Toxicological Sciences 62, 46-53 (2001)
Copyright © 2001 by the Society of Toxicology
ENDOCRINE TOXICOLOGY |
In Utero and Lactational Treatment with 2,3,7,8-Tetrachlorodibenzo-p-dioxin Impairs Mammary Gland Differentiation but Does Not Block the Response to Exogenous Estrogen in the Postpubertal Female Rat
,2

,3
* Institute of Human Virology, Division of Infectious Diseases, Department of Medicine,
Departments of Epidemiology and Preventive Medicine, and
Physiology, University of Maryland Medical School, Baltimore Maryland 21201; and
School of Pharmacy and Environmental Toxicology Center, University of Wisconsin, Madison, Wisconsin 53706
Received December 22, 2000; accepted March 19, 2001
| ABSTRACT |
|---|
|
|
|---|
These experiments tested whether in utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters mammary gland differentiation, estrogen receptor
(ER
) expression levels, or the response to estrogen in the female postpubertal rat mammary gland. Pregnant Holtzman rats were administered a single oral dose of 1 µg/kg TCDD or vehicle on gestation-day 15. Exposed and non-exposed female offspring were weaned on postnatal day 21 and ovariectomized at 9 weeks of age. Two weeks later, both TCDD and control animals were divided into 3 groups, receiving treatment with placebo, 0.025, or 0.1 mg 17ß-estradiol pellet implants. After 48 h, mammary tissue was removed for analysis following euthanasia. TCDD-exposed mammary glands demonstrated impaired differentiation as measured by the distribution of terminal ductal structures and increased expression levels of ER
. The response to exogenous estrogen was tested in TCDD-exposed animals and compared to control non-exposed animals. Estrogen stimulation of the TCDD-exposed glands induced progesterone receptor expression and mammary gland differentiation as measured by a shift in distribution from terminal end buds and terminal ducts to Types I and II lobules. Control glands were better differentiated at baseline and did not exhibit any significant changes in the distribution of terminal ductal structures following estrogen stimulation. The increase in progesterone receptor-expression levels by exogenous estrogen in control glands was similar to the TCDD-exposed glands. These experiments demonstrate that in utero and lactational exposures to TCDD impair mammary gland differentiation but that TCDD-exposed mammary glands retain the ability to differentiate in response to estrogen.
Key Words: TCDD; estrogen receptor
; mammary gland; in utero and lactational exposure; differentiation..
| INTRODUCTION |
|---|
|
|
|---|
This study was initiated to test whether in utero and lactational TCDD exposures impaired mammary gland differentiation, altered expression levels of estrogen receptor alpha (ER
), or modified the response to estrogen in the postpubertal female rat mammary gland.
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is an aryl hydrocarbon receptor (AhR) agonist with direct anti-estrogenic action in mammary epithelial cells (Safe et al., 1991
, 1998
). AhR is expressed in the mammary gland and acute exposure to either 2,3,7,8-tetrachlorodibenzofuran (TCDF) (Hushka et al., 1998
) or TCDD (Brown and Lamartiniere, 1995
) suppresses lobule development. In utero exposure to TCDD results in altered development of hormonally responsive tissues including prostate (Roman and Peterson, 1998
; Roman et al., 1995
, 1998
), testes (Barthold et al. 1999
; Sommer et al., 1996
), epididymis (Barthold et al. 1999
), vagina (Flaws et al., 1997
; Gray and Ostby 1995
; Gray et al., 1997
), and mammary gland (Brown et al., 1998
; Youngblood et al., 2000
). Increased expression levels of ER
have been reported in testes (Barthold et al. 1999
), hypothalamus, uterus, and ovary (Chaffin et al. 1996
; Chaffin et al., 1997
).
In the mammary gland, the percentage of epithelial cells expressing ER
changes with hormonally induced differentiation. Less-well differentiated structures such as terminal end buds (TEBs) exhibit a higher percentage of ER
-expressing cells (Fendrick et al., 1998
; Russo et al. 1999
; Russo and Russo, 1978
). The percentage of mammary epithelial cells expressing ER
decreases as terminal end buds differentiate into lobular structures.
