Toxicological Sciences

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (13) Request Permissions Disclaimer Google Scholar Articles by Boulares, A. H. Articles by Cohen, S. D. Search for Related Content PubMed PubMed Citation Articles by Boulares, A. H. Articles by Cohen, S. D. Social Bookmarking          What's this?

Toxicological Sciences 55, 370-375 (2000)
Copyright © 2000 by the Society of Toxicology

Acetaminophen Inhibits NF-B Activation by Interfering with the Oxidant Signal in Murine Hepa 1-6 Cells

A. Hamid Boulares^*,1, Charles Giardina^*, Mehmet S. Inan^*, Edward A. Khairallah^*,2 and Steven D. Cohen^,3

^* Department of Molecular and Cell Biology, University of Connecticut, Storrs, Connecticut 06269; and Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269

Received July 21, 1999; accepted February 4, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A toxic dose of acetaminophen (APAP) reduces the activity of NF-B in mouse liver. NF-B inactivation may be important for APAP toxicity, as this transcription factor can play a central role in maintaining hepatic viability. We recently reported that APAP likewise inhibits serum growth factor activation of NF-B in a mouse hepatoma cell line (Hepa 1-6 cells). Here we present evidence that APAP's antioxidant activity may be involved in this NF-B inhibition in Hepa 1-6 cells. Like the antioxidants N-acetylcysteine (NAC) and pyrrolidinedithiocarbamate (PDTC), APAP was found to suppress the H₂O₂-induced oxidation of an intracellular reactive oxygen species probe (dihydrodichlorofluorescein) in Hepa 1-6 cells. Treatment of Hepa 1-6 cells with H₂O₂ was sufficient for NF-B activation and IB degradation, and APAP was able to block both of these events. The APAP inhibition of NF-B activation by serum growth factors may also be due to APAP's antioxidant activity, as the antioxidants NAC and PDTC likewise inhibit this activation. The potential role of NF-B and oxidant-based growth factor signal transduction in APAP toxicity is discussed.

Key Words: acetaminophen; NF-B; IB; Hepa 1-6; hepatotoxicity; reactive oxygen; antioxidants.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
APAP is an effective and safe antipyretic and analgesic at pharmacologic doses. Acute overdoses, however, can lead to liver and kidney failure, and in severe cases, death (Boyd and Bereczky, 1966; Boyer and Rouff, 1971; Thomas, 1993). Conversion of APAP to the highly reactive metabolite N-acetyl-p-benzoquinoneimine (NAPQI) by the cytochrome P450 system plays a central role in triggering cellular necrosis and organ failure (Dahlin et al., 1984). The liver can detoxify NAPQI by conjugation with glutathione. However, once glutathione reserves are depleted, multiple perturbations ensue that ultimately culminate in cell death. Although the relative importance of individual NAPQI-triggered events in toxicity is uncertain, it is likely that most play a contributory role (Cohen et al., 1998; Cohen and Khairallah, 1997). Prominent among these events are the covalent binding of NAPQI to target proteins and other macromolecules, the oxidation of protein sulfhydryls, the generation of reactive oxygen species, and the induction of lipid peroxidation (Adamson and Harman, 1989; Albano et al., 1983; Cohen et al., 1998; Jollow et al., 1973; Kyle et al., 1987; Mitchell et al., 1973; Wendel and Jaeschke, 1982). Evidence supporting a central role for NAPQI-mediated oxidative stress and covalent binding includes the finding that antioxidants/radical scavengers such a N-acetylcysteine and dithiothreitol suppress both of these events as well as subsequent organ damage (Corcoran et al., 1978; Corcoran and Wong, 1986; Piperno and Berssenbruegge, 1976).

In addition to cellular damage inflicted by NAPQI, APAP itself may directly contribute to toxicity. APAP has been found to interfere with growth factor signal transduction (Boulares et al., 1999), mitochondrial respiration (Meyers et al., 1988), and ribonucleotide reductase (required for deoxyribose nucleotide synthesis) (Holme et al., 1988; Hongslo et al., 1989; Hongslo et al., 1990; Richard et al., 1991), even in the absence of cytochrome P450 conversion to NAPQI. Although the contribution of these direct effects of APAP on toxicity are not yet known, it has been proposed that APAP may interfere with liver regeneration after injury sustained from NAPQI or other forms of chemical or physical damage (Boulares et al., 1999; Chanda et al., 1995).

