Toxicological Sciences 60, 264-270 (2001)
Copyright © 2001 by the Society of Toxicology
CARCINOGENICITY |
Chromosome 11 Loss from Thymic Lymphomas Induced in Heterozygous Trp53 Mice by Phenolphthalein


* University of North Dakota School of Medicine, Grand Forks, ND; and
National Institute of Environmental Health Sciences, Research Park, North Carolina 27709
Received September 19, 2000; accepted November 20, 2000
| ABSTRACT |
|---|
|
|
|---|
C57BL/6 p53 (+/) N5 mice heterozygous for a null p53 allele were given phenolphthalein to learn more about mechanisms of carcinogenesis and to evaluate the p53-deficient mouse as a tool for identifying potential human carcinogens. DNA samples isolated from 10 phenolphthalein-induced thymic lymphomas were analyzed for loss of heterozygosity (LOH) at the Trp53 locus and simple sequence length polymorphic (SSLP) loci. The initial screening revealed remarkable results from only chromosome 11. Allelotyping at approximately five centiMorgan intervals, we found SSLP heterozygosity for C57BL/6 and 129Sv over much of chromosome 11. In the tumors, treatment-related LOH was apparent on chromosome 11 at each of the 28 informative loci examined. The strain-specific polymorphism lost from individual tumors allowed us to deduce the distribution of alleles along the length of the maternal and paternal chromosomes 11. The allelic patterns indicate that mitotic homologous recombination occurred during embryogenesis if breeding protocols were carried out as described. The mitotic recombination observed may be attributable to p53 haploinsufficiency for normal suppression of mitotic recombination.
Key Words: allelotype; simple sequence length polymorphism; SSLP; carcinogenesis; thymus; lymphoma; phenolphthalein; recombination; LOH; chromosome loss..
| INTRODUCTION |
|---|
|
|
|---|
Phenolphthalein was identified as a multispecies and multisite carcinogen in a 2-year cancer bioassay (Dunnick and Hailey, 1996
To further explore the mechanisms of phenolphthalein-induced carcinogenesis and to assess the potential of p53-deficient mice to rapidly identify carcinogenic effects, heterozygous Trp53 mice on a C57BL/6 background were dosed with phenolphthalein (Dunnick et al., 1997
). The p53-deficient mice were heterozygous for a null p53 allele (Donehower et al., 1992
). As in B6C3F1 mice, the thymus was a target organ in these mice. Twenty-one of 21 of the thymic lymphomas examined showed loss of wild-type Trp53 by Southern blot analyses, but the mechanism for loss was unclear. Among the other effects of phenolphthalein treatment, an increased incidence of micronucleated erythrocytes was observed. Micronucleated erythrocytes were observed at each experimental dose. Thus, a no-observable-adverse-effect-level was not estimated (Tice et al., 1998
). There was no evidence for ovarian tumors in the treated heterozygous Trp53 mice, suggesting the ovarian tumors observed in B6C3F1 mice arose through tumorigenic pathways different from those pathways present in the thymus. Alternatively, the mice expired before ovarian tumors became apparent. Lymphomagenic responses that took 2 years to develop in the conventional B6C3F1 mouse assay were evident after only 4 months in the p53-deficient mouse model.
Here we report the results from in-depth Trp53 genotyping and the results of a survey of simple sequence length polymorphisms (SSLP). The study compared DNA isolated from 10 phenolphthalein-induced thymic lymphomas from heterozygous Trp53 mice to DNA from nontumor tissues.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animal dose response.
TSG-p53TM mice, heterozygous for Trp53 (designated C57BL/6TacBR-[KO]p53 N5), were obtained from Taconic of Germantown, NY. Six groups of 20 female mice, 710 weeks of age, received 0, 200, 375, 750, 3000, or 12,000 ppm of phenolphthalein (CAS # 77-09-8), in their feed for up to 6 months. In the groups that received phenolphthalein, atypical hyperplasia and malignant lymphomas of thymic origin developed at a combined incidence of 5, 5, 25, 100, and 95%, respectively, as previously reported (Dunnick et al., 1997
The TSG-p53TM mice used in the phenolphthalein study were the offspring of the fifth backcross (N5) of p53 (/) C57BL/6 males (N4) x inbred wild-type C57BL/6 females (Fig. 1
). Thus, in the p53 (+/) study animals, the maternal chromosomes should have harbored only C57BL/6 alleles. The original p53-deficient strain was introduced as 75% C57BL/6: 25% 129Sv. Therefore, about 3% of the paternal inherited alleles in the N5 generation should be 129Sv, residual from the embryonic stem cells used to generate the strain.
|
Genomic DNA.