The study demonstrates that expression levels of ER
are increased in postpubertal mammary glands following in utero and lactational TCDD exposure, and that this is correlated with impaired mammary gland differentiation. Significantly, the response to exogenous estrogen was not impaired by in utero and lactational TCDD exposure.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animals and treatments.
Twenty-one timed pregnant Holtzman rats were obtained from Harlan Sprague-Dawley (Madison, WI) and housed at the University of Wisconsin School of Pharmacy facility. Dams were housed individually in clear plastic cages (41 x 20 x 20) containing aspen-chip bedding and maintained on a 12-h light/dark cycle under temperature control (22 ± 1°C). Rat Chow 5012, Purina Mills (St. Louis, MO) and tap water were provided ad libitum. All procedures involving animals were approved by the Institutional Animal Use and Care Committees of the University of Wisconsin and the University of Maryland, in accordance with The Guiding Principles in the Use of Animals in Toxicology (Society of Toxicology, 1995).
On gestational day (GD) 15, 12 rats were administered 1 µg TCDD/kg (98% purity, Cambridge Isotope Laboratories, Woburn, MA) as a single oral gavage dose (2 ml/kg) and 9 control rats received an equivalent volume of vehicle (Wesson corn oil/acetone, 19/1, v/v). All dams were weighed daily and visually inspected until delivery. After parturition at postnatal day (PND) 0, the live pups were counted and sexed. On PND 1, pups were toe-clipped and numerically marked. The litters were adjusted to 5 males and 5 females to enable similar nutritional and lactational exposure to TCDD for all pups.
The offspring were weaned on PND 21 and housed with littermates, 2 to 3 animals per cage, in wire-bottomed stainless-steel cages. Male pups were terminated for experiments reported elsewhere. Female pups were transferred to the University of Maryland Animal Care Facility where they were housed on a 12-h light/dark cycle under temperature control (22 ± 1°C), 2 to 3 animals per clear plastic cage (41 x 20 x 20) containing aspen-chip bedding. Rat Chow 5012, Purina Mills (St. Louis, MO, USA) and tap water were provided ad libitum.
At nine weeks of age, the female offspring were ovariectomized under anesthesia (DePaolo et al. 1981
; Hirshfield 1989
). At eleven weeks of age, both the TCDD-exposed and control non-exposed, ovariectomized female offspring were divided into 3 groups. Each group was composed of pups from different litters. A maximum of one pup per litter was represented in each group. Group 1 was treated with an implant containing 0.1 mg 17ß-estradiol (Innovative Research of America, Sarasota, FL) placed under the dorsal hind skin (TCDD exposure: n = 9; Control: n = 7). Group 2 were treated with an implant containing 0.025 mg 17ß-estradiol (Innovative Research) placed under the dorsal hind skin (TCDD exposure: n = 9; Control: n = 7). Group 3 were treated with a placebo implant (Innovative Research) placed under the dorsal hind skin (TCDD exposure: n = 11; Control: n = 6). The total number of rats analyzed was 37. After 48 h, the rats were euthanized by decapitation and one of the fourth mammary glands removed at the time of necropsy. The mammary tissue removed was divided into 3 portions. One portion was frozen at 70°C and stored for protein and RNA assays, one portion was fixed in 10% neutral formalin and embedded in paraffin for sectioning, and the third portion was taken for whole-mount analysis. Equivalent representative portions of each gland were taken from each animal for analysis of structural differentiation, RNA, and histology. Whole mounts were performed on the caudal portion of the gland.
Mammary gland whole mounts and structural differentiation.