It has recently been reported that APAP influences the transcription factor NF-B. Immediately following a toxic dose of APAP, the NF-B DNA binding activity isolated from the liver is dramatically reduced, with activity returning only after several hours (Blazka et al., 1996). This transient APAP inhibition of NF-B could potentially play an important role in APAP toxicity. Studies utilizing knockout mice deficient in the RelA subunit of NF-B reveal that NF-B is required for maintaining hepatic viability; embryonic livers in RelA knockout animals suffer extensive apoptosis (Beg et al., 1995). NF-B has also been found to protect numerous cell types from cytokine and drug-induced cell death (Baichwal and Baeuerle, 1997; Beg and Baltimore, 1996; Bellas et al., 1997; Iimuro et al., 1998; Van Antwerp et al., 1996; Wang et al., 1996; Wu et al., 1996). The influence of NF-B on cell death appears to be due to its ability to activate protective genes, such as that for the superoxide scavenging enzyme MnSOD (Li and Oberley, 1997; Wong et al., 1989). In addition, the APAP inhibition of NF-B may suppress hepatocyte proliferation and subsequent liver regeneration (Baldwin et al., 1991; Boulares et al., 1999).

We recently demonstrated that the APAP inhibition of NF-B can be reproduced in Hepa 1-6 cells (Boulares et al., 1999). Interestingly, NF-B inhibition is observed in Hepa 1-6 cells in the absence of cytochrome P450 activation, glutathione oxidation, cytosolic enzyme leakage, and cell death. However, even in the absence of overt cellular toxicity, APAP still inhibits proliferation of Hepa 1-6 cells. The APAP inhibition of cell proliferation appears to involve the inhibition of a number of G1 signaling events including Raf-1 kinase activation and NF-B activation (Boulares et al., 1999). Here we present evidence that APAP inhibits NF-B activation in part by interfering with the oxidant signal required for activation of this transcription factor.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cell culture and treatments.
Monolayers of Hepa 1-6 cells (CRL-1830, American Type Culture Collection) were grown and maintained in Dulbecco modified minimal medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 3.5 g/l glucose. Cells were grown to an approximate density of 80% prior to experimental manipulations. For serum stimulation of NF-B, cells were first incubated in serum-free medium for 24 to 36 h before treatment, after which they were stimulated with 20% FBS. H₂O₂ stimulation of NF-B was performed in serum-free media (without prolonged starvation) with 500 µM H₂O₂. In cases where APAP was added to the cultures, it was dissolved directly in medium immediately prior to use. The antioxidants N-acetylcysteine (NAC) and pyrrolidinedithiocarbamate (PDTC) were obtained from Sigma Chemical Company and dissolved in medium prior to use.

Cytoplasmic and nuclear extract preparations and electrophoretic mobility shift assay (EMSA).
Cytoplasmic and nuclear extracts were prepared, and EMSA analysis of DNA binding activity was performed as described previously (Boulares et al., 1999). The NF-B binding oligonucleotide used for these studies was a double-stranded DNA probe synthesized by the University of Connecticut Biotechnology Center with the sequence TCGACAGAGGGGACTTTCCGAGAGGCTCGA (Boulares et al., 1999). This oligonucleotide was end labeled with T4 polynucleotide kinase using [³²P]ATP (Boulares et al., 1999). In the DNA binding reaction, the radioactive DNA probe was in excess to ensure that it was not the limiting component of the binding reaction. Typically, only a few percent of the DNA in the reaction was bound by protein.

Western immunoblotting.
Cytoplasmic extracts (50 µg of protein per lane) were run on a 10% SDS-polyacrylamide gel, and transferred to Immobilon-P membranes (Millipore). Transfers were performed using a Trans-Blot Electrophoretic Transfer Cell (Bio-Rad), following the manufacturer instructions. IB protein was detected with an affinity purified polyclonal anti-IB/MAD3 antibody (Santa Cruz Biotechnology) and visualized by enhanced chemiluminescent staining using ECL reagents (Amersham). Antibody probings were performed in phosphate buffered saline plus 0.1% Tween-20, with antibody dilutions of 1:1000.

