Toxicological Sciences 66, 233-243 (2002)
Copyright © 2002 by the Society of Toxicology
MOLECULAR AND GENETIC TOXICOLOGY |
Acetaminophen-Induced Proliferation of Estrogen-Responsive Breast Cancer Cells Is Associated with Increases in c-myc RNA Expression and NF-
B Activity

,1
* Department of Biochemistry and Molecular Pharmacology and
Department of Community Medicine, West Virginia University, Morgantown, West Virginia; and
National Institute of Occupational Safety and Health, Health Effects Laboratory Division, Morgantown, West Virginia
Received July 16, 2001; accepted October 29, 2001
| ABSTRACT |
|---|
|
|
|---|
Studies reported here tested the hypothesis that acetaminophen stimulates proliferation of E2-responsive cells by inducing expression of E2-regulated genes. Ribonuclease protection assays compared the effects of acetaminophen and E2 on expression of selected genes (c-myc, c-fos, cyclin D1, bcl-2, bax, gadd45, mcl-1, p53, p21CIP1/WAF1, and bcl-xL) in E2-responsive breast cancer (MCF-7) and endometrial adenocarcinoma (Ishikawa) cells as well as in E2-nonresponsive (MDA-MB-231) breast cancer cells. Acetaminophen and E2 increased c-myc RNA levels in MCF-7 cells, consistent with a mitogenic activity of these compounds in MCF-7 cells. However, the magnitude and time course of acetaminophen and E2 induction of c-myc differed. Neither acetaminophen nor E2 induced c-myc in MDA-MB-231 cells, whereas E2, but not acetaminophen, weakly induced c-myc expression in Ishikawa cells. Furthermore, in these 3 cell types, the expression patterns of the other genes differed dramatically in response to acetaminophen and to E2, indicating that acetaminophen does not activate ER as a transcription factor in the same manner as does E2. Additionally, gel shift assays demonstrated that in MCF-7 cells, acetaminophen increased NF-
B activity
40% and did not alter AP-1 activity, whereas E2 increased AP-1 activity
50% and did not increase NF-B activity. These studies indicate that acetaminophen effects on gene expression and cell proliferation depend more on cell type/context than on the presence of ER.
Key Words: acetaminophen; estrogen receptor; c-myc gene; NF-
B; cell cycle.
| INTRODUCTION |
|---|
|
|
|---|
Acetaminophen is a commonly used analgesic and antipyretic drug that is present in >850 over-the-counter and prescription formulas (Prescott, 1996
In vitro studies indicate acetaminophen can exert different effects on E2-mediated responses in various E2-responsive cells. In trout liver cells and Ishikawa endometrial adenocarcinoma cells, acetaminophen inhibits E2-dependent vitellogenin production (Miller et al., 1999
) and E2 induction of alkaline phosphatase activity (Dowdy et al., 2000
), respectively. In contrast, acetaminophen stimulates proliferation of MCF-7, T47-D, and ZR-571 E2-responsive breast cancer cells, but not MDA-MB-231 E2-nonresponsive breast cancer cells (Harnagea-Theophilus and Miller, 1998
; Harnagea-Theophilus et al., 1999b
). Furthermore, antiestrogens inhibit acetaminophen-induced proliferation of E2-responsive cells (Harnagea-Theophilus et al., 1999a
), suggesting the estrogen receptor (ER) is involved in acetaminophen-induced breast cancer cell proliferation. However, acetaminophen does not compete with E2 for binding ER (Dowdy et al. 2000
; Harnagea-Theophilus et al., 1999a
; Isenhower et al., 1986
; Miller et al., 1999
), indicating that acetaminophen does not directly interact with the ER in the same manner as E2 and also indicating that acetaminophen-induced proliferation of these cells may not be mediated by ER. Therefore, acetaminophen may alter some ER-mediated processes in breast cancer cells by binding the ER at a different site than E2, or by a ligand-independent mechanism. For instance, the ER can be transcriptionally activated in the absence of E2 by cross talk with other signal-transduction pathways. This can occur via cAMP activation of protein kinase A (El-Tanani and Green, 1997
), growth factor pathways (Aronica and Katzenellenbogen, 1993
; El-Tanani and Green, 1997
; Smith, 1998
), protein phosphatase inhibitors (Bunone et al., 1996
), and protein kinase-C activators (Le Goff et al., 1994
).
The present study tested the hypothesis that acetaminophen stimulates proliferation of E2-responsive cancer cells by inducing expression of E2-regulated genes. The effects of acetaminophen and E2 on expression of endogenous genes involved in cell proliferation/cell survival (c-myc, c-fos, cyclin D1, bcl-2, bax, p21CIP1/WAF1, p53, gadd45, mcl-1, and bcl-xL) were examined by ribonuclease protection assays in MCF-7 and MDA-MB-231 breast cancer cells and in Ishikawa endometrial adenocarcinoma cells. Whereas MCF-7 cells express high levels of ER
and low levels of ERß, MDA-MB-231 cells do not express ER
but express low levels of an ERß splice variant (Fuqua et al., 1999
; Vladusic et al., 2000
). On the other hand, Ishikawa cells express both ER
and ERß (Bhat and Pezzuto, 2001
). Therefore, these studies examine the effects of acetaminophen in 3 different ER-containing cell lines. In MCF-7 cells, E2 directly induces the c-myc and c-fos proto-oncogenes via an estrogen response element (ERE) half site adjacent to an Sp1 site in the c-myc promoter region (Dubik and Shiu, 1992
), and via an imperfect ERE in the promoter region of c-fos (Weisz and Rosales, 1990
). The importance of c-myc expression in breast cancer cell proliferation is indicated by the observation that E2-induced proliferation of MCF-7 cells is inhibited by an antisense c-myc oligonucleotide (Watson et al., 1991
). Therefore, if acetaminophen-induced proliferation of E2-responsive breast cancer cells occurs via a similar mechanism to E2-induced proliferation, the c-myc gene is a likely target of acetaminophen action. Cyclin D1 is directly responsive to E2 in MCF-7 cells, although the E2-responsive region in the cyclin D1 promoter contains an AP-1 element but not an ERE (Altucci et al., 1996
). E2 induces expression of the antiapoptotic gene bcl-2 (Dong et al., 1999
; Leung and Wang, 1999
; Perillo et al., 2000
; Teixeira et al., 1995
). The tumor suppressor protein, p53, is E2-responsive in T47-D breast cancer cells (Hurd et al., 1995
, 1997
, 1999
); and the cell cycle-arrest gene, p21, appears to be E2-responsive in normal breast epithelial tissue (Thomas et al., 1998
). Conflicting reports have appeared on the effect of E2 on apoptosis-related genes bcl-xL (Kandouz et al., 1999
; Leung et al., 1999) and bax (Kandouz et al., 1999
; Teixeira et al., 1995
). Although not reported to be E2-responsive, this study also determined the effects of acetaminophen and E2 on expression of gadd45 and mcl-1, a cell-cycle arrest gene and an antiapoptotic member of the bcl-2 family, respectively. The expression of all of these genes was examined in the E2-nonresponsive breast cancer cell line, MDA-MB-231, as a negative control, as well as in E2-responsive endometrial adenocarcinoma (Ishikawa) cells. In Ishikawa cells, E2 weakly stimulates cell proliferation and strongly induces alkaline phosphatase activity (Holinka et al., 1986
), whereas acetaminophen inhibits E2-induced alkaline-phosphatase activity, indicating that acetaminophen may have antiestrogenic effects in these cells (Dowdy et al., 2000
). Therefore, the effects of E2 and acetaminophen, alone and in combination, were determined on the expression of the aforementioned genes in Ishikawa cells.