Each mammary gland specimen was spread on a glass slide and fixed in Carnoy's solution (100% ethanol:chloroform:glacial acetic acid, 6:3:1) for 60 min at room temperature. Following fixation, the glands were washed with 70% ethanol for 15 min, followed by a wash with distilled H2O for 5 min. The staining of the glands was performed in carmine alum (1 g carmine; Sigma Chemical Co., St. Louis, MO) and 2.5 g aluminum potassium sulfate [Sigma] in 500 ml H2O) at 4°C overnight. The tissues were then dehydrated and mounted on glass slides. The whole mounts were examined at 10 x and the total number of terminal-end buds (TEB), terminal ducts (TD), and Lobules I and II were determined for each whole mount (Brown et al., 1998
; Russo and Russo, 1978
). Structural differentiation was determined by calculating the percentage of ductal structures ending in terminal end buds (Fig. 1A
), terminal ducts (Fig. 1B
), lobules I (Fig. 1C
) and Lobules II (Fig. 1D
). Terminal end buds differentiate into Lobules I and II. A poorly differentiated gland demonstrates a higher percentage of terminal end buds as compared to Lobules I and II. A better-differentiated gland demonstrates a lower percentage of terminal end buds and terminal ducts as compared to Lobules I and II. Terminal end buds are composed of 36 layers of closely packed mammary epithelial cells and exhibit a rounded appearance at the end of a duct. Terminal ducts have a smaller diameter and are only 2 cell layers thick. Terminal ducts form from terminal end buds that do not differentiate into Lobules I and II and instead exhibit progressive hypoplasia. Lobules I and II are groups of alveoli around a main duct. Lobules II exhibit more extensive alveolar growth and are larger, fuller structures than Lobules I (Russo and Russo, 1978
). Means ± SE were calculated. Tests for normality were applied and the data was not normally distributed. Kruskal-Wallis tests were performed to determine the statistical significance of observed differences; p < 0.05 was considered significant.
|
Analysis of ER
, Progesterone Receptor (PR), and ß-actin mRNA expression levels.Total RNA was isolated from frozen mammary gland tissue using acid-guanidium thiocyanate-phenol-chloroform extraction (Chomczynski et al., 1987) and quantified on a spectrophotometer. First-strand cDNA was generated using a 20 µl reaction volume containing 1 µg RNA, 200 units Superscript RNase H reverse transcriptase (Gibco BRL, Grand Island, NY), 1 mM dithiothreitol (DTT), 0.5 mM each dNTP, and 500 ng random hexamers in Superscript RNase H reverse transcriptase buffer. Total RNA was primed with random hexamers for 10 min. at 70°C, followed by a synthesis time of 60 min at 37°C. After the reaction, the final volume was increased to 100 µl by the addition of distilled water. Polymerase chain reaction (PCR) was performed in a fluorescence rapid cycler (LightCycler LC24, Idaho Technology, Idaho Falls, ID) with 7-µl reactions (Morrison et al., 1998
and PR in each sample were determined by dividing their calculated copy numbers by those of ß-actin. Semi-quantitative RT-PCR was performed using a standard thermocycler (Touchdown, Hybaid, Ltd.) as described previously (Koos, 1995
, sense: GATCCTTCTAGACCCTTCAGTG and antisense: CTTCCAGAGACTTCAAGGTGCT (55°C annealing temperature; 419 bp); PR, sense: CATGTCAGTGGACAGATGCT and antisense: ACTTCAGACATCATTTCCGG (53°C annealing temperature; 400 bp); and ß-actin, sense: TACAACCTCCTTGCAGCTCC and antisense: GGATCTTCATGAGGTAGTCTGTC (54°C annealing temperature; 630 bp). Means ± SE were determined for ER
and PR. Tests for normality were applied. The data for ER
were transformed to correct for heterogeneity of variance and then analyzed by a one-way ANOVA; Dunnett's test was used in the post hoc analysis; p < 0.05 was considered significant. The data for PR was not normally distributed and could not be transformed to correct for heterogeneity of variance. Kruskal-Wallis tests were performed to determine the statistical significance of observed differences; p < 0.05 was considered significant.
Analysis of ER
and ß-actin protein expression levels.
Tissue was homogenized in lysis buffer using a Polytron and cellular proteins were extracted utilizing RIPA buffer (PBS, 1% NP40, 5% sodium deoxycholate, 0.1% SDS) with protease inhibitors PMSF, aprotinin, and sodium orthovanadate, and fractionated on an SDS-polyacrylamide gel as described previously (Li et al., 2000
). Proteins were transferred onto NOVEX PVDF membranes using a NOVEX Western Transfer Apparatus. After transfer and blocking with buffer (5% non-fat milk, 10 mM Tris pH 7.5, 100 mM NaCl, 1% Tween 20) for 1 h at room temperature (RT), the membranes were exposed to a 1:400 dilution of an antibody directed against ER
(NCL-ER-6511, Novo Castra, Burlingame, CA) for 1 h. This was followed by incubation with the appropriate horseradish peroxidase-conjugated antibody at a dilution of 1:2000 (sc-2005, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 1 h at RT. ER
was visualized using ECL (Amersham, Arlington Heights, IL). The membrane was then washed and reprobed with a 1:500 dilution of antibody directed against ß-actin (sc-1616, Santa Cruz Biotechnology, Inc.) for 1 h, followed by incubation with the appropriate horseradish peroxidase-conjugated antibody at a dilution of 1:5000 (sc-2020, Santa Cruz Biotechnology Inc.) for 1 h. ß-actin was visualized using ECL.
