Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (52)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ohsako, S.
Right arrow Articles by Yonemoto, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohsako, S.
Right arrow Articles by Yonemoto, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Toxicological Sciences 60, 132-143 (2001)
Copyright © 2001 by the Society of Toxicology


REPRODUCTIVE AND DEVELOPMENTAL TOXICOLOGY

Maternal Exposure to a Low Dose of 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Suppressed the Development of Reproductive Organs of Male Rats: Dose-Dependent Increase of mRNA Levels of 5{alpha}-Reductase Type 2 in Contrast to Decrease of Androgen Receptor in the Pubertal Ventral Prostate

Seiichiroh Ohsako*,{dagger},1, Yuichi Miyabara*,{dagger}, Noriko Nishimura*,{dagger}, Shuichi Kurosawa{ddagger}, Motoharu Sakaue*, Ryuta Ishimura*,{dagger}, Mikio Sato*, Ken Takeda{ddagger}, Yasunobu Aoki*,{dagger}, Hideko Sone{dagger}, Chiharu Tohyama*,{dagger} and Junzo Yonemoto{dagger}

* Environmental Health Sciences Division, National Institute for Environmental Studies, 16–2 Onogawa, Tsukuba, Ibaraki 305-0053, Japan; {dagger} CREST-JST, Kawaguchi, Saitama 332-0012, Japan; {ddagger} Department of Hygienic Chemistry, Science University of Tokyo, 12 Ichigaya-Funagawara-machi, Shinjuku-ku, Tokyo 162-0826, Japan; and § Regional Environment Division, National Institute for Environmental Studies, 16–2 Onogawa, Tsukuba, Ibaraki 305-0053, Japan

Received September 7, 2000; accepted December 6, 2000


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To assess the health risks associated with exposure to 2,3,7,8-tetrachlorodebenzo-p-dioxin (TCDD), we studied the effects of a relatively low dose of TCDD on the male reproductive system of rats, using the experimental protocol of T. A. Mably et al. (1992, Toxicol. Appl. Pharmacol. 114, 97–107, 108–117, 118–126), and searched for the most sensitive and reliable among several indices of TCDD toxicity. Pregnant Holtzman rats were given a single oral dose of 0, 12.5, 50, 200, or 800 ng TCDD/kg body weight on gestational day (GD) 15, and male offspring were sacrificed on postnatal day (PND) 49 or 120. GC-MS analysis of the abdominal fat tissue and testis clearly showed increased amounts of TCDD in these offspring. However, there was no TCDD effect on body weight of offspring. There were no changes on testicular or epididymal weights by TCDD administration, even at the 800-ng/kg dose in rats sacrificed on either PND 49 or 120. In addition, TCDD administration resulted in no changes in daily sperm production or sperm reserve at any of the doses used. However, the weight of the urogenital complex, including the ventral prostate, was significantly reduced at doses of 200 and 800 ng TCDD/kg in rats sacrificed on PND 120. Moreover, the anogenital distance (AGD) of male rats sacrificed on PND 120 showed a significant decrease in the groups receiving doses greater than 50 ng TCDD/kg. TCDD administration resulted in no apparent dose-dependent changes in levels of either serum testosterone or luteinizing hormone. Interestingly, reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed that, in the ventral prostates of the PND 49 group, TCDD administration resulted in both a dose-dependent increase in 5{alpha}-reductase type 2 (5{alpha}R-II) mRNA level and a dose-dependent decrease in androgen receptor (AR) mRNA level. These results suggest that low-dose TCDD administration had a greater effect on the development of the external genital organs and ventral prostate than on development of the testis and other internal genital organs. Moreover, it is highly suggested that the decrease in the size of the ventral prostate by maternal TCDD exposure might be due to decreased responsiveness of the prostate to androgen due to an insufficient expression level of androgen receptor during puberty.

Key Words: TCDD; male reproduction; ventral prostate; androgen receptor; 5-alpha-reductase.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The effects of environmental endocrine disrupters (EDs) on the male reproductive system have been receiving much attention, since this is thought to be the system most profoundly affected by EDs (Colborn et al., 1993Go). Some researchers have hypothesized that environmental EDs may be responsible for decreased human sperm counts and other male reproductive tract disorders (Carlsen et al., 1992Go; Sharpe and Skakkebaek, 1993Go).

Maternal exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) causes irreversible changes in the reproductive systems of offspring. The lowest-observed-effect level (LOEL) of maternal TCDD exposure is much lower than those estimated in the experiments using adult animals (Chahoud et al., 1989Go; McConnell et al., 1978Go; Tofilon and Piper, 1982Go). Therefore, the effects of TCDD on human endocrine functions during the developmental stage are a highly important issue in terms of human health risk assessment (Birnbaum, 1994Go; Peterson et al., 1993Go). Many researchers have reported that in utero and lactational exposure to TCDD results in adverse effects on the male reproductive system, i.e., reduced sperm count (Faqi et al., 1998Go; Gray et al., 1995Go, 1997Go; Mably et al., 1992cGo; Sommer et al., 1996Go; Wilker et al., 1996Go); reduced size of reproductive organs (Bjerke and Peterson, 1994Go; Gray et al., 1997Go; Mably et al., 1992aGo; Roman et al., 1995Go, 1998a, Roman et al., bGo), and feminized behavior or brain (Bjerke et al., 1994aGo; Faqi et al., 1998Go; Mably et al., 1992bGo).

Peterson and coworkers reported a series of extensive, carefully designed studies with male Holtzman rat offspring born from mothers that were administered a single oral dose of TCDD (0, 64, 160, 400, or 1000 ng/kg bw) on gestational day (GD) 15 (Mably et al., 1992aGo, bGo, cGo). Statistically significant reductions in the weight of the testes and epididymis, and in daily sperm production (DSP) and epididymal sperm number were detected by administration of as low a dose as 64 ng TCDD/kg bw. Some of the animals showed reduced fertility at higher doses (400 and 1000 ng TCDD/kg bw), suggesting that maternal TCDD exposure induces defects in sperm production and causes male infertility. Gray and colleagues (Gray et al., 1997Go) also reported that maternal TCDD exposure (50, 200, or 800 ng TCDD/kg bw) on GD 15 induced changes in the reproductive system of male Long Evans (LE) rats. Reductions in the epididymal and ejaculated sperm number occurred in the same manner as in Peterson's study. In the study by Gray et al.(1997), however, neither testicular weight nor DSP was affected at any of the doses used, and fertility was found to be normal. In a study using Sprague-Dawley rats, another research group reported that there was no significant change in DSP by a single injection of TCDD on GD 15, even at the highest dose (2 µg/kg bw) (Wilker et al., 1996Go). In addition, Chahoud and coworkers used a different protocol in which mothers were given an initial loading dose at 2 weeks prior to mating (25, 60, or 300 ng TCDD/kg bw) followed by a weekly maintenance dose (5, 12, or 60 ng TCDD/kg bw). No effects were observed on testicular weights of male offspring; however, DSP was significantly reduced at all doses tested (Faqi et al., 1998Go). Taking these results together, it is difficult to draw a conclusion concerning the consistent effects of TCDD on testes and sperm production.