Dihydrodichlorofluorescein (H₂DCF) oxidation assay for peroxide.
The assay for reactive oxygen was performed as described (Giardina and Inan, 1998). In brief, cells were grown on 96-well tissue culture plates to near confluency, and loaded with H₂DCF by adding the diacetate form of this compound (Molecular Probes) to the medium at a final concentration of 50 µM. After 30 min, the medium was completely removed and replaced with 100 µl of fresh medium containing APAP or antioxidants as indicated. H₂O₂ was then added to a concentration of 500 µM. In the presence of reactive oxygen species such as H₂O₂, the nonfluorescent H₂DCF is oxidized to fluorescent DCF, which can then be quantified. DCF production was detected after a 30-min exposure with a Cytofluor microplate-reading fluorometer (PerSeptive), with excitation and emission wavelengths of 475 nm and 525 nm, respectively.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Effect of APAP Treatment on Intracellular Oxidative State
We have shown that the APAP inhibition of NF-B observed in vivo (Blazka et al., 1996) can be reproduced in a hepatocyte cell culture model, the Hepa 1-6 cell line (Boulares et al., 1999). NF-B activation often entails a reactive oxygen signal (or at least a pro-oxidant environment). Interestingly, APAP has been reported to possess antioxidant activity (DuBois et al., 1983; Garrido et al., 1991). This antioxidant activity appears to result from the ability of APAP to directly scavenge free radicals (Dinis et al., 1994), rather than an ability to suppress the generation of reactive oxygen species by inhibiting radical-generating enzymes (DuBois et al., 1983). One possibility, therefore, is that APAP's antioxidant activity is responsible for inhibiting NF-B activation in Hepa 1-6 cells. As a first test of this model, the intracellular reactive oxygen species probe H₂DCF was used to determine if APAP influenced the intracellular redox environment of Hepa 1-6 cells after 30-min exposure to H₂O₂. This measurement was made at 30 min so that the cellular redox environment during initial cellular signaling events could be assessed (IB degradation occurs at approximately 45 min). As shown in Figure 1, treatment of Hepa 1-6 cells with 500 µM H₂O₂ triggers oxidation of H₂DCF to the fluorescent DCF. Figure 1 also shows the results of an experiment in which cells were loaded with H₂DCF, then treated with H₂O₂ in the presence of APAP, NAC, or PDTC. All three treatments suppressed H₂O₂-induced H₂DCF oxidation in Hepa 1-6 cells, with NAC providing the most complete protection. NAC at 10 mM almost completely suppressed H₂DCF oxidation, with APAP (10 mM) and PDTC (100 µM) inhibiting oxidation by approximately 80% and 90%, respectively. The effect of APAP on NF-B binding may therefore be related to its ability to function as an antioxidant in this hepatocyte model.

View larger version (17K): [in this window] [in a new window]   FIG. 1. APAP suppresses H2O2-induced H2DCF oxidation in Hepa 1-6 cells. Hepa 1-6 cells were loaded with H2DCF (50 µM), then treated with 500 µM H2O2 in the presence of the indicated concentrations of APAP, NAC, or PDTC. Results from cells loaded with H2DCF and left untreated (no H2O2 or antioxidant) are also shown. The fluorescent measurements shown were obtained after a 30-min incubation. Each bar is the mean of three independent replicates, and similar results were obtained in a second independent experiment. Statistical comparison of the data using Dunnett's test indicates that all APAP concentrations, NAC, and PDTC significantly suppress H2O2-induced H2DCF oxidation (p < 0.05).