Ki67 immunohistochemistry and in situ detection of apoptosis.
Tissue was fixed in 10% neutral formalin solution and embedded in paraffin using routine methods (Li et al., 2000
). Five-micron sections were prepared for hematoxylin and eosin (H&E) staining, Ki67 immunohistochemistry, and in situ detection of apoptosis. For Ki67 immunohistochemistry, sections were deparaffinized, rehydrated with decreasing concentrations of ethanol, quenched in 3% hydrogen peroxide for 5 min, digested with Auto/Zyme buffer (Biomeda, Foster City, CA) at 37°C for 30 min, equilibrated with buffer, incubated with anti-Ki67 antigen/horseradish peroxidase (HRP) (Dako, Carpinteria, CA) for 1 h at RT, and washed with 1x Tris buffered saline (TBS). Color was developed for 15 min using 3,3'-dimethylaminoazobenzene peroxidase substrate (Sigma) diluted in 5 ml sterile H2O. Sections were counterstained with methyl green. The percentage of cells with Ki67-stained nuclei was determined by counting labeled and unlabeled mammary epithelial cell nuclei. Sections from 4 different, randomly chosen mammary glands from each treatment group were analyzed. A minimum of 1000 cells was counted for each mammary gland. Means ± SE were determined. Apoptotic cell nuclei were identified using the ApopTag kit (Oncor, Gaithersburg, MD) as described previously (Li et al., 1996
). The same glands utilized for Ki67 staining were tested for the presence of apoptotic cells. The percentage of apoptotic cells was determined by counting labeled and unlabeled mammary epithelial cells. A minimum of 1000 cells was counted for each animal.
| RESULTS |
|---|
|
|
|---|
In utero and lactational TCDD exposure impaired structural differentiation of the mammary gland.
Differentiation of terminal ductal structures in the mammary gland is marked by a shift from terminal end buds to Lobules I and II, which result from differentiation of terminal end buds into alveolar structures. TCDD-exposed glands demonstrated a significantly higher percentage of terminal end buds (p = 0.006) and terminal ducts (p = 0.005) and a lower percentage of Lobules I and II (p = 0.007) as compared to control glands (Table 1
|
Steady state ER
expression levels were increased in the mammary glands of postpubertal ovariectomized rats following in utero and lactational exposure to TCDD.Expression levels of ER
mRNA and protein were increased significantly in the TCDD-exposed mammary glands of the postpubertal ovariectomized rats (Fig. 2
mRNA in total RNA extracted from 7 TCDD-exposed and 6 control mammary glands treated with a placebo pellet for 48 h (Fig. 2A
mRNA ± SE in TCDD-exposed mammary glands was 1.83 ± 0.95 as compared to 0.08 ± 0.03 in control non-exposed glands (p = 0.006). Increased ER
mRNA expression levels were also found when 1 µg of total RNA was utilized as the starting material for semi-quantitative RT-PCR, using a standard thermocycler (Fig. 2B
protein expression levels were 2.3-fold higher in the mammary glands from the TCDD-exposed rats as compared to the glands from control rats (Fig. 2C
|
Exogenous estrogen induced differentiation of terminal ductal structures in TCDD-exposed mammary glands.
Treatment with 0.1 mg 17ß-estradiol induced differentiation of terminal ductal structures in the TCDD-exposed mammary glands, where the mean percentage of Lobules I and II was increased from 75 ± 4 to 90 ± 4 by 0.1 mg 17ß-estradiol (p = 0.029) (Fig. 3A
|
|
Exogenous estrogen induced expression of progesterone receptor in both TCDD-exposed and control mammary glands.
