH, its identification and its free hydroxyl radical generation: a model compound for Cr(VI) carcinogenicity. Biochem. Biophys. Res. Commun. (1997) 235:54–58.[CrossRef][Web of Science][Medline]

Martin DE, Soulard A, Hall MN. TOR regulates ribosomal protein gene expression via PKA and the Forkhead transcription factor FHL1. Cell (2004) 119:969–979.[CrossRef][Web of Science][Medline]

Mazel D, Marliere P. Adaptive eradication of methionine and cysteine from cyanobacterial light-harvesting proteins. Nature (1989) 341:245–248.[CrossRef][Web of Science][Medline]

Mortimer RK, Johnston JR. Genealogy of principal strains of the yeast genetic stock center. Genetics (1986) 113:35–43.[Abstract/Free Full Text]

Ota N, Galsworthy PR, Pardee AB. Genetics of sulfate transport by Salmonella typhimurium. J. Bacteriol. (1971) 105:1053–1062.[Abstract/Free Full Text]

Pourahmad J, O'Brien PJ. Biological reactive intermediates that mediate chromium (VI) toxicity. Adv. Exp. Med. Biol. (2001) 500:203–207.[Web of Science][Medline]

Quievryn G, Peterson E, Messer J, Zhitkovich A. Genotoxicity and mutagenicity of chromium(VI)/ascorbate-generated DNA adducts in human and bacterial cells. Biochemistry (2003) 42:1062–1070.[CrossRef][Web of Science][Medline]

Roberts KR, Marzluf GA. The specific interaction of chromate with the dual sulfate permease systems of Neurospora crassa. Arch. Biochem. Biophys. (1971) 142:651–659.[CrossRef][Web of Science][Medline]

Salnikow K, Zhitkovich A. Genetic and epigenetic mechanisms in metal carcinogenesis and cocarcinogenesis: nickel, arsenic, and chromium. Chem. Res. Toxicol. (2008) 21:28–44.[CrossRef][Web of Science][Medline]

Shi X, Dong Z, Dalal NS, Gannett PM. Chromate-mediated free radical generation from cysteine, penicillamine, hydrogen peroxide, and lipid hydroperoxides. Biochim. Biophys. Acta (1994) 1226:65–72.[Medline]

Shi XL, Dalal NS. Evidence for a Fenton-type mechanism for the generation of .OH radicals in the reduction of Cr(VI) in cellular media. Arch. Biochem. Biophys. (1990) 281:90–95.[CrossRef][Web of Science][Medline]

Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics (1989) 122:19–27.[Abstract/Free Full Text]

Skeffington RA, Shewry PR, Peterson PJ. Chromium uptake and transport in barley seedlings (Hordeum vulgare L.). Planta (1976) 132:209–214.[CrossRef][Web of Science]

Slade PG, Hailer MK, Martin BD, Sugden KD. Guanine-specific oxidation of double-stranded DNA by Cr(VI) and ascorbic acid forms spiroiminodihydantoin and 8-oxo-2'-deoxyguanosine. Chem. Res. Toxicol. (2005) 18:1140–1149.[CrossRef][Web of Science][Medline]

Smith FW, Hawkesford MJ, Prosser IM, Clarkson DT. Isolation of a cDNA from Saccharomyces cerevisiae that encodes a high affinity sulphate transporter at the plasma membrane. Mol. Gen. Genet. (1995) 247:709–715.[CrossRef][Web of Science][Medline]

Spector D, Labarre J, Toledano MB. A genetic investigation of the essential role of glutathione: Mutations in the proline biosynthesis pathway are the only suppressors of glutathione auxotrophy in yeast. J. Biol. Chem. (2001) 276:7011–7016.[Abstract/Free Full Text]

Sugden KD, Campo CK, Martin BD. Direct oxidation of guanine and 7,8-dihydro-8-oxoguanine in DNA by a high-valent chromium complex: A possible mechanism for chromate genotoxicity. Chem. Res. Toxicol. (2001) 14:1315–1322.[CrossRef][Web of Science][Medline]

Sumner ER, Shanmuganathan A, Sideri TC, Willetts SA, Houghton JE, Avery SV. Oxidative protein damage causes chromium toxicity in yeast. Microbiology (2005) 151:1939–1948.[Abstract/Free Full Text]

Tamás M, Labarre J, Toledano MB, Wysocki R. Mechanisms of toxic metal tolerance in yeast. In: Topics in Current Genetics—Tamas MJ, Martinoia E, eds. (2006) Molecular Biology of Metal Homeostasis and Detoxification - From Microbes to Man. Heidelberg, Springer Verlag 395–435.

Thomas D, Surdin-Kerjan Y. Metabolism of sulfur amino acids in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. (1997) 61:503–532.[Abstract/Free Full Text]

Thorsen M, Lagniel G, Kristiansson E, Junot C, Nerman O, Labarre J, Tamas MJ. Quantitative transcriptome, proteome, and sulfur metabolite profiling of the Saccharomyces cerevisiae response to arsenite. Physiol. Genomics (2007) 30:35–43.[Abstract/Free Full Text]

Vido K, Spector D, Lagniel G, Lopez S, Toledano MB, Labarre J. A proteome analysis of the cadmium response in Saccharomyces cerevisiae. J. Biol. Chem. (2001) 276:8469–8474.[Abstract/Free Full Text]

Wallis JW, Chrebet G, Brodsky G, Rolfe M, Rothstein R. A hyper-recombination mutation in S. cerevisiae identifies a novel eukaryotic topoisomerase. Cell (1989) 58:409–419.[CrossRef][Web of Science][Medline]

Yu M, Martin RL, Jain S, Chen LJ, Segel IH. Rat liver ATP-sulfurylase: Purification, kinetic characterization, and interaction with arsenate, selenate, phosphate, and other inorganic oxyanions. Arch. Biochem. Biophys. (1989) 269:156–174.[CrossRef][Web of Science][Medline]

Zhitkovich A. Importance of chromium-DNA adducts in mutagenicity and toxicity of chromium(VI). Chem. Res. Toxicol. (2005) 18:3–11.[CrossRef][Web of Science][Medline]

Zhitkovich A, Song Y, Quievryn G, Voitkun V. Non-oxidative mechanisms are responsible for the induction of mutagenesis by reduction of Cr(VI) with cysteine: role of ternary DNA adducts in Cr(III)-dependent mutagenesis. Biochemistry (2001) 40:549–560.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Toxicol SciHome page
S. L. Holland and S. V. Avery
Actin-Mediated Endocytosis Limits Intracellular Cr Accumulation and Cr Toxicity during Chromate Stress
Toxicol. Sci., October 1, 2009; 111(2): 437 - 446.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
106/2/400    most recent
kfn193v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Pereira, Y.
Right arrow Articles by Labarre, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pereira, Y.
Right arrow Articles by Labarre, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?