 
Effect of APAP Treatment on H₂O₂-Activation of NF-B and IB Degradation
The role of oxidant signaling in NF-B activation is supported by the finding that direct treatment of many cell types with H₂O₂ is sufficient for NF-B activation (Meyer et al., 1993; Schmidt et al., 1995). As shown in Figure 2A, treatment of Hepa 1-6 cells with 500 µM H₂O₂ for 1.5 h resulted in NF-B activation (in the form of the p65-p50 complex; data not shown). This result indicates that oxidative stress can play a central role in NF-B activation in these cells. If APAP was interfering with oxidant signaling, it would be predicted to inhibit NF-B activation by H₂O₂. To test this possibility, cells were treated with 500 µM H₂O₂ in the absence or presence of 0.5, 3, or 10 mM APAP, after which nuclear extracts were prepared and tested for NF-B DNA binding activity. Figure 2A shows that the ability of H₂O₂ to activate NF-B was reduced by APAP in a concentration-dependent manner, and was completely blocked at 10 mM APAP. As shown in Figure 2B, APAP treatment also blocks the H₂O₂-induced degradation of IB in these cells in a concentration-dependent manner, with the highest level of IB detected in cells treated with 10 mM APAP (IB levels were determined at 45 min). This result demonstrates that APAP inhibition of H₂O₂-induced NF-B activation occurs at or prior to IB degradation.

View larger version (37K): [in this window] [in a new window]   FIG. 2. APAP inhibits NF-B activation and IB degradation in response to H2O2 stimulation. Cells were stimulated with 500 µM H2O2 in the absence or the presence of 0.5, 3, or 10 mM APAP. (A) Effect of APAP treatment on NF-B activation. Nuclear extracts were prepared after 1.5-h exposure to H2O2, and their NF-B DNA binding activity was determined by EMSA. (B) Effect of APAP treatment on IB degradation. Cytoplasmic extracts were prepared after a 45-min exposure to H2O2 and analyzed by Western blot using an IB/MAD-3 antibody. The position of IB is indicated by an arrow on the right. Measurements of IB degradation and NF-B activation were performed in concurrently treated cultures. Similar results were obtained in a second independent trial.

 
Effect of APAP and Other Antioxidants on the Serum Activation of NF-B
We previously reported that APAP inhibits the serum growth factor activation of NF-B in Hepa 1-6 cells (Boulares et al., 1999). In the results presented above, we show that APAP also blocks the H₂O₂ activation of NF-B. Because many stimuli that activate NF-B either increase cellular reactive oxygen production, or at least require a pro-oxidant environment, we wished to determine if APAP's antioxidant activity is responsible for inhibiting the growth factor activation of NF-B. Experiments to detect growth factor-induced reactive oxygen generation in Hepa 1-6 cells were not successful. However, using the antioxidants NAC and PDTC, we were able to show that a pro-oxidant environment is important for growth factor stimulation of NF-B in these cells. As shown in Figure 3A, 10 mM APAP suppresses serum activation of NF-B DNA binding by about 80%. The antioxidants NAC and PDTC likewise inhibit serum activation of NF-B (Figs. 3B and 3C). From these observations, it seems plausible that APAP's inhibitory effect on the serum activation of NF-B may result from its antioxidant activity.

View larger version (36K): [in this window] [in a new window]   FIG. 3. Serum growth factor activation of NF-B in Hepa 1-6 cells is sensitive to antioxidants. Serum-starved Hepa 1-6 cells were left untreated or stimulated with 20% serum in the absence or the presence of: 10 mM APAP (A), 3 mM NAC (B), or 100 µM PDTC (C) for 90 min. Nuclear extracts were then prepared and tested for NF-B DNA binding activity by EMSA. Similar results were obtained in an independent trial.

 

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Toxic doses of APAP have been found to inhibit NF-B in mouse liver (Blazka et al., 1996). We previously reported that APAP can also inhibit NF-B activation in Hepa 1-6 cells (Boulares et al., 1999). Because NF-B activation often requires the generation of reactive oxygen species and is inhibited by antioxidants (Meyer et al., 1993; Schmidt et al., 1995), we tested the hypothesis that APAP's previously reported antioxidant activity (DuBois et al., 1983; Garrido et al., 1991) might be responsible for NF-B inhibition. In support of this hypothesis we have found that: a) APAP inhibits the H₂O₂-induced oxidation of an intracellular reactive oxygen probe in Hepa 1-6 cells; b) H₂O₂ treatment is sufficient for NF-B activation in Hepa 1-6 cells, and that this activation can be blocked by APAP; and c) H₂O₂ and serum growth factor activation of NF-B in Hepa 1-6 cells can be blocked both by APAP and the antioxidants NAC and PDTC. It is therefore possible that the transient inactivation of NF-B in liver after a toxic dose of APAP in vivo results from APAP's antioxidant properties. However, because Hepa 1-6 cells do not metabolize APAP to NAPQI (Navarro et al., 1994), it is difficult to determine how NAPQI, which can generate an oxidative stress, affects NF-B activity.