Estrogen treatment induces progesterone receptor (PR) expression in mammary epithelial cells (Fendrick et al., 1998
mRNA. Treatment with a 0.025-mg 17ß-estradiol pellet for 48 h significantly increased relative mean PR mRNA expression levels in both TCDD-exposed and non-exposed control mammary glands as compared to no estrogen treatment (Table 2
|
There was no significant difference in mammary epithelial cell proliferation between control and TCDD exposed glands after estrogen treatment.
Estrogen treatment increases mammary epithelial cell proliferation in estrogen deprived rodent mammary glands (Fendrick et al., 1998
|
|
In utero and lactational exposure to TCDD did not alter the rate of mammary epithelial cell apoptosis in either the placebo-treated or estrogen-treated glands.
In situ detection of apoptosis was performed to determine if TCDD exposure altered the rate of apoptotic cell death, either in the absence or presence of estrogen treatment. The percentage of mammary epithelial cells undergoing apoptosis was calculated by counting the number of labeled and unlabeled cells within a total population of 1000 cells from randomly chosen sections within each treatment group. Only rare apoptotic cells were found ineither the control or TCDD-exposed glands. There was no change in the apoptotic rate following estrogen treatment (data not shown).
| DISCUSSION |
|---|
|
|
|---|
This study demonstrates that in utero and lactational exposure to TCDD alters mammary gland differentiation, as has been reported for the mammary gland following in utero exposure alone (Brown et al. 1998
are increased in the TCDD-exposed glands.
TCDD is reported to exert anti-estrogenic effects on mammary epithelial cells (Caruso et al. 1999
; Kharat and Saatcioglu 1996
; Safe 1995
; Tian et al. 1998
; Wormke et al., 2000
). The impaired differentiation observed in this experiment is consistent with an anti-estrogenic effect. In the mouse, expression of ER
in stroma cells is required for normal mammary gland development although expression in mammary epithelial cells is dispensable (Bocchinfuso and Korach, 1997
). Reciprocal mammary gland transplant experiments have demonstrated that mammary epithelial cells exposed to TCDD in utero develop normally when transplanted to the fat pad of a non-exposed rat, but that non-exposed mammary epithelial cells transplanted to a fat pad exposed to TCDD in utero grow more slowly. The resulting gland appears underdeveloped, suggesting that TCDD may be able to act on mammary epithelial cells through the stroma (Youngblood et al., 2000
). These experiments do not exclude possible systemic effects with secondary effects on the mammary gland. However, hypothalamic-pituitarygonadal hormonal cyclicity has been described as normal in gestationally exposed animals and normal serum FSH, LH, progesterone, androstenedione and estrogen levels are reported (Chaffin et al., 1996
, 1997
; Flaws et al., 1997
; Gray et al. 1997
; Heimler et al., 1998
; Wolf et al., 1999
).
The TCDD-exposed glands were capable of responding to estrogen stimulation with both increased expression levels of PR and glandular differentiation. The glands were not rendered permanently refractory to the effects of estrogen by TCDD exposure. This implies that it is possible for a gestationally exposed gland to recover at least some normal differentiation with hormonal stimulation. The increase in ER
expression levels in the whole gland may simply be a reflection of the increased percentage of terminal end buds found in the less differentiated TCDD-exposed glands. Alternatively, the anti-estrogenic activity of TCDD may have increased expression levels of ER
in the stroma, as has been reported in ovariectomized, postmenopausal mice (Fendrick et al., 1998
). It is important to note that susceptibility to chemical carcinogenesis in rats is linked to the number of terminal end buds present in the gland (Brown et al., 1998
; Lamartiniere et al., 1995
; Murrill et al., 1996
; Russo and Russo, 1978
, 1996
). The increased numbers of terminal end buds found after in utero TCDD exposure appears to render the animals more susceptible to chemical carcinogenesis as shown by Brown et al. (1998).
It is not known if in utero or lactational TCDD exposure alters mammary gland differentiation in humans. Potential effects on susceptibility to carcinogenesis in humans are debated. However, the experiments presented here lay the foundation for a molecular understanding of the effect of TCDD exposure on the developing mammary gland. They identify the mammary gland as a potential target organ for TCDD exposure but illustrate that it still can respond normally to estrogen stimulation, at least in the short term. In the rat model, a next step would be to determine if hormonally induced differentiation would protect the TCDD-exposed gland from chemical carcinogenesis and normalize ER
expression levels. For human studies, it is necessary to determine if mammary gland differentiation is impaired or ER
expression levels altered by TCDD exposure to the developing mammary gland. If any changes are found, it will be most important to establish if the alterations are fixed or if hormonal exposure through estrous cycling, pregnancy, or exogenous sources can normalize the differences.