Another potentially sensitive index of TCDD exposure is the ejaculated sperm count (Gray et al., 1995Go, 1997Go), in conjunction with the reduction in size of sex-accessory glands and reduction in anogenital distance (Gray et al., 1997Go; Mably et al., 1992aGo; Roman et al., 1995Go, 1998a, Roman et al., bGo). However, the ejaculated sperm number is a less reliable index than testicular weight, DSP, or the weight of other reproductive organs, because the protocol for determining the ejaculated sperm count is highly complex and difficult to carry out.

In the present paper, we used Holtzman rats, which can be classified as highly responsive to TCDD in terms of CYP1A1 induction (Jana et al., 1998Go). The aims of our experiment were to investigate the effects of a low dose of TCDD on the male reproductive system, particularly with respect to decreases in testicular weight or DSP, and to determine the most sensitive and reliable indexes for risk assessment. Anogenital distance and ventral prostate weight were revealed to be the most sensitive indexes in our experiment. Moreover it was demonstrated by semiquantitative RT-PCR with total RNA in the ventral prostate from pubertal rats, that content of androgen receptor (AR) transcript was highly down-regulated and 5{alpha}-reductase type 2 (5{alpha}R-II) was upregulated by maternal TCDD administration in a dose-dependent manner.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials.
2,3,7,8-TCDD was purchased from Cambridge Isotope Laboratory (Andover, MA). The purity was higher than 99.5%. Nonane and corn oil used for dissolving TCDD or vehicle control were from Sigma (St. Louis, MO). The silica gel column and activated carbon-silica gel column were purchased from Wako Pure Chemical (Osaka, Japan). SuperScriptTM II RNAse H-Reverse Transcriptase and oligo(dT)12–18 primer were from Life Technologies (Rockville, MD). LA TaqTM with 2x GC Buffer I and Ex TaqTM with 10x Ex TaqTM Buffer were from TaKaRa Biomedicals (Otsu, Japan). The plasmids pGEM-T Easy vector was obtained from Promega Corp. (Madison, WI).

Animals.
Male and female Holtzman rats were purchased from Harlan Sprague-Dawley, Inc. (Indianapolis, IN) and bred in our own facility. They were maintained in a controlled environment with temperature at 24 ± 1°C, humidity at 45 ± 5%, and a 12/12-h light/dark cycle. They were given food and distilled water ad libitum. Ten-week-old female rats in proestrus were mated 1:1 with males overnight, and females that had a vaginal plug the following morning were designated as being at Day 0 of gestation. Dams were housed individually in clear plastic cages with heat-treated wood chips as bedding.

TCDD administration.
The treatment and necropsies described below were all performed in the hazardous chemical regulation area at our institute. TCDD was dissolved first in nonane, followed by further dilution in corn oil to make a TCDD concentration of 20 µg/ml. On GD 15, pregnant rats were given a single dose (po) of TCDD (12.5, 50, 200 or 800 ng/kg; 2.5 ml/kg) or an equivalent volume of vehicle (6 pregnant rats per each dose). On PND 2, litters were randomly culled to 8 pups, with 5 males and 3 females, when possible. After weaning, the 5 males of each litter were housed in a separate stainless steel cage. Two male offspring per litter were sacrificed under diethylether anesthesia on PNDs 49 and 120.

Sample collection and processing.
The length between the base of the genital tubercle and the anterior edge of the anus was measured with a caliper as the anogenital distance (AGD). The testis and epididymis of both sides were excised from the abdomen and the surrounding adipose tissue was carefully removed. After removing the urine from the bladder, the deferent ducts were cut at the base of the bladder and the anterior end of the urethra was cut to excise the urogenital complex, which was then measured, followed by dissection and re-weighing of the seminal vesicle and ventral prostate. The tissue-weight data were expressed as a percentage of the body weight of each animal. All tissue samples were frozen by liquid nitrogen immediately after dissection and kept at –80°C until measurement of daily sperm production and sperm reserve, or RNA extraction.

Daily sperm production and epididymal sperm reserve.
The testes and cauda epididymis were homogenized in phosphate-buffered saline by a polytoron homogenizer. Homogenization-resistant spermatid nuclei were counted by a hemocytometer. The numbers of homogenization-resistant spermatid nuclei per testis were calculated and then divided by 6.1 days to convert them to testicular daily sperm production (DSP) (Robb et al., 1978Go). The numbers of homogenization-resistant sperm head per cauda epididymis were defined as the cauda epididymal sperm reserve (SR).

Histopathology.
Testes were fixed with Bouin's fixative and embedded in paraffin. Sections (5-µm thickness) were deparaffinized and stained with hematoxylin and eosin. The stage of the rat seminiferous epithelium was evaluated by using the STAGES 2.2 software developed by Dr Rex A. Hess of the University of Illinois (Urbana, IL).

Gas chromatogragh-mass spectrometry.
The tissue content of TCDD was determined according to the methods described previously (Miyabara et al., 1999Go). Briefly, a tissue sample (0.1–1.0 g) was spiked with 20 pg of (13C) 2,3,7,8-TCDD as an internal standard and then digested in 2 mol/l potassium hydroxide solution for 12 h. The TCDD in the digested material was extracted with n-hexane. The solution was applied to a silica gel column that was connected to an activated carbon-silica gel column, and then eluted with toluene. The final eluate was concentrated and the residue was dissolved in n-hexane. The GC-MS analysis was performed in the selected ion mode on a JMS700 high performance double focusing mass spectrometer (JEOL, Japan). The area of mass profile peaks of the quantification ions was used for the quantitative analysis of TCDD.

Hormone assay.
Serum luteinizing hormone (LH) and follicle stimulating hormone (FSH) levels were determined using an enzyme immunoassay (EIA) system (Amersham Life Sciences, Buckinghamshire, UK). Testosterone levels were determined using a radioimmunoassay (RIA) kit (Diagnostic Products Corporation, Los Angeles, CA) according to the manufacturer's instructions.