In addition, the effect of acetaminophen was determined on 2 transcription factors, NF-
B and AP-1. Data reported herein show that acetaminophen increases c-myc RNA in MCF-7 breast cancer cells, and NF-
B is a known regulator of the c-myc promoter in MCF-7 cells (Sovak et al., 1997
). Therefore, NF-
B was investigated as a possible mediator of acetaminophen-induced c-myc RNA expression in MCF-7 cells. Studies also determined if acetaminophen altered AP-1 activity in MCF-7 cells, because E2-bound ER interacts with AP-1 to promote transcription of AP-1-regulated genes (Webb et al., 1995
, 1999
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
MCF-7 (E2-responsive) cells were obtained from the American Type Culture Collection (Manassas, VA). Dr. Mary Wolff (Department of Community and Preventative Medicine, Mount Sinai School of Medicine) kindly provided Ishikawa cells. MDA-MB-231 (E2-nonresponsive) cells were a gift from Dr. Jeannine Strobl (Department of Pharmacology and Toxicology, West Virginia University). Dulbecco's Modified Eagle's Medium (DMEM) ± phenol red, fetal bovine serum (FBS), glutamine, and gentamicin were purchased from BioWhitaker (Walkersville, MD). DNA probes for electrophoretic mobility shift assays (EMSAs) were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). Ready-To-Go Polynucleotide Kinase Kit and G50 micro columns were purchased from Amersham Pharmacia Biotech (Piscataway, NJ). DNA templates for c-myc, glyceraldehydes 3-phosphate dehydrogenase (GAPDH), 18S rRNA, and RPA II kits, were purchased from Ambion (Austin, TX). DNA templates for c-fos, bcl-2, cyclin D1, bcl-xL, bax, gadd45, p53, p21CIP1/WAF1, mcl-1, and L32 were purchased from BD Pharmingen (San Diego, CA). Acetaminophen, acrylamide, urea, and trypsin were purchased from Sigma Co. (St. Louis, MO). Corning tissue flasks (75 cm2) and disposable sterile pipettes were purchased from Fisher Scientific (Pittsburgh, PA). 32P-UTP (800 mCi/mmol) was purchased from ICN Pharmaceuticals (Costa Mesa, CA). 32P-ATP (800 mCi/mmol) was purchased from Amersham (Piscataway, NJ).
Cell culture conditions.
MCF-7, MDA-MB-231, and Ishikawa cells were routinely maintained in Dulbecco's Modified Eagle's Medium supplemented with 10% fetal bovine serum (FBS) and gentamicin (DMEM). Cells were kept at 37°C with 10% CO2. The medium was changed every 2 days, and cells were passed once a week, or as needed, to prevent them from reaching confluence.
Experimental conditions.
For RNA extraction, MCF-7 cell cultures that were approximately 6070% confluent were placed in phenol red-free DMEM supplemented with 2% E2-free FBS and gentamicin (PRF-DMEM). E2-free FBS was prepared by the charcoal-dextran procedure (Strobl et al, 1994
). MCF-7 cells were kept in PRF-DMEM for 4 days, with one medium change on day 2, to deplete cells of residual estrogens. On day 4, the flasks were separated into 3 groups, which received PRF-DMEM containing (1) no additions (negative control); (2) 3 nM E2 (positive control); or (3) 0.3 mM acetaminophen, with duplicate flasks in each group. This concentration of acetaminophen maximally stimulated MCF-7 breast cancer cell proliferation (Harnagea-Theophilus and Miller, 1998
). MDA-MB-231 cells, which were 5060% confluent, were placed in PRF-DMEM. Cells were kept in PRF-DMEM for 2 days with one medium change on day 1. MDA-MB-231 cells were kept in PRF-DMEM for 2 days instead of 4, because these cells do not tolerate PRF-DMEM for extended periods of time. On day 2, the cells were treated with acetaminophen or E2, as described for MCF-7 cells. Ishikawa cells were maintained in phenol red-free Ham's F12 (DMEM [1:1], 5% E2-free FBS [EFBM]) for 28 weeks prior to experiments. Ishikawa cells become more E2-responsive after culture in E2-free medium for several weeks (Mary Wolff, personal communication). For experiments, Ishikawa cells that were
85% confluent were divided into 6 groups that received EFBM, containing (1) no additions (negative control); (2) 3 nM E2 (positive control); (3) 0.3 mM acetaminophen; (4) 0.1 mM acetaminophen; (5) 3 nM E2 + 0.3 mM acetaminophen; or (6) 3 nM E2 + 0.1 mM acetaminophen.