Genomic DNA from normal 129SvJ and C57BL/6J mice were generously provided by Dr. Norman R. Drinkwater of the McArdle Laboratory for Cancer Research, University of Wisconsin. All other DNA samples were from tissues from C57BL/6TacBR-[KO]p53 N5 study mice obtained at necropsy, flash-frozen in liquid nitrogen, and stored at 80°C. Genomic DNA was isolated from 10 thymic lymphomas from animals treated with 750 ppm (animal number 908 and 915), 3000 ppm (animal number 920, 924, 928, 931, and 938) and 12,000 ppm (animal number 948, 949, and 953) of phenolphthalein. DNA was also isolated from nontumor thymus and ear tissues from two sentinel mice (animal number 960 and 965) not treated with phenolphthalein but otherwise maintained the same as the dosed animals. The 10 tumor-derived DNA samples were paired with nontumor tissue DNA isolated from an ear or kidney of the same animal (Table 1
|
Primers.
For PCR reactions specifically targeting wild-type Trp53, the upstream and downstream priming sequences were TGCCCTGTGCAGTTGTGGGTCA and ATTTCCTTCCACCCGGATAAGATG, respectively. The complementary sequence of the downstream primer is present in exon 6 of both the wild-type and null p53 alleles. The upstream priming sequence is located in the region of exon 5 deleted from the null allele and thus only primed amplification from the wild-type allele. Primers used to amplify the neo sequence harbored by the null allele were ATTGAACAAGATGGATTGCAC, located at base pair 1554, and GGTAGCCGGATCAAGCGTATG, located at base pair 1940. The sets of primers used to amplify SSLP were purchased from Research Genetics (Huntsville, AL).
Conditions.
Final volume for PCR reactions was 20 µl. Each reaction contained 24 ng template DNA, 0.6 U of Taq 2000 polymerase (Stratagene), 200 µM each deoxynucleoside triphosphate, 0.132 µM each primer, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, and 0.001% gelatin. Reactions were thermal cycled: one cycle at 96°C for 3 min, 42 cycles at 96°C for 1 min, 55°C for 1 min, 72°C for 1 min, and one cycle at 72°C for 3 min. Amplicons generated from SSLP loci were radiolabeled for autoradiography by reducing the cold dATP to 5 µM and adding 0.5 to 1.0 µCi of [
-32P]dATP, 6000 Ci/mmole per 20 µl reaction volume (Weber, 1989
). All amplifications included a negative control where sterile water was added in place of template DNA. P53 amplicons were electrophoretically separated on 2.0% agarose containing ethidium bromide. Radiolabeled amplicons were separated under denaturing conditions on 12 x 16 inch, 6% polyacrylamide gels.
| RESULTS |
|---|
|
|
|---|
The mice used in the study were heterozygous for C57BL/6 and 129Sv along much of chromosome 11. This was unexpected. Each scan shown in Figure 2
|
The frequency of 129Sv occurrence was approximately 50% of the loci examined. This contrasted with the expectation of about 3% 129Sv in the N5 generation. The higher than expected frequency was, in part, attributed to 129Sv linkage with Trp53, the selection marker (Donehower et al., 1992
Loss of heterozygosity (LOH) occurred in the 10 phenolphthalein-induced lymphomas at each of 28 informative chromosome 11 loci. Patterns of LOH were apparent. At loci between 0 centiMorgans (cM) and 37.0 cM, each tumor DNA alternated between regions of 129Sv loss and C57BL/6 loss (Table 1
and Fig. 2
; D11MIT149). In contrast, consistent loss of the C57BL/6 allele was observed in the central region of chromosome 11, proximal to the p53 locus, and between 37.0 and 44.0 cM from the centromere (Table 1
and Fig. 2
; D11MIT4, D11MIT368, and D11MIT219). In tumors 218, 223, 026, 273, 278, 011, and 016, the C57BL/6 alleles were lost at informative loci distal to 47.0 cM. In contrast, tumors 255 and 001 retained C57BL/6 alleles in this region (Table 1
and Fig. 2
; D11MIT196 and D11MIT284).