Semiquantitative RT-PCR.
Total RNA was extracted from ventral prostates and caput epididymes (n = 3) by the protocol of Chomczynski and Sacchi (1987). The RNA samples (4 µg) were reverse-transcribed for 50 min at 42°C in a 20-µl reaction with 200 units of SuperScriptTM II reverse transcriptase and 0.5 µg of oligo(dT)12–18 primer by the standard protocol of the supplier. For AR mRNA amplification, 200-µl of a PCR mixture containing 4 µl of the reverse transcriptase reaction, 10 units of TaKaRa LA TaqTM polymerase, 1x GC Buffer I, 0.4 mM of each dNTP mixture, and 0.4 µM of each primer, was equally divided into 4 tubes. The primers were designed to amplify a 630-base pair (bp) fragment for rat androgen receptor (AR) (forward, ATCGAGGAGCGTTCCAGAATCTG; reverse, ATATGGTCGAATTGCCCCCTAGG). PCR was subsequently performed using an optimized protocol consisting of between 16 and 50 cycles. Each cycle consisted of the following: 94°C, 30 s; 63°C, 30 s; 72°C, 1.5 min. For 5{alpha}R-II and cyclophilin mRNA amplification, 200 µl of PCR mixture containing 4 µl of the reverse transcriptase reaction, 5 units of TaKaRa Ex TaqTM polymerase, 1x Ex TaqTM Buffer, 0.2 mM of each dNTP mixture, and 0.4 µM of each primer, was equally divided into 4 tubes. The primers were designed to amplify a 496-bp cDNA fragment for rat 5{alpha}R-II (forward, ATCCTGTGCTTAGGGAAAC; reverse, CATACGTAAACAAGCCACC) and a 524-bp fragment for cyclophilin (forward, TCTGAGCACTGGGGAGAAAG; reverse, AGGGGAATGAGGAAAATATGG). PCR was subsequently performed by several cycles. Cycling parameters were as follows: 94°C, 30 s; 63°C, 30 s; 72°C and 1 min for 5{alpha}R-II; and 94°C, 30 s; 55°C, 30 s; and 72°C, 45 s for cyclophilin. The PCR products were separated by 2% agarose gel. The relative amounts of RT-PCR products for AR and 5{alpha}R-II were then quantified by standardizing with the PCR products of cyclophilin using Scion Images software (Scion Corporation, Frederick, MD). PCR products for AR were evaluated using 25 cycles for PND 120 ventral prostate, 24 cycles for PND 49 caput epididymis, and 30 cycles for PND 120 ventral prostate. 5{alpha}R-II was evaluated using 25 cycles for PND 49 ventral prostate, 19 cycles for PND 49 caput epididymis, and 30 cycles for PND 120 ventral prostate. The PCR product for cyclophilin at 20 cycles was used as an internal standard. Each amplification reaction was performed at least 3 times and confirmed for the reproducibility.

The PCR products for rat AR, 5{alpha}R-II, and cyclophilin were subcloned into pGEM-T Easy vectors and sequenced by the dideoxynucleotide chain termination method using the ABI Prism BigDye terminator cycle sequencing kit (PE-Biosystems, Foster City, CA).

Statistical analysis.
For statistical analysis, StatView for Windows version 5.0 (SAS Institute, Cary, NC) was used. All results represented are the means ± SE. Data were analyzed by one-way analysis of variance (ANOVA) followed by Dunnett's test as a post hoc test for comparison of means for tissue weights and AGD. Fisher's PLSD test was used for band intensity in semiquantitative RT-PCR analysis. p Values less than 0.05 were considered to indicate statistical significance.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Body Weight
Treatment of dams with a graded series of TCDD doses on GD 15 did not affect maternal body-weight gain during pregnancy. The treatment also did not affect live pup numbers or pup body weights on PND2 (data not shown). Figure 1Go represents the body weight of male offspring on PND 49 and PND 120. There was no statistically significant difference between the TCDD-treated and control groups.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1. Effects of maternal exposure to TCDD on body weight. Pregnant rats were orally administered TCDD on GD 15 as described in Materials and Methods. The values expressed are mean ± SE. The number of animals examined in each group is indicated above the x-axis. No statistical difference was detected between the vehicle-treated control group and any of the TCDD-treated groups, either on PND 49 or 120.

 
TCDD Concentration
Figure 2Go represents the TCDD concentrations in the adipose tissue and testis on PND 120. Abdominal adipose and testes were collected from 2–3 animals per each dose and extracted as described in Materials and Methods. GC-MS analysis clearly showed a dose-dependent increase of TCDD in both tissues. The concentration of TCDD in the adipose tissue was much higher than that in the testis: 24.1 pg TCDD/g for wet adipose tissue vs. 0.49 pg TCDD/g for wet testis. These tissue concentration data indicated that administration of TCDD was properly executed and maternal TCDD was transported to the offspring body proportionally to the treatment dose.



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 2. TCDD concentration in adipose tissue and testis from male rats maternally exposed to TCDD. The TCDD concentration was measured by GC-MS as described in Materials and Methods. Dose-dependent retention of TCDD was shown in both adipose tissue and testis.

 
Testicular Weight, DSP, and Histopathology of the Testis
The testicular weight at PNDs 49 and 120 are shown in Figure 3AGo. The data were expressed as a percentage of testis to body weight. On PND 49, there was no significant difference in testicular weight between any of the dosage groups and the control group. Although a statistically significant decrease in testicular weight of 50 ng TCDD/kg group was detected on PND 120, a dose-related effect was not apparent. Figure 3BGo represents DSP data on PNDs 49 and 120. No significant change was detected between any of the dose groups and the controls. In addition, histopathological analysis of the testes did not reveal any differences between the TCDD-exposed and control groups (Fig. 4Go).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 3. Effects of maternal exposure to TCDD on testicular weight (A) and daily sperm production (B) of male rat offspring on PNDs 49 and 120. Pregnant rats were orally administered TCDD on GD 15, as described in Materials and Methods. The values expressed are mean ± SE. The number of animals examined in each group is indicated above the x-axis. Statistically significant difference between means and control was analyzed by ANOVA followed by Dunnett's test (**p < 0.01).

 


View larger version (152K):
[in this window]
[in a new window]
 
FIG. 4. Histopathology of testes from male rats maternally exposed to TCDD. (A) Testis from vehicle-treated rat on PND 49; (B) testis from rat exposed to 800 ng TCDD/kg on PND 49. Magnification x100.

 
Epididymal Weight and Cauda Epididymal Sperm Reserve
Epididymal weight was not significantly affected by TCDD treatment (Fig. 5Go). With respect to the paired epididymal weight on PND 49, there was no difference between the treated and control groups (Fig. 5AGo). There was also no statistically significant difference in the cauda epididymal sperm reserve (SR) by maternal TCDD administration (Fig. 5CGo). Although it was not statistically significant, a trend of slight reduction in SR was observed at 800 ng TCDD/kg in the treated group.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 5. Effects of maternal exposure to TCDD on the epididymis on PNDs 49 and 120. Pregnant rats were orally administered TCDD on GD 15 as described in Materials and Methods. The values expressed are mean ± SE. The number of animals examined in each group is indicated above the x-axis. (A) Paired weight of whole epididymis; (B) paired cauda epididymal weight; (C) cauda epididymal sperm reserve. Statistically significant difference between means and control was analyzed by ANOVA followed by Dunnett's test (*p < 0.05).