For extraction of nuclear transcription factors, MCF-7 or MDA-MB-231 cells were plated into 100-mm dishes in DMEM with 10% FBS. Cells were placed in PRF-DMEM when they reached 6070% confluence. Cells were kept in PRF-DMEM for 4 days, and were then treated with 3 nM E2, 0.3 mM acetaminophen, 3 mM acetaminophen, or 10 mM acetaminophen, with duplicate dishes in each group.
Ribonuclease protection assays (RPAs).
Total cellular RNA was isolated at indicated times after addition of compounds to each cell line, using the Chomczynski protocol (Chomczynski and Sacchi, 1987
). RPAs were performed using 32P-labeled riboprobes for c-myc, GAPDH, and 18S rRNA (Ambion) or c-fos, cyclin D1, bcl-xL, bax, bcl-2, gadd45, p53, p21CIP1/WAF1, mcl-1, L32, and GAPDH (Pharmingen). 32P-labeled riboprobes were generated using Ambion's MAXIscript kit, and were gel purified (c-myc, GAPDH, and 18S) or extracted with phenol (chloroform [c-fos, cyclin D1, bcl-xL, bax, bcl-2, gadd45, p53, p21CIP1/WAF1, mcl-1, L32, and GAPDH). Fifteen µg of cellular RNA was incubated with 70,000120,000 cpm of labeled riboprobe, and RPAs were performed according to the manufacturer's protocol. Protected fragments were separated on 8 M urea, 5% polyacrylamide gels were electrophoresed at 250 volts for 12 h. Gels were exposed to a phosphorimage screen overnight, visualized using a Molecular Dynamics phosphorimager, and bands were quantified using ImageQuant software. RNAs of constitutively expressed genes not affected by E2 (GAPDH mRNA, and L32 or 18S rRNAs) were used as internal controls for RNA loading. Specific genes in E2- and acetaminophen-treated cells were then normalized to negative control values at corresponding time points. Negative control values were determined by taking the mean of duplicate samples. Values for E2- and acetaminophen-treated groups are reported relative to negative control (control = 1).
Nuclear extraction.
Cells were harvested for extraction of nuclear proteins at various times after addition of test compounds, as indicated. Cells were rinsed with cold PBS, scraped, collected by centrifugation, then resuspended in 300 µl lysis buffer (50 mM KCl, 0.5% IGEPAL CA-630, 25 mM HEPES, 10 µg/ml leupeptin, 20 µg/ml aprotinin, 125 µM dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF), transferred to a 1.5 ml eppendorf tube, and kept on ice for 4 min. Nuclei were collected by centrifugation (10,000 rpm, 10 min at 4°C), and washed in 300 µl washing buffer (50 mM KCl, 25 mM HEPES, 10 µg/ml leupeptin, 20 µg/ml aprotinin, 125 µM DTT, and 1 mM PMSF). Nuclei were pelleted (10,000 rpm, 1 min at 4°C), and resuspended in 30100 µl extraction buffer (500 mM KCl, 25 mM HEPES, 10% glycerol, 10 µg/ml leupeptin, 20 µg/ml aprotinin, 125 µM DTT, and 1 mM PMSF) for 20 min. The suspension was centrifuged (14,000 rpm, 2 min at 4°C), and the supernatant retained for EMSAs. Protein concentration was measured using the Bradford assay (Bradford, 1976
), and adjusted to 1 µg/µl in extraction buffer.
Electrophoretic Mobility Shift Assays (EMSAs)
DNA probe.
The following sequences were used for DNA probes: (1) 5'TGGGATTTTCCCATGAGTCT3' from the human IL-6 gene promoter contains a
B-binding site recognized by NF-
B; and (2) 5'ATGAGTCAGACACCTCTGG CTTTCTGGAAG3' from the human collagenase gene promoter contains an AP-1 binding site. Single-stranded, complementary DNA probes were renatured by heating at 90°C for 5 min and cooled slowly. Concentration was determined by OD260 and adjusted to 0.1 µg/µl with dH20. DNA probes were radiolabeled with 32P-
-ATP using a Ready-To-Go T4 Polynucleotide Kinase kit (Amersham), following the manufacturer's protocol. Labeled probe was purified using a G50 micro column (Amersham). Radioactivity of the recovered probe was determined by scintillation counting and adjusted to 20,00050,000 cpm/µl for EMSAs.
Assay.
EMSA reactions consisted of: 12 µl of 2x gel shift reaction buffer (12% glycerol, 24 mM HEPES, 8 mM TrisHCl, 2 mM EDTA, and 1 mM DTT), 1 µl of bovine serum albumin (3 µg/µl), 2 µl of Poly (dI-dC) (0.5 µg/µl), and 20,00050,000 cpm DNA probe. Lastly, 3 µg of nuclear extract and a sufficient volume of extraction buffer were added to give 5 µl total. Samples were incubated on ice for 20 min, loaded on a 4% polyacrylamide gel, and electrophoresed at 200 V for 11.5 h at 4°C. Gels were transferred to 3MM Whatman paper, dried under vacuum at 80°C for 1 h, and exposed overnight to either a phosphorimager screen or Kodak film. Shifted bands were quantified by phosphorimage analysis (Molecular Dynamics phosphorimager; ImageQuant software). Initial experiments established optimum conditions (concentrations of total salt, protein, and dI:dC) for transcription factor binding. The specificity of shifted oligonucleotides reflecting binding of NF-
B or AP-1 was determined by oligonucleotide competition experiments (NF-
B and AP-1 binding were compared with nonradioactive
B and AP-1 sequences, respectively, indicated above, but were not significantly different from oligonucleotides containing sites for binding p53 or YY1); and NF-
B binding was specifically disrupted by antibodies to the NF-
B subunit p65 (not shown).
Statistics.