Analyses of 21 loci on chromosomes other than 11 (D1MIT70, D3MIT169, D4MIT40, D4MIT77, D5MIT122, D6MIT86, D7MIT82, D8MIT45, D8MIT107, D9MIT194, D10MIT150, D12MIT136, D12MIT8, D12MIT158, D13MIT15, D14MIT36, D15MIT12, D16MIT20, D17MIT55, D18MIT101, and D19MIT31) did not reveal polymorphism or meaningful differences between tumor DNA and nontumor tissue DNA. A few simple intragenic repeat sequences, not known to be polymorphic, were screened for alterations. The simple repeats were targeted because they are located within cancer-associated genes. No difference between nontumor and tumor DNA was revealed by the analyses of repeat sequences within Brca1, Brca2, Gli2, Tnfr2, or Xrccl.
Figure 3
shows ethidium bromidestained PCR amplicons separated on 2.0% agarose. The amplicons were generated using wild-type Trp53specific primers and template DNA isolated from the phenolphthalein-induced thymic tumors, and nontumor tissue DNA. Reactions that used template DNA from nontumor tissues generated a 270 base pair amplicon from the wild-type Trp53 and a 190 base pair amplicon from the p53 processed pseudogene. Reactions using template DNA from the thymic lymphomas did not generate the wild-type amplicon. The pseudogene amplicon was an internal control in these reactions and confirmed that the lack of yield from the wild-type allele was due to a loss of that allele rather than inadequate amplification conditions. Although not shown, similar results were yielded from template DNA isolated from thymic tumors generated in the animals treated with 750 ppm phenolphthalein.
|
Unlike the wild-type allele, the null allele was not lost during phenolphthalein-induced tumorigenesis. Each of the tumor- and nontumor tissue- derived DNA samples generated a targeted 386 base pair amplicon from the null allele neo (not shown). The results were consistent with previous Southern analyses that showed loss of wild-type Trp53 and retention of the null allele in each of 21 phenolphthalein-induced tumors (Dunnick et al., 1997
| DISCUSSION |
|---|
|
|
|---|
Heterozygous TSG-p53TM mice harbor a wild-type Trp53, a null Trp53, and a processed p53 pseudogene (Donehower et al., 1992
Although unexpected, the C57BL/6:129Sv heterozygosity we detected facilitated the determination that one copy of chromosome 11 was lost from each of the 10 lymphomas. The common elements of this (maternal) chromosome that were lost included the wild-type p53 allele and a 3.0 cM flanking region of C57BL/6 character.
In consideration of the mechanism of lymphomagenesis, we speculate that cells that lost wild-type Trp53 escaped an apoptotic response elicited by phenolphthalein-induced DNA damage and that these cells expanded clonally. We extend this well-accepted mechanism and suggest a mechanism where the wild-type Trp53 was lost during tumorigenesis as a consequence of generalized genomic instability enhanced by p53 haploinsufficiency. Loss of heterozygosity at each of the 28 informative chromosome 11 loci examined showed that the wild-type p53 allele-harboring maternal chromosome 11 was lost during lymphomagenesis. Thus, the allelotypes found in the tumors defines the patterns of polymorphism on the paternal chromosomes. The paternal allelotypes, together with the heterozygous allelotypes of the nontumor tissues, allowed us to deduce the arrangements of the polymorphisms on maternal chromosomes (Fig. 4
). If the breeding protocol was conducted as reported, then the maternal and paternal allelic patterns are best explained by mitotic recombination during embryogenesis. We attribute the unexpected rearrangements to generalized genomic instability in somatic tissues as a consequence of p53 haploinsufficiency. These finding parallel results from sarcomas and bladder tumors induced in benzene- and p-cresidine treated p53 (+/) mice (J. E. Hulla, J. E. French, and J. K. Dunnick, Carcinogenesis, 2000, in press).