In summary, mammary gland differentiation was impaired by in utero and lactational exposure to TCDD in the rat. ER
expression levels were increased. Exposure to exogenous estrogen induced progesterone-receptor expression and -differentiation of the terminal ductal structures in the TCDD-exposed glands, demonstrating that the glands were not refractory to estrogen stimulation.
| ACKNOWLEDGMENTS |
|---|
This manuscript is dedicated to the memory of Bernadette C. Lewis. The work was supported in parts by a grant from the University of Maryland Women's Health Research to P.A.F., by NIH CA68033 to P.A.F., ES01332 to R.P., and a Veterans Administration grant to J.A.F.
| NOTES |
|---|
1 Now deceased.
2 Present address: Bates College, Department of Biology, Lewiston, ME 04240. ![]()
3 To whom correspondence should be addressed at the Institute of Human Virology, University of Maryland Medical School, 725 West Lombard Street, Room N545, Baltimore, MD 21201. Fax: (410) 706-1992. E-mail: furth{at}umbi.umd.edu. ![]()
Portions of this work were presented in preliminary form at the annual meetings of the Society of Toxicology in 1999, New Orleans, LA, and 2000, Philadelphia, PA.
| REFERENCES |
|---|
|
|
|---|
Barthold, J. S., Kryger, J. V., Derusha, A. M., Duel, B. P., Jednak, R., and Skafar, D. F. (1999). Effects of an environmental endocrine disruptor on fetal development, estrogen receptor (alpha) and epidermal growth factor expression in the porcine male genital tract. J. Urol. 162, 864871.[Web of Science][Medline]
Brown, N. M., and Lamartiniere, C. A. (1995). Xenoestrogens alter mammary gland differentiation and cell proliferation in the rat. Environ. Health Perspect. 103, 708713[Web of Science][Medline]
Brown, N. M., Manzolillo, P. A., Zhang, J.-X., Wang, J., and Lamartiniere, C. A. (1998). Prenatal TCDD and predisposition to mammary cancer in the rat. Carcinogenesis 19, 16231629.
Bocchinfuso, W. P., and Korach, K. S. (1997). Mammary gland development and tumorigenesis in estrogen receptor knockout mice. J. Mammary Gland Biol. Neoplasia 2, 323334.[Medline]
Caruso, J. A., Laird, D. W., and Batist, G. (1999). Role of HSP90 in mediating cross-talk between the estrogen receptor and the Ah receptor signal transduction pathways. Biochem. Pharmacol. 58, 13951403.[Web of Science][Medline]
Chaffin, C. L., Peterson, R. E., and Hutz, R. J. (1996). In utero and lactational exposure of female Holtzman rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Modulation of the estrogen signal. Biol. Reprod. 55, 6267.[Abstract]
Chaffin, C. L., Trewin, A. L., Watanabe, G., Taya, K., and Hutz, R. J. (1997). Alterations to the pituitary-gonadal axis in the peripubertal female rat exposed in utero and through lactation to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Biol. Reprod. 56, 14981502.[Abstract]
Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156159[Web of Science][Medline]
DePaolo, L. V., Anderson, L. D., and Hirshfield, A. N. (1981). Possible existence of a long-loop feedback system between FSH and inhibin in female rats. Am. J. Physiol. 240, E544549.
Fendrick, J. L., Raafat, A. M., and Haslam, S. Z. (1998). Mammary gland growth and development from the postnatal period to postmenopause: Ovarian steroid receptor ontogeny and regulation in the mouse. Mammary Gland Biology and Neoplasia 3, 722.