All experiments were repeated 27 times, as indicated in figure legends and table titles.. Data were analyzed using ANOVA and post hoc Student's t-test. Data are expressed as mean ± SE. Means were considered statistically significant if p < 0.05.
| RESULTS |
|---|
|
|
|---|
The effects of E2 and acetaminophen on MCF-7 cell proliferation were assessed by measuring 3H-dT incorporation into DNA as described (Harnagea-Theophilus and Miller, 1998
E2 and acetaminophen induce c-myc RNA in MCF-7 cells.
The effects of acetaminophen and E2 on c-myc RNA expression were assayed in MCF-7 cells by RPAs. In Figure 1A
, a representative RPA gel is shown, demonstrating the effects of acetaminophen and E2 on c-myc RNA levels at 14 h and at 1 h, respectively. Figure 1B
summarizes the effects of acetaminophen and of E2 on c-myc RNA levels over 8-h and 2-h time periods, respectively. E2 induction of c-myc RNA followed a time course similar to those described in the literature (Dubik et al., 1987
, 1988); E2 maximally induced c-myc RNA 2.09 ± 0.13-fold at
1 h, and c-myc RNA fell to basal levels by 2 h (Fig. 1B
). In subsequent studies, the effect of 3 nM E2 on gene expression was measured at 1 h. Acetaminophen-mediated increases of c-myc RNA were somewhat more variable than those mediated by E2. Acetaminophen increased c-myc RNA 1.43 ± 0.19-fold 2 h after addition, and 1.47 ± 0.17-fold 4 h after addition (Fig. 1B
). Although c-myc RNA was elevated 6 h after acetaminophen addition, the increase was not significantly different from corresponding control levels. These data demonstrate that acetaminophen increases c-myc RNA levels in MCF-7 cells, although the time course and intensity of acetaminophen induction differs from E2-mediated induction.
|
E2 and acetaminophen do not induce c-myc RNA in MDA-MB-231 cells.
MDA-MB-231 breast cancer cells are not E2-responsive, and their proliferation is not stimulated by E2 or acetaminophen (Harnagea-Theophilus and Miller, 1998
|
E2, but not acetaminophen, weakly induces c-myc RNA in Ishikawa cells.
Ishikawa cells contain both ER
and ERß (Bhat and Pezzuto, 2001
|
E2 and acetaminophen differentially alter expression of other E2-regulated genes in MCF-7 cells.
Studies were then conducted to determine the extent to which acetaminophen alters expression of other E2-regulated genes in MCF-7 cells. Figure 3
1.2 to
1.7 fold) (Table 2
65% of control levels (Table 2
|
|
E2 and acetaminophen differentially alter expression of specific genes in MDA-MB-231 cells.
The effects of E2 and acetaminophen on expression of the same genes studied in MCF-7 cells were also determined in E2-nonresponsive MDA-MB-231 cells. Table 3
|
E2 and acetaminophen differentially alter expression of E2-regulated genes in Ishikawa cells.
To further determine the extent to which acetaminophen may alter E2-regulated gene expression in Ishikawa cells, the effects of E2 (3 nM) and acetaminophen (0.1 or 0.3 mM) alone, and in combination, were determined on the expression of the same endogenous genes examined in breast cancer cells. In Ishikawa cells, 3 nM E2 consistently increased c-fos RNA levels by
1.4 fold at 4 days, consistent with reports in the literature (Fujimoto et al., 1996
1.7-fold at 4 days, 0.1 mM acetaminophen (a nontoxic concentration) did not significantly increase c-fos RNA above control levels. The addition of both acetaminophen (0.1 and 0.3 mM) and E2 to Ishikawa cells resulted in small (
1.5-fold) but significant increases in c-fos RNA (Table 1
1.5-fold increases in the RNAs from the bcl-xL, p53, p21CIP1/WAF1, and bcl-2 genes (Table 1
Acetaminophen induces NF-
B activity in MCF-7 cells.
Because NF-
B can regulate c-myc RNA expression in MCF-7 cells (Sovak et al., 1997
), electrophoretic mobility shift assays (EMSAs) were used to examine the potential correlation between acetaminophen-induced c-myc RNA levels and NF-
B transcription factor activation. In addition to assessing the effect of 0.3 mM acetaminophen on NF-
B binding, the effects of high concentrations of acetaminophen (3 and 10 mM) on NF-
B binding in MCF-7 cells were also examined, because these concentrations inhibited growth factor-induced cell proliferation, NF-
B DNA binding, c-myc expression, and raf kinase activation in Hepa1-6 liver cells (Boulares et al., 1999
). Similar high concentrations of acetaminophen also abolished NF-
B activity in a variety of other cell types (Blazka et al., 1996
; Pumford and Halmes, 1997
; Rannug et al., 1995
). As shown in Figure 4
, NF-
B is strongly induced by the addition of 10% fetal bovine serum to MCF-7 cells, consistent with other reports (Boulares et al., 1999
). NF-
B is not significantly altered relative to untreated cells in response to 3 nM E2 (0.94 ± 0.29), or high concentrations (3 and 10 mM) of acetaminophen (1.06 ± 0.38 and 1.07 ± .42, respectively; Fig. 4
), and these high concentrations of acetaminophen did not alter the serum induction of NF-
B (not shown). However, 0.3 mM acetaminophen resulted in a 1.4-fold increase in NF-
B DNA binding, relative to untreated MCF-7 cells, 90 min after addition (Fig. 4
). In addition, EMSAs were performed to establish a time course (17 h) of 0.3 mM acetaminophen induction of NF-
B in MCF-7 cells. No detectable alterations in NF-
B binding were observed within 60 min of acetaminophen treatment, maximum binding was induced after 90 min, NF-
B binding decreased to 20% above control level after 4 h (not significantly different from control), and binding returned to control levels by 7 h after acetaminophen addition (not shown). In contrast, treating MDA-MB-231 cells with 3 or 10 mM acetaminophen for 90 min significantly reduced NF-
B binding to
60% of the binding in control cells, while 0.3 mM acetaminophen reduced NF-
B binding 14%, but this was not significantly different from NF-
B binding in control cells.