|
A second but less significant common feature of the tumors was consistent loss of C57BL/6 genetic elements. C57BL/6 elements closely linked to the wild-type Trp53 in the nontumor tissue were absent from the lymphoma from the same animal. Thus, we considered 129Sv-specific cancer susceptibility and C57BL/6-specific resistance that map to this region as possibly having roles in tumorigenesis. Except for the teratoma susceptibility that mapped to chromosome 18, 129Sv mice have a relatively low incidence of spontaneous tumors (Mouse Genome Informatics Resource, 1999
There was no evidence to suggest that the wild-type p53 alleles were not of maternal origin as outlined in Figure 1
. Loss of the maternal chromosome was invariably selected as a consequence of harboring the wild-type Trp53. Because LOH occurred in the tumor, it is important to acknowledge that genomic imprinting effects might play a role in the mechanism of tumorigenesis. In this regard, it is noteworthy that chromosome 11 harbors imprinted genes. Mice with two maternal and no paternal copies of the proximal region of chromosome 11 showed differential fetal growth (Cattanach et al., 1996
). Two imprinted genes mapped to the proximal region of chromosome 11, Meg1Grb10 and U2af1rsl (Cattanach et al., 1998
; Miyoshi et al., 1998
). Nf1, for which there is evidence of monoallelic expression in humans (Stephens et al., 1992
), mapped to 46.06 cM, near Trp53. Nf1 is a positive regulator of Trp53 (Furlong et al., 1996
; Ginsberg et al., 1990
) and a negative regulator of ras (Bollag et al., 1996
). Loss of Nf1 may have a critical role in ras-induced cellular proliferation in the thymus. Again, we consider the loss of Trp53 to be most significant. Yet, a role for monoallelic expression could not specifically be ruled out.
Comparisons between the occurrence of spontaneous tumors in p53 (/) and (+/) mice on a C57BL/6x129Sv background and on a 129Sv background were previously reported (Donehower et al., 1995
; Harvey et al., 1993
). Lymphomagenesis was most frequent in both strains and may not show strain specificity due to the rapid development of immune competence of the thymus. The Trp53-dependent requirement of the thymus for eliminating aberrant recombinants through programmed cell death might predispose the thymus for induction of a neoplasia (Lowe et al., 1993
). In this regard, lymphomagenesis was attributed to loss of Trp53 rather than to differences in genetic background. Therefore, the short time-to-tumor-development observed in the phenolphthalein study was most likely directly attributable to the loss of Trp53 and the clastogenic action of phenolphthalein rather than to genetic background.
The heterozygosity we observed on chromosome 11 should not be stable in the p53-deficient strain. The window of heterozygosity is expected to decrease to close proximity of the Trp53 locus with every C57BL/6 backcross as the differential chromosomal segment recedes (Silver, 1995
). The study mice were reported to be N5 offspring of female inbred C57BL/6 mice and allelotyping data were inconsistent in this regard. This inconsistency was unresolved. However, similar inconsistency was found in the benzene and p-cresidine studies, therefore breeding errors seem unlikely. It is important to emphasize that recombination was detected in nontumor tissues in all three studies. One possible explanation is that heretofore undescribed embryonic recombination events, perhaps related to p53 haploinsufficiency, occurred. This possibility and the possibility of p53 haploinsufficiency-related environmental susceptibilities are currently under investigation.
| ACKNOWLEDGMENTS |
|---|
We acknowledge the excellent technical support of Mary Kovarik, Sherry Levandowski, Tanya Schill, Jamie Hanrahan, Isaac Grindeland, Sam Rodriguez, Elena Rodgers, and Robin Adams-Hays at the University of North Dakota School of Medicine and Health Sciences. Expert review and advice from Drs. Norman Drinkwater, University of Wisconsin, and Roger Wiseman, the National Institute of Environmental Health Sciences, were invaluable. This project was funded through NIH grant 5-P20RR11817-03 and the NIEHS Division of Intramural Research (ES21207-05).
| NOTES |
|---|
1 To whom correspondence should be addressed at National Institute of Environmental Health Sciences, National Institutes of Health, 111 T. W. Alexander Drive, Box 12233, F1-05, Research Triangle Park, NC, 27709. Fax: (919) 541-1460. E-mail: hulla{at}niehs.nih.gov.
| REFERENCES |
|---|
|
|
|---|
Andervont, H. B., and Edgcomb, J. H. (1956). Responses of seven inbred strains of mice to percutaneous applications of 3-methylcholanthrene. J. Natl. Cancer Inst. 17, 481495.
Bentvelzen, P., Daams, J. H., Hageman, P., and Calafat, J. (1970). Genetic transmission of viruses that incite mammary tumors in mice. Proc. Natl. Acad. Sci. U.S.A. 67, 377384.
Bollag, G., Clapp, D. W., Shih, S., Adler, F., Zhang, Y. Y., Thompson, P., Lange, B. J., Freedman, M. H., McCormick, F., Jacks, T., and Shannon, K. (1996). Loss of NF1 results in activation of the Ras signaling pathway and leads to aberrant growth in haematopoietic cells. Nat. Genet. 12, 144148.[Web of Science][Medline]
Bonin, A. M., Farquharson, J. B., and Baker, R. S. (1981). Mutagenicity of arylmethane dyes in Salmonella Mutat. Res. 89, 2134.