The role of NF-B inhibition in APAP toxicity is not clear. A wealth of evidence has implicated this transcription factor in regulating cell death in a number of situations. For example, knockout mice lacking the RelA subunit of NF-B suffer extensive hepatocyte apoptosis during embryogenesis (Beg et al., 1995). A direct role for NF-B in maintaining hepatocyte viability has also been demonstrated in cell culture models (Bellas et al., 1997; Xu et al., 1998). Whether the transient inhibition of NF-B observed after APAP administration sensitizes cells to a NAPQI-induced cell death is not yet known. NF-B activation has, however, been shown to protect cells from toxicity induced by a number of chemotherapeutic agents (Wang et al., 1996), suggesting that it can modulate cellular sensitivity to toxins.

Since the initial discovery that APAP has antioxidant properties (DuBois et al., 1983; Garrido et al., 1991), evidence has been obtained that reactive oxygen species can play a role in cell signaling. For example, growth factor signal transduction appears to require a reactive oxygen signal (Sundaresan et al., 1995). An emerging paradigm envisions a modest level of reactive oxygen generation as being essential for cell viability and proliferation (Khan and Wilson, 1995). Here we show that APAP's interference with growth factor signal transduction to NF-B can be accounted for (at least in part) by its antioxidant properties. NF-B can influence cell cycle progression through its ability to modulate c-myc expression (Baldwin et al., 1991; La Rosa et al., 1994), and we have previously shown that APAP also blocks c-myc expression in Hepa 1-6 cells (Boulares et al., 1999). However, other cellular processes required for maintaining cell viability and proliferative capacity may also be suppressed by APAP's antioxidant properties. Although evidence has been obtained indicating that the stimulation of hepatocyte proliferation may enhance recovery from APAP poisoning (Chanda et al., 1995), we have proposed that APAP's inhibition of hepatocyte proliferation may interfere with liver regeneration following injury (Boulares et al., 1999). The present findings suggest that APAP's interference with cell proliferation is mediated through its antioxidant action. Additional studies will be required to determine if APAP's antioxidant action can block cell proliferation in vivo and whether this activity contributes to hepatic injury.

	ACKNOWLEDGMENTS

 
This study was supported by NIH grant GM31460. The authors are grateful to Dr. Mary Bruno for her thoughtful comments and Teresa Sharillo for her assistance in preparing the manuscript.

	NOTES

 
¹ Present address: Department of Biochemistry and Molecular Biology, Georgetown University, Washington, DC 20007.

² Deceased, September 1996.

³ To whom correspondence should be addressed at University of Connecticut, Department of Pharmaceutical Sciences, 372 Fairfield Rd., Storrs, CT 06269. Fax: (860) 486-4998. E-mail: cohens{at}uconnvm.uconn.edu.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Adamson, G. M., and Harman, A. W. (1989). A role for glutathione peroxidase/reductase enzyme system in the protection from paracetamol toxicity in isolated mouse hepatocytes. Biochem. Pharmacol. 38, 3323–3330.[Web of Science][Medline]

Albano, E., Poli, G., Chiarpotto, E., Biasi, F., and Dianzani, M. U. (1983). Paracetamol-stimulated lipid peroxidation in isolated rat and mouse hepatocytes. Chem. Biol. Interact. 47, 249–263.[Web of Science][Medline]

Baichwal, V. R., and Baeuerle, P. A. (1997). Activate NF-B or die? Curr. Biol. 7, R94–R96.[Web of Science][Medline]

Baldwin, A. S., Jr., Azizkhan, J. C., Jensen, D. E., Beg, A. A., and Coodly, L. R. (1991). Induction of NF-B DNA-binding activity during the G0-to-G1 transition in mouse fibroblasts. Mol. Cell. Biol. 11, 4943–4951.[Abstract/Free Full Text]