|
AP-1 EMSAs were conducted to determine if acetaminophen activates AP-1 DNA binding in a manner similar to that of E2. These studies demonstrated that 90 min after E2 addition to MCF-7 cells, AP-1 binding was increased
50%, consistent with other reports (Chen et al., 1996
|
| DISCUSSION |
|---|
|
|
|---|
This report deals with the potential of acetaminophen to alter ER-mediated processes in 3 different ER-containing cells. We tested the hypothesis that acetaminophen induces proliferation of E2-responsive breast cancer cells by inducing expression of E2-regulated mitogenic genes. Although E2 and acetaminophen both stimulate c-myc RNA expression in MCF-7 cells, consistent with a mitogenic response, these compounds exhibit both different time courses and intensities of c-myc RNA induction. E2 induces c-myc RNA
2-fold at 1 h while acetaminophen induces c-myc RNA at
1.45-fold at 24 h (Fig. 1
30 min (Shiu et al., 1993
2 h. Therefore, acetaminophen appears to increase c-myc RNA in MCF-7 cells by a different mechanism than E2, such as induction of a signal cascade, indirect activation of a transcription factor or stabilization of c-myc RNA. The effect of the antiestrogen ICI182,780 on acetaminophen induction of c-myc RNA was investigated in an attempt to determine if ER was involved in acetaminophen elevation of c-myc RNA; however, results were inconclusive, in part due to ICI182,780 reduction of basal c-myc RNA and to the low level of acetaminophen induction of MCF-7 cell c-myc RNA. As expected, E2 had no effect on c-myc RNA expression in E2-nonresponsive MDA-MB-231 breast cancer cells, while acetaminophen significantly reduced c-myc RNA levels at 1 and 2 h, consistent with the fact that MDA-MB-231 cells do not proliferate in response to E2 or acetaminophen (Harnagea-Theophilus et al., 1999a
While E2 and acetaminophen increased c-myc RNA levels in MCF-7 cells, these compounds elicited distinct patterns of expression on other genes, many of which are E2-responsive. E2 significantly induced cyclin D1, c-fos, bcl-2, p53, bax, bcl-xL, and gadd45 RNAs at 1 h, and induced bcl-2, bax, p53 and p21CIP1/WAF1 RNAs at 4 days (Fig. 3
and Table 2
), but acetaminophen did not significantly increase expression of any of these genes in the times examined (Fig. 3
and Table 2
). Furthermore, at 2 h, acetaminophen decreased levels of c-fos, bcl-xL, p21CIP1/WAF1, and mcl-1 RNAs (Fig. 3
and Table 2
), and decreased levels of bcl-xL RNA
35% after 4 days (Table 2
). ER transcriptionally regulates expression of c-myc, c-fos, cyclin D1, and bcl-2 at E2-responsive sites in their promoter regions (Altucci et al., 1996
; Dong et al., 1999
; Dubik and Shiu, 1992
; Weisz and Rosales, 1990
). The lack of c-fos, cyclin D1, and bcl-2 RNA induction by acetaminophen indicates that acetaminophen does not activate the ER as a transcription factor in a manner similar to E2. It is only possible to speculate on the different effects acetaminophen and E2 exert on the MCF-7 cell genes examined (Table 2
), relative to the mitogenic effects these 2 agents exert on these cells. Bcl-2 and bcl-xl are involved in both apoptosis and in cell cycle control; upregulation of bcl-2/xL is associated with inhibition of apoptosis (reviewed in Konopleva et al., 1999
) and with cell cycle arrest (Huang et al., 1997
; Mazel et al., 1996
; O'Reilly et al., 1996
), and bax antagonizes these bcl effects. E2 may regulate MCF-7 cell proliferation/survival in part by inducing sufficient levels of bax to counter the cell cycle arrest effects of bcl-2/xl. Acetaminophen may exert a similar effect on MCF-7 cell proliferation/survival by a different mechanism, by downregulating bcl-xl expression.
Acetaminophen and E2 also showed distinct patterns of gene alteration in another ER-containing cell line, Ishikawa cells. Although E2 significantly induced c-myc RNA
20% in Ishikawa cells, consistent with weak E2-induced proliferation of these cells (Holinka et al., 1986
); and acetaminophen slightly reduced c-myc RNA in these cells (Table 1
), consistent with acetaminophen decreasing proliferation of these cells (Dowdy et al., 2000
), the magnitudes of these alterations were very small. Both acetaminophen (0.3 mM) and E2 significantly induced c-fos RNA levels after 4 days of exposure (Table 1
). However, whereas E2 did not significantly alter any of the other RNAs assayed in these cells, 0.3 mM acetaminophen induced bcl-xL, p53, p21CIP1/WAF1, and bcl-2 RNAs (Table 1
). Because treatment with 0.3 mM acetaminophen for 4 days produces toxic effects in Ishikawa cells (Dowdy et al., 2000
), induction of these genes by 0.3 mM acetaminophen may indicate a toxic or apoptotic response. Interestingly, when 3 nM E2 and 0.3 mM acetaminophen are added together, levels of bcl-xL, p53, p21CIP1/WAF1 and bcl-2 return to control levels, indicating that E2 may oppose some acetaminophen effects in Ishikawa cells.
Other studies suggest a potential association between acetaminophen-induced c-myc RNA and activation of the NF-
B transcription factor in MCF-7 cells. Acetaminophen (0.3 mM) induced a
40% increase in NF-
B activity at 90 min (Fig. 4
), consistent with the time course of acetaminophen induction of c-myc RNA (24 h). Preliminary studies indicate the antiestrogen ICI 182,780 inhibits both acetaminophen-induced and basal NF-
B binding (not shown); the high sensitivity of acetaminophen-induced breast cancer cell proliferation to antiestrogens (Harnagea-Theophilus et. al., 1999a
) may therefore be attributed to inhibition of NF-
B rather than inhibition of ER function. Additionally, E2 did not alter NF-
B binding (Fig. 4
); however, E2 but not acetaminophen, induced AP-1 activity
50% at 90 min, consistent with the idea that E2 and acetaminophen act via distinct pathways in MCF-7 breast cancer cells. Furthermore, in ER-deficient MDA-MB-231 breast cancer cells, acetaminophen reduced NF-
B binding, especially at high concentrations (3 and 10 mM), consistent with other reports (Blazka et al., 1996
; Boulares et al., 1999
). The lack of inhibition of MCF-7 cell NF-
B binding by high concentrations of acetaminophen may be unique to this cell line, or to E2-responsive breast cancer cells.