Cattanach, B. M., Beechey, C. V., Rasberry, C., Jones, J., and Papworth, D. (1996). Time of initiation and site of action of the mouse chromosome 11 imprinting effects. Genet. Res. 68, 3544.[Web of Science][Medline]
Cattanach, B. M., Shibata, H., Hayashizaki, Y., Townsend, K. M., Ball, S., and Beechey, C. V. (1998). Association of a redefined proximal mouse chromosome 11 imprinting region and U2afbp-rs/U2af1-rs1 expression. Cytogenet. Cell Genet. 80, 4147.[Web of Science][Medline]
Collins, B. J., Grizzle, T. B., and Dunnick, J. K. (2000). Toxicokinetics of phenolphthalein in male and female rats and mice. Toxicol. Sci. 56, 271281.
Donehower, L. A., Harvey, M., Slagle, B. L., Mcarthur, M. J., Montgomery, C. A., Jr., Butel, J. S., and Bradley, A. (1992). Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215221.[Medline]
Donehower, L. A., Harvey, M., Vogel, H., McArthur, M. J., Montgomery, C. A., Jr., Park, S. H., Thompson, T., Ford, R. J., and Bradley, A. (1995). Effects of genetic background on tumorigenesis in p53-deficient mice. Mol. Carcinog. 14, 1622.[Web of Science][Medline]
Dunnick, J. K., and Hailey, J. R. (1996). Phenolphthalein exposure causes multiple carcinogenic effects in experimental model systems. Cancer Res. 56, 49224926.
Dunnick, J. K., Hardisty, J. F., Herbert, R. A., Seely, J. C., Furedi-Machacek, E. M., Foley, J. F., Lacks, G. D., Stasiewicz, S., and French, J. E. (1997). Phenolphthalein induces thymic lymphomas accompanied by loss of the p53 wild type allele in heterozygous p53-deficient (+/) mice. Toxicol. Pathol. 25, 533540.
Evans, J. T., Hauschka, T. S., and Mittelman, A. (1974). Differential susceptibility of four mouse strains to induction of multiple large-bowel neoplasms by 1,2,-dimethylhydrazine. J. Natl. Cancer Inst. 52, 9991000.
Evans, J. T., Shows, T. B., Sproul, E. E., Paolini, N. S., Mittelman, A., and Hauschka, T. S. (1977). Genetics of colon carcinogenesis in mice treated with 1, 2-dimethylhydrazine. Cancer Res. 37, 134136.
Flaks, A. (1968). The susceptibility of various strains of neonatal mice to the carcinogenic effects of 9,10-dimethyl-1,2-benzanthracene. Eur. J. Cancer 4, 579585.
Fujita, H., Mizuo, A., and Hiraga, H. (1976). Mutagenicity of dyes in the microbial system. Ann. Rep. Tokyo Metr. Res. Lab. PH27-2, 153158.
Furlong, E. E., Rein, T., and Martin, F. (1996). YY1 and NF1 both activate the human p53 promoter by alternatively binding to a composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. Mol. Cell Biol. 16, 59335945.[Abstract]
Ginsberg, D., Oren, M., Yaniv, M., and Piette, J. (1990). Protein-binding elements in the promoter region of the mouse p53 gene. Oncogene 5, 12851290.[Web of Science][Medline]
Griffin, R. J., Godfrey, V. B., and Burka, L. T. (1998). Metabolism and disposition of phenolphthalein in male and female F344 rats and B6C3F1 mice. Toxicol. Sci. 42, 7381.
Harvey, M., McArthur, M. J., Montgomery, C. A., Jr., Bradley, A., and Donehower, L. A. (1993). Genetic background alters the spectrum of tumors that develop in p53-deficient mice. FASEB J. 7, 938943.[Abstract]
Hulla, J. E., French, J. E., and Dunnick, J. K. (2001). Chromosome 11 allelotypes reflect a mechanism of chemical carcinogenesis in heterozygous p53-deficient mice. Carcinogenesis 22, 8998.
Kada, T., Tutikawa, K., and Sadaie, Y. (1972). In vitro and host-mediated "rec-assay" procedures for screening chemical mutagens; and phloxine, a mutagenic red dye detected. Mutat. Res. 16, 165174.[Web of Science][Medline]
Lowe, S. W., Schmitt, E. M., Smith, S. W., Osborne, B. A., and Jacks, T. (1993). p53 is required for radiation-induced apoptosis in mouse thymocytes. Nature 362, 847849.[Medline]
Miyoshi, N., Kuroiwa, Y., Kohda, T., Shitara, H., Yonekawa, H., Kawabe, T., Hasegawa, H., Barton, S. C., Surani, M. A., Kaneko-Ishino, T., and Ishino, F. (1998). Identification of the Meg1/Grb10 imprinted gene on mouse proximal chromosome 11, a candidate for the Silver-Russell syndrome gene. Proc. Natl. Acad. Sci. U.S.A. 95, 11021107.
Mortelmans, K., Haworth, S., Lawlor, T., Speck, W., Tainer, B., and Zeiger, E. (1986). Salmonella mutagenicity tests: II. Results from the testing of 270 chemicals. Environ. Mutagen. 8(Suppl. 7), 1119
Mouse Genome Informatics Resource (May, 1999) http://www.informatics.jax.org/. The Jackson Laboratory, Bar Harbor, Maine.
NTP. United States National Toxicology Program. (1996). Toxicology and Carcinogenesis Studies of Phenolphthalein (CAS No. 77-09-8) in F344/N Rats and B6C3F1 Mice (Feed Studies). Rprt No. 465.
Sato, S., Takizawa, H., and Inui, N. (1993). Mouse strain differences in induction of micronuclei by base analogues and nucleosides. Mutat. Res. 301, 4549.[Web of Science][Medline]
Silver, L. (1995). Mouse Genetics. Oxford University Press, New York.
Simpson, E. M., Linder, C. C., Sargent, E. E., Davisson, M. T., Mobraaten, L. E., and Sharp, J. J. (1997). Genetic variation among 129 substrains and its importance for targeted mutagenesis in mice. Nat. Genet. 16, 1927.[Web of Science][Medline]
Stephens, K., Kayes, L., Riccardi, V. M., Rising, M., Sybert, V. P., and Pagon, R. A. (1992). Preferential mutation of the neurofibromatosis type 1 gene in paternally derived chromosomes. Hum. Genet. 88, 279282.[Web of Science][Medline]
Tice, R. R., Furedi-Machacek, M., Satterfield, D., Udumudi, A., Vasquez, M., and Dunnick, J. K. (1998). Measurement of micronucleated erythrocytes and DNA damage during chronic ingestion of phenolphthalein in transgenic female mice heterozygous for the p53 gene. Environ. Mol. Mutagen. 31, 113124.[Web of Science][Medline]
Tsutsui, T., Tamura, Y., Yagi, E., Hasegawa, K., Tanaka, Y., Uehama, A., Someya, T., Hamaguchi, F., Yamamoto, H., and Barrett, J. C. (1997). Cell-transforming activity and genotoxicity of phenolphthalein in cultured Syrian hamster embryo cells. Int. J. Cancer 73, 697701.[Web of Science][Medline]
U.S. FDA. United States Food and Drug Administration. (1997). U.S. Food and Drug Administration laxative drug products for over-the-counter human use; proposed amendment to the tentative final rule [Docket No. 78N036L]. Fed. Regist. 62, 4622346227.
Weber, J. L. (1989). Length polymorphisms in (dC-dA)-n(dG-dT)n sequences detected using the polymerase chain reaction. In Current Communications in Molecular BiologyPolymerase Chain Reaction (H. A. Erlich, R. Gibbs, and H. H. Kazazian, Jr., Eds.), pp. 141146. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Witt, K. L., Gulati, D. K., Kaur, P., and Shelby, M. D. (1995). Phenolphthalein: Induction of micronucleated erythrocytes in mice. Mutat Res. 341, 151160.[Web of Science][Medline]
Zakut-Houri, R., Oren, M., Bienz, B., Lavie, V., Hazum, S., and Givol, D. (1983). A single gene and a pseudogene for the cellular tumour antigen p53. Nature 306, 594597.[Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Karlsson, P. Soderkvist, and S.-M. Zhuang Point Mutations and Deletions in the Znfn1a1/Ikaros Gene in Chemically Induced Murine Lymphomas Cancer Res., May 1, 2002; 62(9): 2650 - 2653. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. French, R. D. Storer, and L. A. Donehower The Nature of the Heterozygous Trp53 Knockout Model for Identifi cation of Mutagenic Carcinogens Toxicol Pathol, January 1, 2001; 29(1_suppl): 24 - 29. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