Beg, A. A., and Baltimore, D. (1996). An essential role for NF-B in preventing TNF--induced cell death. Science 274, 782–784.[Abstract/Free Full Text]

Beg, A. A., Sha, W. C., Bronson, R. T., Ghosh, S., and Baltimore, D. (1995). Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-B. Nature 376, 167–170.[Medline]

Bellas, R. E., FitzGerald, M. J., Fausto, N., and Sonenshein, G. E. (1997). Inhibition of NF-B activity induces apoptosis in murine hepatocytes. Am. J. Pathol. 151, 891–896.[Abstract]

Blazka, M. E., Germolec, D. R., Simeonova, P., Bruccoleri, A., Pennypacker, K. R., and Luster, M. I. (1996). Acetaminophen-induced hepatotoxicity is associated with early changes in NF-B and NF-IL6 DNA binding activity. J. Inflamm. 47, 138–150.

Boulares, H. A., Giardina, C., Navarro, C. L., Khairallah, E. A., and Cohen, S. D. (1999). Modulation of serum growth factor signal transduction in Hepa 1-6 cells by acetaminophen: an inhibition of c-myc expression, NF-B activation, and RAF-1 kinase activity. Toxicol. Sci. 48, 264–274.[Abstract/Free Full Text]

Boyd, E. M., and Bereczky, G. M. (1966). Liver necrosis from paracetamol. Br. J. Pharmacol. 26, 606–614.[Medline]

Boyer, T. D., and Rouff, S. L. (1971). Acetaminophen-induced hepatic necrosis and renal failure. JAMA 218, 440–441.[Abstract/Free Full Text]

Chanda, S., Mangipudy, R. S., Warbritton, A., Bucci, T. J., and Mehendale, H. M. (1995). Stimulated hepatic tissue repair underlies heteroprotection by thioacetamide against acetaminophen-induced lethality. Hepatology 21, 477–486.[Web of Science][Medline]

Cohen, S. D., Hoivik, D. J., and Khairallah, E. A. (1998). Acetaminophen-induced hepatotoxicity. In Toxicology of the Liver, 2nd ed., pp. 159–186. Raven Press, New York.

Cohen, S. D., and Khairallah, E. A. (1997). Selective protein arylation and acetaminophen-induced hepatotoxicity. Drug Metab. Rev. 29, 59–77.[Web of Science][Medline]

Corcoran, G. B., Racz, W. J., and Mitchell, J. R. (1978). Inhibition by N-acetylcysteine of acetaminophen covalent binding and liver injury. Pharmacologist 20, 259.

Corcoran, G. B., and Wong, B. K. (1986). Role of glutathione in prevention of acetaminophen-induced hepatotoxicity by N-acetyl-L-cysteine in vivo: studies with N-acetyl-D-cysteine in mice. J. Pharmacol. Exp. Ther. 238, 54–61.[Abstract/Free Full Text]

Dahlin, D. C., Miwa, G. T., Lu, A., and Nelson, S. D. (1984). N-acetyl-p-benzoquinone imine: a cytochrome P-450-mediated oxidation product of acetaminophen. Proc. Natl. Acad. Sci. U S A 81, 1327–1331.[Abstract/Free Full Text]

Dinis, T. C., Maderia, V. M., and Almeida, L. M. (1994). Action of phenolic derivatives (acetaminophen, salicylate, and 5-aminosalicylate) as inhibitors of membrane lipid peroxidation and as peroxyl radical scavengers. Arch. Biochem. Biophys. 315, 161–169.[Web of Science][Medline]

DuBois, R. N., Hill, K. E., and Burk, R. F. (1983). Antioxidant effect of acetaminophen in rat liver. Biochem. Pharmacol. 32, 2621–2622.[Web of Science][Medline]

Garrido, A., Arancibia, C., Campos, R., and Valenzuela, A. (1991). Acetaminophen does not induce oxidative stress in isolated rat hepatocytes: its probable antioxidant effect is potentiated by the flavonoid silybin. Pharmacol. Toxicol. 69, 9–12.[Web of Science][Medline]