Flaws, J. A., Sommer, R. J., Silbergeld, E. K., Peterson, R. E., and Hirshfield, A. N. (1997). In utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) induces genital dysmorphogenesis in the female rat. Toxicol. Appl. Pharmacol. 147, 351362.[Web of Science][Medline]
Gray, L. E., Jr., and Ostby, J. S. (1995). In utero 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters reproductive morphology and function in female rat offspring. Toxicol. Appl. Pharmacol. 133, 285294.[Web of Science][Medline]
Gray, L. E., Wolf, C., Mann, P., and Ostby, J. S. (1997). In utero exposure to low doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin alters reproductive development of female Long-Evans hooded rat offspring. Toxicol. Appl. Pharmacol. 146, 237244.[Web of Science][Medline]
Heimler, I., Trewin, A. L., Chaffin, C. L., Rawlins, R. G., and Hutz, R. J. (1998). Modulation of ovarian follicle maturation and effects on apoptotic cell death in Holtzman rats exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in utero and lactationally. Reprod. Toxicol. 12, 6973.[Web of Science][Medline]
Hirshfield, A. N. (1989). Rescue of atretic follicles in vitro and in vivo. Biol. Reprod. 40, 181190.[Abstract]
Hushka, L. J., Williams, J. S., and Greenlee, W. F. (1998). Characterization of 2,3,7,8-tetrachlorodibenzofuran-dependent suppression and AH receptor pathway gene expression in the developing mouse mammary gland. Toxicol. Appl. Pharmacol. 152, 200210.[Web of Science][Medline]
Kharat, I., and Saatcioglu, F. (1996). Antiestrogenic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin are mediated by direct transcriptional interference with the liganded estrogen receptor. Cross-talk between aryl hydrocarbon- and estrogen-mediated signaling. J. Biol. Chem. 271, 1053310537.
Koos, R. (1995). Increased expression of vascular endothelial growth/permeability factor in the rat ovary following an ovulatory gonadotropin stimulus: Potential roles in follicle rupture. Biol. Reprod. 52, 14261435.[Abstract]
Lamartiniere, C. A., Morre, J. B., Brown, N. M., Thompson, R., Hardin, M. J., and Barnes, S. (1995). Genistein suppresses mammary cancer in rats. Carcinogenesis 16, 28332840.
Li, M., Hu, J., Heermeier, K., Hennighausen, L., and Furth, P. A. (1996). Apoptosis and remodeling of the mammary gland tissue during involution proceeds through p53-independent pathways. Cell Growth Diff. 7, 1320.[Abstract]
Li, M., Lewis, B., Capuco, A. V., Laucirica, R., and Furth, P. A. (2000). WAP-TAg transgenic mice and the study of dysregulated cell survival, proliferation, and mutation during breast carcinogenesis. Oncogene 19, 10101019.[Web of Science][Medline]
Morrison, T. B., Weis, J. J., and Wittwer, C. T. (1998). Quantification of low-copy transcripts by continuous SYBR green I monitoring during amplification. Biotechniques 24, 954958.[Web of Science][Medline]
Murrill, W. B., Brown, N. M., Zhang, J.-X., Manzolillo, P. M., Barnes, S., and Lamartiniere, C. A. (1996). Prepubertal genistein exposure suppresses mammary cancer and enhances gland differentiation in rats. Carcinogenesis 17, 14511457.
Roman, B. L., and Peterson, R. E. (1998). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin impairs prostate development: 1. Effects on gene expression. Toxicol. Appl. Pharmacol. 150, 240253.[Web of Science][Medline]
Roman, B. L., Sommer R. J., Shinomiya K., and Peterson R. E. (1995). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Impaired prostate growth and development without inhibited androgen production. Toxicol Appl. Pharmacol. 134, 241250.[Web of Science][Medline]
Roman, B. L., Timms, B. G., Prins, G. S., and Peterson, R. E. (1998). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin impairs prostate development: 2. Effects on growth and cytodifferentiation. Toxicol. Appl. Pharmacol. 150, 254270.[Web of Science][Medline]
Russo, J., Ao, X., Grill, C., and Russo, I. H. (1999). Pattern of distribution of cells positive for estrogen receptor alpha and progesterone receptor in relation to proliferating cells in the mammary gland. Breast Cancer Res. Treat. 53, 217227.[Web of Science][Medline]
Russo, J., and Russo, I. H. (1978). DNA labeling index and structure of the rat mammary gland as determinants of its susceptibility to carcinogenesis. J. Natl. Cancer Inst. 61, 14511459.
Russo, I. H., and Russo, J. (1996). Mammary gland neoplasia in long-term rodent studies. Environ. Health Perspect. 104, 938967.[Web of Science][Medline]
Safe, S. (1995). Modulation of gene expression and endocrine response pathways by 2,3,7,8-tetrachlorodibenzo-p-dioxin and related compounds. Pharmacol. Ther. 67,247281.[Web of Science][Medline]
Safe, S., Astroff, B., Harris, M., Zacharewski, T., Dickerson, R., Romkes, M., and Biegel, L. (1991). 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related compounds as antiestrogens: Characterization and mechanism of action. Pharmacol. Toxicol. 69, 400409.[Web of Science][Medline]
Safe, S., Wang F., Porter W., Duan R., and McDougal A. (1998). Ah receptor agonists as endocrine disruptors: Antiestrogenic activity and mechanisms. Toxicol. Lett. 102103, 343347.
Sommer, R. J., Ippolito, D. L., and Peterson, R. E. (1996). In utero and lactational exposure of the male Holtzman rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Decreased epididymal and ejaculated sperm numbers without alterations in sperm transit rate. Toxicol. Appl. Pharmacol. 140,146153.[Web of Science][Medline]
Tian, Y., Ke, S., Thomas, T., Meeker, R. J., and Gallo, M. A. (1998). Transcriptional suppression of estrogen receptor gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). J. Steroid Biochem. Mol. Biol. 67, 1724.[Web of Science][Medline]
Wolf, C. J., Ostby, J. S., and Gray, L. E., Jr. (1999). Gestational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) severely alters reproductive function of female hamster offspring. Toxicol. Sci. 2, 259264.
Wormke, M., Stoner, M., Saville, B., and Safe, S. (2000). Cross-talk between estrogen receptor alpha and the aryl hydrocarbon receptor in breast cancer cells involves unidirectional activation of proteosomes. FEBS Lett. 478, 109112.[Web of Science][Medline]
Youngblood, G. L., Hamm, J. T., Birnbaum, L. S., and Fenton, S. E. (2000). Gestational exposure of Long-Evans rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) leads to stunted mammary epithelial development in female offspring. Toxicologist 54, 637A.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
B. J. Lew, L. L. Collins, M. A. O'Reilly, and B. P. Lawrence Activation of the Aryl Hydrocarbon Receptor during Different Critical Windows in Pregnancy Alters Mammary Epithelial Cell Proliferation and Differentiation Toxicol. Sci., September 1, 2009; 111(1): 151 - 162. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Andreasen, L. K. Mathew, C. V. Lohr, R. Hasson, and R. L. Tanguay Aryl Hydrocarbon Receptor Activation Impairs Extracellular Matrix Remodeling during Zebra Fish fin Regeneration Toxicol. Sci., January 1, 2007; 95(1): 215 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Fenton Endocrine-Disrupting Compounds and Mammary Gland Development: Early Exposure and Later Life Consequences Endocrinology, June 1, 2006; 147(6): s18 - s24. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Vorderstrasse, S. E. Fenton, A. A. Bohn, J. A. Cundiff, and B. P. Lawrence A Novel Effect of Dioxin: Exposure during Pregnancy Severely Impairs Mammary Gland Differentiation Toxicol. Sci., April 1, 2004; 78(2): 248 - 257. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Krig, R. A. S. Chandraratna, M. M. J. Chang, R. Wu, and R. H. Rice Gene-Specific TCDD Suppression of RAR{alpha}- and RXR-Mediated Induction of Tissue Transglutaminase Toxicol. Sci., July 1, 2002; 68(1): 102 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Fenton, J. T. Hamm, L. S. Birnbaum, and G. L. Youngblood Persistent Abnormalities in the Rat Mammary Gland following Gestational and Lactational Exposure to 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Toxicol. Sci., May 1, 2002; 67(1): 63 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Capuco, M. Li, E. Long, S. Ren, K. S. Hruska, K. Schorr, and P. A. Furth Concurrent Pregnancy Retards Mammary Involution: Effects on Apoptosis and Proliferation of the Mammary Epithelium after Forced Weaning of Mice Biol Reprod, May 1, 2002; 66(5): 1471 - 1476. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