The magnitudes of acetaminophen-induced NF-
B DNA binding and c-myc RNA expression are not robust but nonetheless may be important. The increases in c-myc RNA induced by E2 (100%) and acetaminophen (50%) (Fig. 1B
) are consistent with E2 inducing a larger mitogenic response than acetaminophen (Harnagea-Theophilus et al., 1999a
). Similarly, serum growth factors are potent mitogens that strongly induce NF-
B binding in MCF-7 cells (Fig. 4
and Biswas et al., 2000
), whereas acetaminophen is a weaker mitogen in breast cancer cells and induces smaller increases in NF-
B binding in these cells (Fig. 4
). Additionally, the magnitude of NF-
B activation by acetaminophen is very similar to the magnitude of E2-activation of AP-1 (Chen et al., 1996
; and Fig. 5
), a finding which is considered physiologically relevant.
Based on these studies, we conclude that acetaminophen does not mimic E2 in the 2 E2-responsive cell types, MCF-7 breast cancer cells and Ishikawa endometrial adenocarcinoma cells tested in this study. Although these studies do indicate that acetaminophen and E2 may exert partial mitogenic activity in MCF-7 breast cancer cells via a common target, the c-myc gene, the mechanism of c-myc induction by acetaminophen and E2 are different. Furthermore, studies in Ishikawa cells indicate that acetaminophen and E2 may have opposing effects on gene expression, consistent with previous data showing that acetaminophen inhibits E2-induced alkaline phosphatase activity in these cells (Dowdy et al., 2000
). Although previous studies indicated that acetaminophen-induced proliferation of E2-responsive breast cancer cells appears to involve the ER (Harnagea-Theophilus et al., 1999a
; Harnagea-Theophilus and Miller, 1998
), studies presented herein indicate that the effects of acetaminophen on gene expression or cell proliferation depend more on cell type/context than on the ER.
| ACKNOWLEDGMENTS |
|---|
This work was supported in part by grants from USPHS/OWH (IAA97-040), ACS (RPG-5706601-VM), WVU School of Medicine and Sigma Delta Epsilon Graduate Women in Science. We thank Dr. James Mahaney for critical review of the manuscript.
| NOTES |
|---|
1 To whom correspondence should be addressed at Robert C. Byrd Health Sciences Center, West Virginia University, P.O. Box 9142, Morgantown, WV 26506-9142. Fax: (304) 293-6846. E-mail: mmiller{at}hsc.wvu.edu.
| REFERENCES |
|---|
|
|
|---|
Altucci, L., Addeo, R., Cicatiello, L., Dauvois, S., Parker, M. G., Truss, M., Beato, M., Sica, V., Bresciani, F., and Weisz, A. (1996). 17ß-Estradiol induces cyclin D1 gene transcription, p36D1- p34cdk4 complex activation, and p105Rb phosphorylation during mitogenic stimulation of G1-arrested human breast cancer cells. Oncogene 12, 23152324.[Web of Science][Medline]
Aronica, S. M., and Katzenellenbogen, B. S. (1993). Stimulation of estrogen receptor-mediated transcription and alteration in the phosphorylation state of rat uterine estrogen receptor by estrogen, cyclic adenosine monophosphate, and insulin-like growth factor 1. Mol. Endocrinol. 7, 743752.
Bhat, K. P. L., and Pezzuto, J. M. (2001). Resveratrol exhibits cytostatic and antiestrogenic properties with human endometrial adenocarcinoma (Ishikawa) cells. Cancer Res. 61, 61376144.
Biswas, D. K., Cruz, A. P., Gansberger, E., and Pardee, A. B. (2000). Epidermal growth factor-induced nuclear factor
B activation: A major pathway of cell-cycle progression in estrogen-receptor negative breast cancer cells. Proc. Natl. Acad. Sci. U.S.A.. 97, 85428547.
Blazka, M. E., Germolec, D. R., Simeonova, P., Bruccoleri, A., Pennypacker, K. R., and Luster, M. I. (1996). Acetaminophen-induced hepatotoxicity is associated with early changes in NF-
B and NF-IL6 DNA binding activity. J. Inflamm. 47, 138150.
Boulares, H. A., Giardina, C., Navarro, C. L., Khairallah, E. A., and Cohen, S. D. (1999). Modulation of serum growth factor signal transduction in Hepa 16 cells by acetaminophen: An inhibition of c-myc expression, NF-
B activation, and Raf-1 kinase activity. Toxicol. Sci. 48, 264274.
Bradford, M. M. (1976). A rapid and sensitive method for quantitating microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248254.[Web of Science][Medline]
Bunone, G., Briand, P. A., Miksicek, R. J., and Picard, D. (1996). Activation of the unliganded estrogen receptor by EGF involves the MAP kinase pathway and direct phosphorylation. EMBO J. 15, 21742183.[Web of Science][Medline]
Chen, T. K., Smith, L. M., Gebhardt, D. K., Birrer, M. J., and Brown, P. H. (1996). Activation and inhibition of the AP-1 complex in human breast cancer cells. Mol. Carcinog. 15, 215226.[Web of Science][Medline]
Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156159.[Web of Science][Medline]
Cramer, D. W., Harlow, B. L., Titus-Ernstoff, L., Bohlke, K., Welch, W. R., and Greenberg, E. R. (1998a). Over-the-counter analgesics and risk of ovarian cancer. Lancet 351, 104107.[Web of Science][Medline]
Cramer, D. W., Liberman, R. F., Hornstein, M. D., McShane, P., Powers, D., Li. E. Y., and Barbieri, R. (1998b). Basal hormone levels in women who use acetaminophen for menstrual pain. Fertil. Steril. 70, 371373.[Web of Science][Medline]
Dong, L., Wang, W., Wang, F., Stoner, M., Reed, J. C., Harigai, M., Samudio, I., Kladde, M. P., Vyhlidal, C., and Safe, S. (1999). Mechanisms of transcriptional activation of bcl-2 gene expression by 17ß-estradiol in breast cancer cells. J. Biol. Chem. 274, 3209932107.