Giardina, C., and Inan, M. S. (1998). Nonsteroidal antiinflammatory drugs, short-chain fatty acids, and reactive oxygen metabolism in human colorectal cancer cells. Biochim. Biophys. Acta 1401, 277–288.[Medline]

Holme, J. A., Hongslo, J. K., Bjornstad, C., Harvison, P. J., and Nelson, S. D. (1988). Toxic effects of paracetamol and related structures in V79 chinese hamster cells. Mutagenesis 3, 51–56.[Abstract/Free Full Text]

Hongslo, J. K., Bjorge, C., Schwarze, P. E., Brogger, A., Mann, G., Thelander, L., and Holme, J. A. (1990). Paracetamol inhibits replicative DNA synthesis and induces sister chromatid exchange and chromosomal aberrations by inhibition of ribonucleotide reductase. Mutagenesis 5, 475–480.[Abstract/Free Full Text]

Hongslo, J. K., Bjornstad, C., Schwarze, P. E., and Holme, J. A. (1989). Inhibition of replicative DNA synthesis by paracetamol in V79 chinese hamster cells. Toxicol. in Vitro 3, 13–20.

Iimuro, Y., Nishiura, T., Hellerbrand, C., Behrns, K. E., Schoonhoven, R., Grisham, J. W., and Brenner, D. A. (1998). NF-B prevents apoptosis and liver dysfunction during liver regeneration. J. Clin. Invest. 101, 802–811.[Web of Science][Medline]

Jollow, D. J., Mitchell, J. R., Potter, W. Z., Davis, D. C., Gillette, J. R., and Brodie, B. B. (1973). Acetaminophen-induced hepatic necrosis. II. Role of covalent binding in vivo. J. Pharmacol. Exp. Ther. 187, 195–202.[Abstract/Free Full Text]

Khan, A. U., and Wilson, T. (1995). Reactive oxygen species as cellular messengers. Chem. Biol. 2, 437–445.[Web of Science][Medline]

Kyle, M. E., Miccadei, S., Nakae, D., and Farber, J. L. (1987). Superoxide dismutase and catalase protect cultured hepatocytes from the cytotoxicity of acetaminophen. Biochem. Biophys. Res. Commun. 31, 889–896.

La Rosa, F., Pierce, J., and Sonenshein, G. (1994). Differential regulation of the c-myc oncogene promoter by the NF-B rel family of transcription factors. Mol. Cell. Biol. 14, 1039–1044.[Abstract/Free Full Text]

Li, J. J., and Oberley, L. W. (1997). Overexpression of manganese-containing superoxide dismutase confers resistance to the cytotoxicity of tumor necrosis factor alpha and/or hyperthermia. Cancer Res. 57, 1991–1998.[Abstract/Free Full Text]

Meyer, M., Schreck, R., and Baeuerle, P. A. (1993). H₂O₂ and antioxidants have opposite effects on activation of NF-B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 12, 2005–2015.[Web of Science][Medline]

Meyers, L. L., Beierschmitt, W. P., Khairallah, E. A., and Cohen, S. D. (1988). Acetaminophen-induced inhibition of hepatic mitochondrial respiration in mice. Toxicol. Appl. Pharmacol. 93, 378–387.[Web of Science][Medline]

Mitchell, J. R., Jollow, D. J., Potter, W. Z., Davis, D. C., Gillette, J. R., and Brodie, B. B. (1973). Acetaminophen-induced hepatic necrosis. I. Role of drug metabolism. J. Pharmacol. Exp. Ther. 187, 181–194.

Navarro, C., Cohen, S. D., and Khairallah, E. A. (1994). Acetaminophen administration alters the rate of cell replication in hepatoma cells without activation of drugs by cytochrome P-450. Fed. Am. Soc. Exp. Biol. J. 9, 1216 (abstract).

Piperno, E., and Berssenbruegge, D. A. (1976). Reversal of experimental paracetamol toxicosis with N-acetylcysteine. Lancet 2, 738–739.