 
Accessory Sex Organ Weights
There was a clear pattern of dose-dependent decrease in the weight of the urogenital complex on both PND 49 and PND 120 (Fig. 6AGo). Statistically significant differences from the controls were detected in the 200 and 800 ng/kg groups on PND 120. Ventral prostate weight was significantly reduced in a dose-dependent manner (Fig. 6BGo). Statistically significant differences from the controls were detected in the 800 ng TCDD/kg group on PND 49 and at as low as the 200 ng TCDD/kg group on PND 120.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 6. Effects of maternal exposure to TCDD on urogenital complex (A) and ventral prostate (B) weight on PND 49 and PND 120. Pregnant rats were orally administered TCDD on GD 15, as described in Materials and Methods. The values expressed are mean ± SE. The number of animals examined in each group is indicated above the x axis. Statistically significant differences between means and control were analyzed by ANOVA followed by Dunnett's test (*p < 0.05, **p < 0.01). Note the statistically significant difference of rats treated at a dose of 800 ng TCDD/kg on both PNDs 49 and 120.

 
Anogenital Distance
Anogenital distance (AGD), the length between the base of the genital tubercle and the anterior edge of the anus, was measured with a caliper. Although the magnitude of reduction was small, AGD was decreased in a dose-dependent manner (Fig. 7Go). On PND 120 there were statistically significant differences at doses as low as 50 ng TCDD/kg.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 7. Effects of maternal exposure to TCDD on anogenital distance of male rats on PNDs 49 and 120. Pregnant rats were orally administered TCDD on GD 15 as described in Materials and Methods. The values expressed are mean ± SE. The number of animals examined in each group is indicated above the x-axis. Significant difference between means and control was analyzed by ANOVA followed by Dunnett's test (*p < 0.05, **p < 0.01). Note the significant difference between the control group and TCDD-exposed groups of more than 50 ng/kg on PND 120.

 
Hormone Assay
We measured serum gonadotropins and testosterone concentrations by EIA and RIA, respectively. There were no dose-dependent decreases or increases in serum LH, FSH, or testosterone concentrations on either PND 49 or 120 (Table 1Go).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Effects of Maternal TCDD Exposure on Serum Gonadotropins and Testosterone Concentrations in Male Rats
 
5{alpha}R-II and AR mRNA Expression
Amounts of specific transcripts in tissue samples from TCDD-exposed and control animals were compared by RT-PCR. Although this system could not determine the absolute amount of mRNA molecules in the total RNA sample, it was possible to compare the relative mRNA amounts among the identical tissue samples by using an amplifying program with an appropriate number of cycles (log-phase) before saturation (plateau phase).

Ventral prostate on PND 49.
The maternal TCDD administration resulted in a dose-dependent increase in the amounts of 5{alpha}R-II transcripts in the ventral prostates on PND 49 (Fig. 8Go). For the purpose of comparison, relative arbitrary units were calculated by dividing the intensity of the band of the 5{alpha}R-II PCR product by the corresponding band intensity of cyclophilin using the same cDNA template. Multiple comparison analysis showed that there were statistically significant differences at doses as low as 200 ng/kg (Fig. 8BGo). On the other hand, a clear tendency for TCDD to cause a dose-related decrease in concentrations of AR mRNAs was observed. Statistically significant differences were detected at doses of more than 12.5 ng/kg by measuring the band intensity.



View larger version (75K):
[in this window]
[in a new window]
 
FIG. 8. Semiquantitative RT-PCR analysis of the effects of maternal exposure to TCDD on 5{alpha}R-II and AR mRNA levels in the ventral prostate of PND 49 offspring. RT-PCR was carried out with total RNA from the ventral prostate as described in Materials and Methods. (A) Agarose gel electrophoretic pattern of PCR products. The number indicated on the right is the cycle used in each PCR. (B) Relative amounts of PCR products to cyclophilin. The values expressed are mean ± SE for the total 3 samples examined for each group. A decreased level of androgen receptor mRNA expression and an increased level of 5{alpha}R-II mRNA expression were detected in a dose-dependent manner. Statistically significant difference between means and control was analyzed by ANOVA followed by Fisher's PLSD test (*p < 0.05, **p < 0.01).

 
Caput epididymis on PND 49.
No dose-dependent differences of either 5{alpha}R-II or AR mRNAs were detected in the caput epididymis on PND 49 (Fig. 9Go). There were also no dose-dependent changes in relative arbitrary units calculated from the 5{alpha}R-II bands at 19 cycles with cyclophilin bands at 20 cycles.



View larger version (63K):
[in this window]
[in a new window]
 
FIG. 9. Semiquantitative RT-PCR analysis of the effects of maternal exposure to TCDD on 5{alpha}R-II and AR mRNA levels in the caput epididymis of PND 49 offspring. (A) Agarose gel electrophoretic pattern of PCR products. The number indicated on the right is the cycle used in each PCR. (B) Relative amounts of PCR products to cyclophilin. The values expressed are mean ± SE for the total of 3 samples examined for each group. No dose-dependent change was observed for either gene.

 
Ventral prostate on PND 120.
No dose-dependent difference in the amounts of 5{alpha}R-II mRNAs was detected in the ventral prostate on PND 120 (Fig. 10Go). Relative arbitrary units that were calculated from the 5{alpha}R-II bands at 30 cycles with cyclophilin bands at 20 cycles did not show a dose-dependent change. Since the results were highly variable, statistical significance was not detected, but some animals in the 200 and 800 ng/kg dose groups clearly showed higher AR mRNA levels than did those in the control group.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 10. Semiquantitative RT-PCR analysis of the effects of maternal exposure to TCDD on 5{alpha}R-II and AR mRNA levels in the ventral prostate of PND 120 offspring. (A) Agarose gel electrophoretic pattern of PCR products. The number indicated on the right is the cycle used in each PCR reaction. (B) Relative amounts of PCR products to cyclophilin. The values expressed are mean ± SE for the total of 3 samples examined for each group. A sharp increase of AR mRNA was observed in rats treated with a TCDD dose of 800 ng/kg, although this change was not statistically significant.

 
mRNA expression levels of 5{alpha}R-II and AR mRNA in the ventral prostate were compared between PND 49 and PND 120 (Fig. 11Go). RT-PCR analysis showed that the expression of both 5{alpha}R-II and AR mRNA in control rats were clearly higher on PND 49 than on PND 120.



View larger version (77K):
[in this window]
[in a new window]
 
FIG. 11. Differences of mRNA levels of 5R-II, AR, and cyclophilin in the ventral prostate of vehicle-treated control rats between PNDs 49 and 120. The number indicated on the right is the cycle used in each PCR.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Maternal Exposure to A Low Dose of TCDD Does Not Affect Testicular Development or Spermatogenesis of Male Offspring
The experimental protocol used in the present study was based on the reports using Holtzman rats described by Peterson and coworkers (Mably et al., 1992aGo, bGo, cGo), but the lowest dose used was lower than their protocol (12.5–800 ng TCDD/kg vs. 64–1000 ng TCDD/kg, Mably et al., 1992a, b, c). The amounts of TCDD transferred to offspring from dams were proportional to the injected amounts (Fig. 2Go), indicating that the magnitude of exposure was dose-dependent. However, even the highest TCDD dose failed to induce reduction of testicular weight or DSP, or to provide any histological evidence of a reduction in spermatogenic cell number, suggesting that testicular development and spermatogenesis were not affected by the TCDD doses used. This observation does not appear to be consistent with the report by Mably et al. (1992c), in which DSP of the TCDD-treated rats was reduced in a dose-related fashion with a statistical significance at more than 160 ng TCDD/kg, and even at the lowest dose of 64 ng TCDD/kg on PNDs 63 and 120. In their report, no abnormal histological observation on the testis was presented with regard to the decrease of DSP (Mably et al., 1992cGo). Gray and coworkers reported that they executed similar experiments using LE rats but could not detect any significant reduction of testicular weight or DSP at doses less than 800 ng TCDD/kg (Gray et al., 1995Go, 1997Go). Faqi et al. (1998) gave female Wistar rats an initial loading dose of 25, 60, or 300 ng TCDD/kg bw at 2 weeks prior to mating, followed by a weekly maintenance dose of 5, 12, or 60 ng TCDD/kg bw, and reported a slight decrease of DSP with no changes in testicular weight. In other studies, no reduction of testicular weight was observed following maternal exposure to low-dose TCDD (Cooke et al., 1998Go; Wilker et al., 1996Go). In an ongoing experiment in our laboratory, however, the testes of some male Sprague Dawley (SD) offspring were reduced to nearly half the size of controls, following maternal administration of 1 µg TCDD/kg (unpublished data). These results strongly suggest that the threshold dose of TCDD, which still produces an adverse effect on the testes, might be around 1000 ng/kg single injection in the case of rats. Taken together, these results indicate that maternal exposure to a relatively low dose of TCDD (less than 1 µg TCDD/kg) has a minimal effect on testicular development and spermatogenesis.

Maternal Exposure to A Low Dose of TCDD Does Not Affect Epididymal Development or Sperm Number
No statistically significant difference in epididymal weight or SR was observed between the highest dose group (800 ng TCDD/kg) and the control group (Fig. 5Go). This observation is in contrast to that of Mably et al. (1992c), who reported that TCDD treatment reduced the size of the epididymis and the SR at doses larger than 400 ng/kg and 64 ng/kg, respectively. Furthermore, Gray et al. (1997) observed a statistically significant reduction of epididymal weight and SR in LE rats only at the highest dose of 800 ng TCDD/kg. In the present study, the cauda epididymal weight and SR of the highest TCDD dose (800-ng/kg) groups on both PNDs 49 and 120 showed a clear trend of reduction, although the difference was not statistically significant. In addition, in our current experiment using SD rats, dramatic hypoplasia of the epididymis was detected in some male offspring dosed maternally to 1 µg TCDD/kg (unpublished observation). Thus, the threshold of effects on epididymal development is thought be around 800 ng/kg by a single oral dose in the case of rats.

Reduction of ejaculated sperm number (ESN) is documented to be the most sensitive endpoint by Gray et al. (1997). They reported that a dose of only 50 ng TCDD/kg led to a significant decrease in ESN, and that this decrease was much greater than that of SR. To explain this phenomenon, Peterson and co-workers (Sommer et al., 1996Go) hypothesized that an increase in the phagocytotic activity of epithelial cells of epididymal and efferent ducts might be involved in the reduction of ESN. Because of the lack of experimental evidence on ESN, we cannot discuss the mechanism of the decrease of sperm count in the epididymis and ejaculates.

Low-Dose TCDD Reduced the Size of Sex-Accessory Glands and the Anogenital Distance
At TCDD doses larger than 200 ng/kg, the weight of the urogenital complex showed a clear pattern of dose-dependent decreases, and these decreases were significantly different from the control values. This reduction is attributable to the decreased size of the ventral prostate. Moreover, the AGD of male rats showed a dose-dependent reduction on PND 120, and the lowest-observed-adverse-effect level (LOAEL) was estimated to be 50 ng TCDD/kg in this protocol. Based on the above results, we concluded that ventral prostate weight and AGD are much more sensitive endpoints to TCDD exposure than testicular weight, DSP, epididymal weight, or SR. The reports by Mably et al. (1992a,b,c) also documented that maternal TCDD exposure significantly reduced AGD on PND 1 and PND 4. The ventral prostate weight on PND 49, 63, and 120 was reduced in a dose-dependent manner, and a statistically significant difference was detected at more than 160 ng/kg. At the highest dose of 800 ng/kg, the ventral prostate weight was reduced less than 50% in size. Gray et al. also reported the same effects on AGD and ventral prostate (Gray et al., 1995Go, 1997Go).

A Low Dose of TCDD Reduced Ventral Prostate Size without Affecting Serum Gonadotropins or Testosterone Levels
Since the growth of these organs is dependent upon androgen, Peterson and coworkers measured the concentrations of plasma testosterone (T), 5{alpha}-dihydrotestosterone (DHT), and luteinizing hormone (LH) (Mably et al., 1992aGo; Roman et al., 1995Go), and observed a tendency toward reduction of T and DHT during stages of development. Cooke et al. (1998) also found significantly lower concentrations of total serum androgen on PND 45 in TCDD-exposed rats than in control rats. However, a detailed examination concerning circulating and intratesticular androgen levels and in vitro androgen production of TCDD-treated rats revealed that the decreased levels were not large enough to explain the reductions of androgen (Roman et al., 1995Go). In the present study, we also failed to find significant differences in serum gonadotropins (LH and FSH) and T (Table 1Go). It would thus seem that maternal exposure to TCDD did not alter the productivity of androgen in male offspring.

When the castrated male rats that had been maternally exposed to 700 ng TCDD/kg were implanted with T-filled silastic capsule on PND 63, ventral prostate weight and protein content did not respond to testosterone by growing as much as those of vehicle-treated control rats (Bjerke et al., 1994bGo). Moreover, it has been reported that a set of androgen-responsive genes, e.g., probasin and 20-kDa cystatin-like protein, which are all major secretory proteins of ventral prostate, were expressed at significantly lower levels in the prostates of TCDD-treated rats than in the prostates of vehicle-treated rats (Roman et al., 1998a). Based on these investigations, Peterson and coworkers concluded that TCDD reduces the androgen responsiveness of the prostate without inhibiting androgen production. In our study, we also suggest that maternal TCDD exposure caused the reduced androgen responsiveness of the prostate without inhibiting androgen production during the pubertal period.

5{alpha}R-II mRNA Level in the Ventral Prostate Is Increased by A Low Dose of TCDD
5{alpha}-Reductase type 2 (5{alpha}R-II), one of the two isoenzymes for steroid-5{alpha}-reduction (Mahendroo and Russell, 1999Go; Normington and Russell, 1992Go), was reported to be responsible for prostate growth (George, 1997Go). The ventral prostate and AGD seem to be more responsive to TCDD than the testis and epididymis, and their growth is known to be more sensitive to DHT, a metabolite of T, than is the growth of the internal reproductive organs, testis, and epididymis (Iguchi et al., 1991Go; Imperato-McGinley et al., 1992Go; Tsuji et al., 1994Go). Accordingly, we here investigated the association between the 5 {alpha}-reductase enzyme and growth of the TCDD-affected ventral prostate. In a preliminary experiment using RT-PCR, we confirmed that 5{alpha}R-II mRNA was expressed in the ventral prostate, seminal vesicle, and epididymis, but not in the testis of adult Holtzman rats. If the decreased size of the TCDD-exposed prostate was due to reduction of DHT production, then we would expect that the 5{alpha}R-II mRNA level would be reduced. Surprisingly, however, semiquantitative RT-PCR analysis revealed that the expression level of 5{alpha}R-II mRNAs on PND 49 was increased in a TCDD-dose-dependent manner (Fig. 8Go). This result revealed that the reduction in ventral prostate size was not accompanied by a decrease in 5{alpha}R-II mRNA. More recently, Peterson and coworkers examined 5{alpha}R-II enzyme activity in the ventral prostate on PNDs 14, 21, and 32 of rats that were exposed maternally to 1 µg TCDD/kg, and found that the activity was increased by TCDD, which is consistent with our current results on 5{alpha}R-II mRNA (personal communication).

In the control rats, the 5{alpha}R-II mRNA levels in the prostate were higher on PND 49 than on PND 120 (Fig. 11Go). In contrast, the average weights of the ventral prostate on PNDs 49 and 120 were around 280 mg and 1000 mg, respectively. Therefore, although the regulatory mechanism of 5{alpha}R-II expression is not clear, it appears that the 5{alpha}R-II mRNA levels are inversely correlated with the size of the prostate. Because the size of the prostate is reduced by exposure to TCDD, the higher level of 5{alpha}R-II mRNA in the TCDD-exposed prostate might reflect in normal expression level. The present results suggest that TCDD exposure results in permanent alteration of the prostate via an as-yet-unknown mechanism, and that this mechanism is related to the above-described decrease of androgen responsiveness in the pubertal stages (Bjerke et al., 1994bGo).

A Low Dose of TCDD Decreased AR mRNA Level in the Ventral Prostate
Gray et al. (1995) reported that the number of AR in the TCDD-exposed ventral prostate and seminal vesicles were similar to those of control organs. More recently, in a study using competitive RT-PCR, Hamm et al. (2000) reported that maternal administration of a single dose of 1 µg TCDD/kg to LE rats did not result in any significant reduction in the number of AR mRNA molecules in seminal vesicles on either PND 25 or PND 32. In the present study, however, a dose-dependent decrease of PCR product for AR mRNA was detected in TCDD-exposed ventral prostates on PND 49 by the use of semiquantitative RT-PCR, and a statistical significance was detected even at a dose of 12.5 ng TCDD/kg, suggesting that maternal exposure to a low dose of TCDD decreases AR mRNA level. We speculate that this reduction of AR might be involved in the decrease of androgen responsiveness.

The AR gene itself is a target for androgen, and androgen regulates AR mRNA expression in a tissue-specific fashion (Grad et al., 1999Go). In the normal ventral prostate of adult rats, AR mRNA levels have been shown to be down-regulated by androgens (Lubahn et al., 1989Go; Prins et al., 1995). As shown in Figure 11Go, the AR mRNA level in the ventral prostate on PND 120 was lower than that on PND 49 and the level of AR mRNA was inversely correlated with the size of the prostate. This decreased level of AR mRNA might be the result of the elevated T level during puberty (Zanato et al., 1994Go). From the standpoint of this T-mediated AR down-regulation, it should be considered that AR mRNA levels tend to be elevated in the TCDD-exposed prostate on PND 49 because of the previous reports that T concentrations on PND 49 tended to be reduced by TCDD (Cooke et al., 1998Go; Mably et al., 1992aGo; Roman et al., 1995Go). In the present study, however, we failed to observe any indication of an increased T level; this makes it difficult to explain the probable reasons for this decrease of AR mRNA level.

With respect to age-related changes of the prostate, the apparent discrepancy between our data and those from Peterson's laboratory may be attributable to one or more of the possible causes below. In their reports, the difference in prostate weight between the TCDD-treated and control groups was more conspicuous at the prepubertal or pubertal stages (PND 46 and PND 63) than at the mature stage (PND 120). That is, the magnitude of the size reduction became smaller as development progressed (Mably et al., 1992aGo). This suggests that male reproductive effects by maternal TCDD exposure may be reversible. In contrast, our data on the ventral prostate and AGD showed that the effects were more evident on PND 120, suggesting that the effects were irreversible. However, in RT-PCR analysis on PND 120, AR mRNA levels in rats treated at a TCDD dose of 800 ng/kg were higher than those in controls, although the difference was not statistically significant. This was the reverse of the pattern seen on PND 49, suggesting that the androgen receptor expression of the TCDD-exposed prostate on PND120 appeared to be differently regulated from that on PND 49. Further investigations focusing on DHT production and the relationship between AR mRNA number and androgen responsiveness in the ventral prostate of normal male rats will be needed.

Conclusion
Maternal exposure to a relatively low dose of TCDD affected the development of the ventral prostate and external genital organs as well as the AGD, more than it affected the development of the testis and other internal genital organs. The decreased size of the ventral prostate by maternal TCDD exposure is thought to be due to decreased responsiveness of the prostate to androgen; that is, it is thought to be derived from insufficient expression of androgen receptor mRNA during puberty.


    ACKNOWLEDGMENTS
 
The authors thank Mr. Toshiyuki Takano for his excellent care of animals and technical assistance.


    NOTES
 
1 To whom correspondence should be addressed. Fax: +81-298–50–2588. E-mail: ohsako{at}nies.go.jp. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Birnbaum, L. S. (1994). Endocrine effects of prenatal exposure to PCBs, dioxins, and other xenobiotics: Implications for policy and future research. Environ. Health. Perspect. 102, 676–679.[Web of Science][Medline]

Bjerke, D. L., Brown, T. J., MacLusky, N. J., Hochberg, R. B., and Peterson, R. E. (1994a). Partial demasculinization and feminization of sex behavior in male rats by in utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin is not associated with alterations in estrogen receptor binding or volumes of sexually differentiated brain nuclei. Toxicol. Appl. Pharmacol. 127, 258–267.[Web of Science][Medline]

Bjerke, D. L., and Peterson, R. E. (1994). Reproductive toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in male rats: Different effects of in utero versus lactational exposure. Toxicol. Appl. Pharmacol. 127, 241–249.[Web of Science][Medline]

Bjerke, D. L., Sommer, R. J., Moore, R. W., and Peterson, R. E. (1994b). Effects of in utero and lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure on responsiveness of the male rat reproductive system to testosterone stimulation in adulthood. Toxicol. Appl. Pharmacol. 127, 250–257.[Web of Science][Medline]

Carlsen, E., Giwercman, A., Keiding, N., and Skakkebaek, N. E. (1992). Evidence for decreasing quality of semen during past 50 years. B M J. 305, 609–613.

Chahoud, I., Krowke, R., Schimmel, A., Merker, H. J., and Neubert, D. (1989). Reproductive toxicity and pharmacokinetics of 2,3,7,8-tetrachlorodibenzo-p-dioxin: 1. Effects of high doses on the fertility of male rats. Arch. Toxicol. 63, 432–439.[Web of Science][Medline]

Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.[Web of Science][Medline]

Colborn, T., vom Saal, F. S., and Soto, A. M. (1993). Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ. Health Perspect. 101, 378–384.[Web of Science][Medline]

Cooke, G. M., Price, C. A., and Oko, R. J. (1998). Effects of in utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on serum androgens and steroidogenic enzyme activities in the male rat reproductive tract. J. Steroid Biochem. Mol. Biol. 67, 347–354.[Web of Science][Medline]

Faqi, A. S., Dalsenter, P. R., Merker, H. J., and Chahoud, I. (1998). Reproductive toxicity and tissue concentrations of low doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin in male offspring rats exposed throughout pregnancy and lactation. Toxicol. Appl. Pharmacol. 150, 383–392.[Web of Science][Medline]

George, F. W. (1997). Androgen metabolism in the prostate of the finasteride-treated adult rat: A possible explanation for the differential action of testosterone and 5 alpha-dihydrotestosterone during development of the male urogenital tract. Endocrinology 138, 871–877.[Abstract/Free Full Text]

Grad, J. M., Dai, J. L., Wu, S., and Burnstein, K. L. (1999). Multiple androgen-responsive elements and a Myc consensus site in the androgen receptor (AR) coding region are involved in androgen-mediated up-regulation of AR messenger RNA. Mol. Endocrinol. 13, 1896–1911.[Abstract/Free Full Text]

Gray, L. E., Jr., Kelce, W. R., Monosson, E., Ostby, J. S., and Birnbaum, L. S. (1995). Exposure to TCDD during development permanently alters reproductive function in male Long Evans rats and hamsters: Reduced ejaculated and epididymal sperm numbers and sex accessory gland weights in offspring with normal androgenic status. Toxicol. Appl. Pharmacol. 131, 108–118.[Web of Science][Medline]

Gray, L. E., Ostby, J. S., and Kelce, W. R. (1997). A dose-response analysis of the reproductive effects of a single gestational dose of 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin in male Long Evans hooded rat offspring. Toxicol. Appl. Pharmacol. 146, 11–20.[Web of Science][Medline]

Hamm, J. T., Sparrow, B. R., Wolf, D., and Birnbaum, L. S. (2000). In utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters postnatal development of seminal vesicle epithelium. Toxicol. Sci. 54, 424–430.[Abstract/Free Full Text]

Iguchi, T., Uesugi, Y., Takasugi, N., and Petrow, V. (1991). Quantitative analysis of the development of genital organs from the urogenital sinus of the fetal male mouse treated prenatally with a 5 {alpha}-reductase inhibitor. J. Endocrinol. 128, 395–401.[Abstract/Free Full Text]

Imperato-McGinley, J., Sanchez, R. S., Spencer, J. R., Yee, B., and Vaughan, E. D. (1992). Comparison of the effects of the 5{alpha}-reductase inhibitor finasteride and the antiandrogen flutamide on prostate and genital differentiation: Dose-response studies. Endocrinology 131, 1149–1156.[Abstract/Free Full Text]

Jana, N. R., Sarkar, S., Yonemoto, J., Tohyama, C., and Sone, H. (1998). Strain differences in cytochrome P4501A1 gene expression caused by 2,3,7,8-tetrachlorodibenzo-p-dioxin in the rat liver: Role of the aryl hydrocarbon receptor and its nuclear translocator. Biochem. Biophys. Res. Commun. 248, 554–558.[Web of Science][Medline]

Lubahn, D. B., Tan, J. A., Quarmby, V. E., Sar, M., Joseph, D. R., French, F. S., and Wilson, E. M. (1989). Structural analysis of the human and rat androgen receptors and expression in male reproductive tract tissues. Ann. N. Y. Acad. Sci. 564, 48–56.[Web of Science][Medline]

Mably, T. A., Moore, R. W., and Peterson, R. E. (1992a). In utero and lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin: 1. Effects on androgenic status. Toxicol. Appl. Pharmacol. 114, 97–107.[Web of Science][Medline]

Mably, T. A., Moore, R. W., Goy, R. W., and Peterson, R. E. (1992b). In utero and lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin: 2. Effects on sexual behavior and the regulation of luteinizing hormone secretion in adulthood. Toxicol. Appl. Pharmacol. 114, 108–117.[Web of Science][Medline]

Mably, T. A., Bjerke, D. L., Moore, R. W., Gendron-Fitzpatrick, A., and Peterson, R. E. (1992c). In utero and lactational exposure of male rats to 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin: 3. Effects on spermatogenesis and reproductive capability. Toxicol. Appl. Pharmacol. 114, 118–126.[Web of Science][Medline]

Mahendroo, M. S., and Russell, D. W. (1999). Male and female isoenzymes of steroid 5{alpha}-reductase. Rev. Reprod. 4, 179–183.[Abstract]

McConnell, E. E., Moore, J. A., and Dalgard, D. W. (1978). Toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in rhesus monkeys (Macaca mulatta) following a single oral dose. Toxicol. Appl. Pharmacol. 43, 175–187.[Web of Science][Medline]

Miyabara, Y., Hashimoto, S., Sagai, M., and Morita, M. (1999). PCDDs and PCDFs in vehicle exhaust particles in Japan. Chemosphere 39, 143–150.[Medline]

Normington, K., and Russell, D. W. (1992). Tissue distribution and kinetic characteristics of rat steroid 5{alpha}-reductase isozymes. Evidence for distinct physiological functions. J. Biol. Chem. 267, 19548–19554.[Abstract/Free Full Text]

Peterson, R. E., Theobald, H. M., and Kimmel, G. L. (1993). Developmental and reproductive toxicity of dioxins and related compounds: Cross-species comparisons. Crit. Rev. Toxicol. 23, 283–335.[Web of Science][Medline]

Prins, G. S., and Woodham, C. (1995). Autologous regulation of androgen receptor messenger ribonucleic acid in the separate lobes of the rat prostate gland. Biol. Reprod. 53, 609–619.[Abstract]

Robb, G. W., Amann, R. P., and Killian, G. J. (1978). Daily sperm production and epididymal sperm reserves of pubertal and adult rats. J. Reprod. Fert. 54, 103–107.[Abstract/Free Full Text]

Roman, B. L., and Peterson, R. E. (1998a). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin impairs prostate development: 1. Effects on gene expression. Toxicol. Appl. Pharmacol. 150, 240–253.[Web of Science][Medline]

Roman, B. L., Sommer, R. J., Shinomiya, K., Peterson, R. E. (1995). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Impaired prostate growth and development without inhibited androgen production. Toxicol. Appl. Pharmacol. 134, 241–250.[Web of Science][Medline]

Roman, B. L., Timms, B. G., Prins, G. S., and Peterson, R. E. (1998b). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin impairs prostate development: 2. Effects on growth and cytodifferentiation. Toxicol. Appl. Pharmacol. 150, 254–270.[Web of Science][Medline]

Sharpe, R. M., and Skakkebaek, N. E. (1993). Are oestrogens involved in falling sperm counts and disorders of the male reproductive tract? Lancet 341, 1392–1395.[Web of Science][Medline]

Sommer, R. J., Ippolito, D. L., and Peterson, R. E. (1996). In utero and lactational exposure of the male Holtzman rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Decreased epididymal and ejaculated sperm numbers without alterations in sperm transit rate. Toxicol. Appl. Pharmacol. 140, 146–153.[Web of Science][Medline]

Tofilon, P. J., and Piper, W. N. (1982). 2,3,7,8-Tetrachlorodibenzo-p-dioxin-mediated depression of rat testicular heme synthesis and microsomal cytochrome P-450. Biochem. Pharmacol. 31, 3663–3666.[Web of Science][Medline]

Tsuji, M., Shima, H., Terada, N., and Cunha, G. R. (1994). 5 {alpha}-reductase activity in developing urogenital tracts of fetal and neonatal male mice. Endocrinology 134, 2198–2205.[Abstract]

Wilker, C., Johnson, L., and Safe, S. (1996). Effects of developmental exposure to indole-3-carbinol or 2,3,7,8-tetrachlorodibenzo-p-dioxin on reproductive potential of male offspring. Toxicol. Appl. Pharmacol. 141, 68–75.[Web of Science][Medline]

Zanato, V. F., Martins, M. P., Anselmo-Franci, J. A., Petenusci, S. O., and Lamano-Carvalho, T. L. (1994). Sexual development of male Wistar rats. Braz. J. Med. Biol. Res. 27, 1273–1280.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Toxicol SciHome page
T. Jiang, D. R. Bell, S. Clode, M. Q. Fan, A. Fernandes, P. M. D. Foster, G. Loizou, A. MacNicoll, B. G. Miller, M. Rose, et al.
A Truncation in the Aryl Hydrocarbon Receptor of the CRL:WI(Han) Rat Does Not Affect the Developmental Toxicity of TCDD
Toxicol. Sci., February 1, 2009; 107(2): 512 - 521.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. R. Bell, S. Clode, M. Q. Fan, A. Fernandes, P. M. D. Foster, T. Jiang, G. Loizou, A. MacNicoll, B. G. Miller, M. Rose, et al.
Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin in the Developing Male Wistar(Han) Rat. I: No Decrease in Epididymal Sperm Count after a Single Acute Dose
Toxicol. Sci., September 1, 2007; 99(1): 214 - 223.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. R. Bell, S. Clode, M. Q. Fan, A. Fernandes, P. M. D. Foster, T. Jiang, G. Loizou, A. MacNicoll, B. G. Miller, M. Rose, et al.
Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin in the Developing Male Wistar(Han) Rat. II: Chronic Dosing Causes Developmental Delay
Toxicol. Sci., September 1, 2007; 99(1): 224 - 233.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. T. Okino, D. Pookot, L.-C. Li, H. Zhao, S. Urakami, H. Shiina, M. Igawa, and R. Dahiya
Epigenetic Inactivation of the Dioxin-Responsive Cytochrome P4501A1 Gene in Human Prostate Cancer.
Cancer Res., August 1, 2006; 66(15): 7420 - 7428.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
R. Ishimura, T. Kawakami, S. Ohsako, K. Nohara, and C. Tohyama
Suppressive Effect of 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Vascular Remodeling That Takes Place in the Normal Labyrinth Zone of Rat Placenta during Late Gestation
Toxicol. Sci., May 1, 2006; 91(1): 265 - 274.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Mutoh, J. Taketoh, K. Okamura, T. Kagawa, T. Ishida, Y. Ishii, and H. Yamada
Fetal Pituitary Gonadotropin as an Initial Target of Dioxin in Its Impairment of Cholesterol Transportation and Steroidogenesis in Rats
Endocrinology, February 1, 2006; 147(2): 927 - 936.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
H. M. Miettinen, P. Pulkkinen, T. Jamsa, J. Koistinen, U. Simanainen, J. Tuomisto, J. Tuukkanen, and M. Viluksela
Effects of In Utero and Lactational TCDD Exposure on Bone Development in Differentially Sensitive Rat Lines
Toxicol. Sci., June 1, 2005; 85(2): 1003 - 1012.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
M. Yamamoto, A. Narita, M. Kagohata, M. Shirai, F. Akahori, and K. Arishima
Effects of Maternal Exposure to 3,3',4,4',5-Pentachlorobiphenyl (PCB126) or 3,3',4,4',5,5'-Hexachlorobiphenyl (PCB169) on Testicular Steroidogenesis and Spermatogenesis in Male Offspring Rats
J Androl, March 1, 2005; 26(2): 205 - 214.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
C. Emond, L. S. Birnbaum, and M. J. DeVito
Physiologically Based Pharmacokinetic Model for Developmental Exposures to TCDD in the Rat
Toxicol. Sci., July 1, 2004; 80(1): 115 - 133.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
U. Simanainen, T. Haavisto, J. T. Tuomisto, J. Paranko, J. Toppari, J. Tuomisto, R. E. Peterson, and M. Viluksela
Pattern of Male Reproductive System Effects After in Utero and Lactational 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Exposure in Three Differentially TCDD-Sensitive Rat Lines
Toxicol. Sci., July 1, 2004; 80(1): 101 - 108.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
K. Ko, H. M. Theobald, R. W. Moore, and R. E. Peterson
Evidence that Inhibited Prostatic Epithelial Bud Formation in 2,3,7,8-Tetrachlorodibenzo-p-dioxin-Exposed C57BL/6J Fetal Mice Is Not Due to Interruption of Androgen Signaling in the Urogenital Sinus
Toxicol. Sci., June 1, 2004; 79(2): 360 - 369.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. Ashby, H. Tinwell, P. A. Lefevre, R. Joiner, and J. Haseman
The Effect on Sperm Production in Adult Sprague-Dawley Rats Exposed by Gavage to Bisphenol A between Postnatal Days 91-97
Toxicol. Sci., July 1, 2003; 74(1): 129 - 138.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. Ohsako, Y. Miyabara, M. Sakaue, R. Ishimura, M. Kakeyama, H. Izumi, J. Yonemoto, and C. Tohyama
Developmental Stage-Specific Effects of Perinatal 2,3,7,8-Tetrachlorodibenzo-p-dioxin Exposure on Reproductive Organs of Male Rat Offspring
Toxicol. Sci., April 1, 2002; 66(2): 283 - 292.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (52)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ohsako, S.
Right arrow Articles by Yonemoto, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohsako, S.
Right arrow Articles by Yonemoto, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?