Dowdy, J., Gadd, S., Rhodes, S., and Miller, M. R. (2000). Acetaminophen alters estrogen receptor-regulated processes in different cells in a ligand-binding, independent manner. Toxicologist 54, 238239.
Dubik, D., Dembinski, T. C., and Shiu, R. P. (1987). Stimulation of c-myc oncogene expression associated with estrogen-induced proliferation of human breast cancer cells. Cancer Res. 47, 65176521.
Dubik, D., and Shiu, R. P. C. (1988). Transcriptional regulation of c-myc oncogene expression by estrogen in hormone-responsive human breast-cancer cells. J Biol. Chem. 263, 1270512708.
Dubik, D., and Shiu, R. P. C. (1992). Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 7, 15871594.[Web of Science][Medline]
El-Tanani, M. K. K., and Green, C. D. (1997). Two separate mechanisms for ligand-independent activation of the estrogen receptor. Mol. Endocrinol. 11, 928937.
Fujimoto, J., Hori, M., Ichigo, S., Morishita, S., and Tamaya, T. (1996). Estrogen induces expression of c-fos via activation of protein kinase C in an endometrial cancer cell line and fibroblasts derived from human uterine endometrium. Gynecol. Endocrinol. 10, 109118.[Web of Science][Medline]
Fuqua, S. A., Schiff, R., Parra, I., Friedrichs, W. E., Su, J. L., McKee, D. D., Slentz-Kesler, K., Moore, L. B., Wilson, T. M., and Moore, J. T. (1999). Expression of wild-type estrogen receptor beta and variant isoforms in human breast cancer. Cancer Res. 59, 54255428.
Harnagea-Theophilus, E., Gadd, S. L., Knight-Trent, A. H., DeGeorge, G. L., and Miller, M. R. (1999a). Acetaminophen-induced proliferation of breast cancer cells involves estrogen receptors. Toxicol. Appl. Pharmacol. 155, 273279.[Web of Science][Medline]
Harnagea-Theophilus, E., and Miller, M. R. (1998). Acetaminophen alters estrogenic responses in vitro: Stimulation of DNA synthesis in estrogen-responsive human breast cancer cells. Toxicol. Sci. 46, 3844.
Harnagea-Theophilus, E., Miller, M. R., and Rao, N. (1999b). Positional isomers of acetaminophen differentially induce proliferation of cultured breast cancer cells. Toxicol. Lett. 104, 1118.[Web of Science][Medline]
Harris, R. E., Kasbari, S., and Farrar, W. B. (1999). Prospective study of nonsteroidal anti-inflammatory drugs and breast cancer. Oncol. Rep. 6, 7173.[Web of Science][Medline]
Holinka, C. F., Hata, H., Kuramoto, H., and Gurpide, E. (1986). Effects of steroid hormones and antisteroids on alkaline phosphatase activity in human endometrial cancer cells (Ishikawa line). Cancer Res. 46, 27712774.
Hongslo, J. K., Bjorge, C., Schwarze, P. E., Brogger, A., Mann, G., Thelander, L., and Holme, J. A. (1990). Paracetamol inhibits replicative DNA synthesis and induces sister chromatid exchange and chromosomal abberations by inhibition of ribonucleotide reductase. Mutagenesis 5, 475480.
Huang, D. C. S., O'Reilly, L. A., Strasser, A., and Cory, S. (1997). The anti-apoptosis function of Bcl-2 can be genetically separated from its inhibitory effect on cell-cycle entry. EMBO J. 16, 46284638.[Web of Science][Medline]
Hurd, C., Dinda, S., Khattree, N., and Mougdil, V. K. (1999). Estrogen-dependent and -independent activation of the P1 promoter of the p53 gene in transiently transfected breast cancer cells. Oncogene 18, 10671072.[Web of Science][Medline]
Hurd, C., Khattree, N., Alban, P., Nag, K., Jhanwar, S. C., Dinda, S., and Moudgil, V. K. (1995). Hormonal regulation of the p53 tumor suppressor protein in T47D human breast carcinoma cell line. J. Biol. Chem. 270, 2850728510.
Hurd, C., Khattree, N., Dinda, S., Alban, P., and Moudgil, V. K. (1997). Regulation of tumor suppressor proteins, p53 and retinoblastoma, by estrogen and antiestrogens in breast cancer cells. Oncogene 15, 991995.[Web of Science][Medline]
Isenhower, W. D., Jr., Newbold, R. R., Cefalo, R. C., Korach, K. S., and McLachlan, J. A. (1986). Absence of estrogenic activity in some drugs commonly used during pregnancy. Biol. Res. Pregnancy Perinatol. 7, 610.[Web of Science][Medline]
Kandouz, M., Lombet, A., Perrot, J.-Y., Jacob, D., Carvajal, S., Kazem, A., Rostene, W., Therwath, A., and Gompel, A. (1999). Proapoptotic effects of antiestrogens, progestins, and androgen in breast cancer cells. J. Steroid Biochem. Mol. Biol. 69, 463471.[Web of Science][Medline]
Konopleva, M., Zhao, S., Xie, Z., Segall, H., Younes, A., Claxton, D. F., Estrov, Z., Kornblau, S. M., and Andreeff, M. (1999). Apoptosis. Molecules and mechanisms. Adv. Exp. Med. Biol. 457, 217236.[Web of Science][Medline]
Le Goff, P., Montano, M. M., Schodin, D. J., and Katzenellenbogen, B. S. (1994). Phosphorylation of the human estrogen receptor: Identification of hormone-regulated sites and examination of their influence on transcriptional activity. J. Biol. Chem. 269, 44584466.
Leung, L. K., and Wang, T. T. Y. (1999). Paradoxical regulation of bcl-2 family proteins by 17ß-estradiol in human breast cancer cells MCF-7. Br. J. Cancer 81, 387392.[Web of Science][Medline]
Mazel, S, Burtrum, D., and Petrie, H. T. (1996). Regulation of cell division-cycle progression by bcl-2 expression: A potential mechanism for inhibition of programmed cell death. J. Exp. Med. 183, 22192226.
Miller, M. R., Wentz, E., and Ong, S. (1999). Acetaminophen alters estrogenic responses in vitro: Inhibition of estrogen-dependent vitellogenin production in trout liver cells. Toxicol. Sci. 48, 3037.
O'Reilly, L. A., Huang, D. C. S., and Strasser, A. (1996). The cell-death inhibitor Bcl-2 and its homologues influence control of cell-cycle entry. EMBO J. 15, 69796990.[Web of Science][Medline]
Patel, R., and Rosengren, R. J. (2001). Acetaminophen elicits anti-estrogenic but not estrogenic responses in the immature mouse. Toxicol Lett. 122, 8996.[Web of Science][Medline]
Perillo, B., Sasso, A., Abbondanza, C., and Palumbo, G. (2000). 17ß-Estradiol inhibits apoptosis in MCF-7 cells, inducing bcl-2 expression via two estrogen-responsive elements present in the coding sequence. Mol. Cell. Biol. 20, 28902901.
Prescott, L. F. (1996). Paracetamol (Acetaminophen). A Critical Bibliographic Review. Taylor & Francis, Bristol, PA.
Pumford, N. R., and Halmes, N. C. (1997). Protein targets of xenobiotic reactive intermediates. Annu. Rev. Pharmacol. Toxicol. 37, 91117.[Web of Science][Medline]
Rannug, U., Holme, J. A., Hongslo, J. K., and Sram, R. (1995). An evaluation of the genetic toxicity of paracetamol. Mutat. Res. 327, 179200.[Web of Science][Medline]
Reel, J., Lawton, A. D., and Lamb, J. C., IV. (1992). Reproductive toxicity evaluation of acetaminophen in Swiss CD-1 mice, using a continuous breeding protocol. Fundam. Appl. Toxicol. 18, 233239.[Web of Science][Medline]
Sakakibara, K., Kan, N. C., and Satyaswaroop, P. G. (1992). Both 17-ß estradiol and tamoxifen induce c-fos messenger ribonucleic acid expression in human endometrial carcinoma grown in nude mice. Am. J. Obstet. Gynecol. 166, 206212.[Web of Science][Medline]
Shiu, R. P. C., Watson, P. H., and Dubik, D. (1993). C-myc oncogene expression in estrogen-dependent and -independent breast cancer. Clin. Chem. 39, 353355.[Abstract]
Smith, C. L. (1998). Crosstalk between peptide growth factor and estrogen receptor signaling pathways. Biol. Reprod. 58, 627632.
Sovak, M. A., Bellas, R. E., Kim, D. W., Zanieski, G. J., Rogers, A. E., Traish, A. M., and Sonenshein, G. E. (1997). Abberrant nuclear factor-
B/Rel expression and the pathogenesis of breast cancer. J. Clin. Invest. 100, 29522960.[Web of Science][Medline]
Strobl, J. S., Peterson, V. A., and Woodfork, K. A. (1994). A survey of human breast cancer sensitivity to growth inhibition by calmodulin antagonists in tissue culture. Biochem.. Pharmacol. 47, 21572161.[Web of Science][Medline]
Teixeira, C., Reed, J. C., and Pratt, M. A. C. (1995). Estrogen promotes chemotherapeutic drug resistance by a mechanism involving Bcl-2 proto-oncogene expression in human breast cancer cells. Cancer Res. 55, 39023907.
Thomas, T. J., Faaland, C. A., Adhikarakunnathu, S., Watkins, L. F., and Thomas, T. (1998). Induction of p21 (CIPI/WAF1/SID1) by estradiol in a breast epithelial-cell line transfected with the recombinant estrogen receptor gene: A possible mechanism for a negative regulatory role of estradiol. Breast Cancer Res. Treat. 47, 181193.[Web of Science][Medline]
Vladusic, E. A., Hornby, A. E., Guerra-Bladusic, F. K., Lakins, J., and Lupu, R. (2000) Expression and regulation of estrogen receptor ß in human breast tumors and cell lines. Oncol. Rep. 7, 157167.[Web of Science][Medline]
Watson, P., Pon, R. T., and Shiu, R. P. C. (1991). Inhibition of c-myc expression by phosphorothioate antisense oligonucleotide identifies a critical role for c-myc in the growth of human breast cancer. Cancer Res. 51, 39964000.
Webb, P., Lopez, G. N., Uht, R. M., and Kushner, P. J. (1995). Tamoxifen activation of the estrogen receptor/AP-1 pathway: Potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol. Endocrinol. 9, 443456.
Webb, P., Nguyen, P., Valentine, C., Lopez, G. N., Kwok, G., McInerney, E., Katzenellenbogen, B. S., Enmark, E., Gustafsson, J.-A., Nilsson, S., and Kushner, P. J. (1999). The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol. Endocrinol. 13, 16721685.
Weisz, A., and Rosales, R. (1990). Identification of an estrogen-response element upstream of the human c-fos gene that binds the estrogen receptor and the AP-1 transcription factor. Nucleic Acids Res. 18, 50975106.
Wiger, R., Finstad, H. S., Hongslo, J. K., Haug, K., and Holme, J. A. (1997). Paracetamol inhibits cell cycling and induces apoptosis in HL-60 cells. Pharmacol. Toxicol. 81, 285291.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. J. Bowman, N. J. Barlow, K. J. Turner, D. G. Wallace, and P. M. D. Foster Effects of in Utero Exposure to Finasteride on Androgen-Dependent Reproductive Development in the Male Rat Toxicol. Sci., August 1, 2003; 74(2): 393 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dowdy, S. Brower, and M. R. Miller Acetaminophen Exhibits Weak Antiestrogenic Activity in Human Endometrial Adenocarcinoma (Ishikawa) Cells Toxicol. Sci., March 1, 2003; 72(1): 57 - 65. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