Richard, A. M., Hongslo, J. K., Boone, P. F., and Holme, J. A. (1991). Structure-activity study of paracetamol analogues: inhibition of replicative DNA synthesis in V79 chinese hamster cells. Chem. Res. Toxicol. 4, 151–156.[Web of Science][Medline]

Schmidt, K. N., Amstad, P., Cerutti, P., and Baeuerle, P. A. (1995). The roles of hydrogen peroxide and superoxide as messengers in the activation of transcription factor NF-B. Chem. Biol. 2, 13–22.[Web of Science][Medline]

Sundaresan, M., Yu, Z.-X., Ferrans, V. J., Irani, K., and Finkel, T. (1995). Requirement for generation of H₂O₂ for platelet-derived growth factor signal transduction. Science 270, 296–299.[Abstract/Free Full Text]

Thomas, S. H. (1993). Paracetamol (acetaminophen) poisoning. Pharmacol. Ther. 60, 91–120.[Web of Science][Medline]

Van Antwerp, D. J., Martin, S. J., Kafri, T., Green, D. R., and Verma, I. M. (1996). Suppression of TNF--induced apoptosis by NF-B. Science 274, 787–789.[Abstract/Free Full Text]

Wang, C.-Y., Mayo, M. W., and Baldwin, A. S., Jr. (1996). TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-B. Science 274, 784–787.[Abstract/Free Full Text]

Wendel, A., Jaeschke, H., and Gloger, M. (1982). Drug-induced lipid peroxidation in mice. II. Protection against paracetamol-induced liver necrosis by intravenous liposomally entrapped glutathione. Biochem. Pharmacol. 31, 3601–3605.[Web of Science][Medline]

Wong, G. H., Elwell, J. H., Oberley, L. W., and Goeddel, D. V. (1989). Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor. Cell 58, 923–931.[Web of Science][Medline]

Wu, M., Lee, H., Bellas, R. E., Schauer, S. L., Arsura, M., Katz, D., FitzGerald, M. J., Rothstein, T. L., Sherr, D. H., and Sonenshein, G. E. (1996). Inhibition of NF-B /Rel induces apoptosis of murine B cells. EMBO J. 15, 4682–4690.[Web of Science][Medline]

Xu, Y., Bialik, S., Jones, B. E., Iimuro, Y., Kitsis, R. N., Srinivasan, A., Brenner, D. A., and Czaja, M. J. (1998). NF-B inactivation converts a hepatocyte cell line TNF- response from proliferation to apoptosis. Am. J. Physiol. 275, C1058–C1066.[Abstract/Free Full Text]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				T. Liu, C. P. Masamha, S. Chengedza, K. D. Berlin, S. Lightfoot, F. He, and D. M. Benbrook Development of flexible-heteroarotinoids for kidney cancer Mol. Cancer Ther., May 1, 2009; 8(5): 1227 - 1238. [Abstract] [Full Text] [PDF]

				D. Z. Ye, M.-H. Tai, K. D. Linning, C. Szabo, and L. K. Olson MafA Expression and Insulin Promoter Activity Are Induced by Nicotinamide and Related Compounds in INS-1 Pancreatic {beta}-Cells Diabetes, March 1, 2006; 55(3): 742 - 750. [Abstract] [Full Text] [PDF]

				D. Sanocka, P. Jedrzejczak, A. Szumala-Kaekol, M. Fraczek, and M. Kurpisz Male Genital Tract Inflammation: The Role of Selected Interleukins in Regulation of Pro-Oxidant and Antioxidant Enzymatic Substances in Seminal Plasma J Androl, May 1, 2003; 24(3): 448 - 455. [Abstract] [Full Text] [PDF]

				A. H. Boulares, A. J. Zoltoski, Z. A. Sherif, P. Jolly, D. Massaro, and M. E. Smulson Gene Knockout or Pharmacological Inhibition of Poly(ADP-Ribose) Polymerase-1 Prevents Lung Inflammation in a Murine Model of Asthma Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 322 - 329. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (13) Request Permissions Disclaimer Google Scholar Articles by Boulares, A. H. Articles by Cohen, S. D. Search for Related Content PubMed PubMed Citation Articles by Boulares, A. H. Articles by Cohen, S. D. Social Bookmarking          What's this?

Online ISSN 1096-0929 - Print ISSN 1096-6080

Copyright © 2009 Society of Toxicology

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics