Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ohsako, S.
Right arrow Articles by Tohyama, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohsako, S.
Right arrow Articles by Tohyama, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Toxicological Sciences 66, 283-292 (2002)
Copyright © 2002 by the Society of Toxicology


REPRODUCTIVE AND DEVELOPMENTAL TOXICOLOGY

Developmental Stage-Specific Effects of Perinatal 2,3,7,8-Tetrachlorodibenzo-p-dioxin Exposure on Reproductive Organs of Male Rat Offspring

Seiichiroh Ohsako*,1, Yuichi Miyabara{dagger},§, Motoharu Sakaue*, Ryuta Ishimura*, Masaki Kakeyama, Hiroyuki Izumi,||, Junzo Yonemoto§ and Chiharu Tohyama{ddagger},§

* Molecular and Cellular Toxicology Section and {dagger} Biomarker Health Indicator Section, {ddagger} Environmental Health Sciences Division, § Endocrine Disruptors and Dioxin Research Project, National Institute for Environmental Studies, 16–2 Onogawa, Tsukuba 305-8506, Japan; CREST-JST, Kawaguchi, Saitama 332-0012, Japan; and || Panapharm Laboratories Company, Ltd., 1285 Kurisaki-machi, Uto 869-0425, Japan

Received August 17, 2001; accepted December 6, 2001


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Exposure to a relatively low dose of 2,3,7,8-tetrachlorodebenzo-p-dioxin (TCDD) during mid-gestation induces a reduction of ventral prostate weight in rat offspring. Recently we reported that a single administration of TCDD (12.5–800 ng/kg body weight) to pregnant Holtzman rats on gestational day (GD) 15 caused a decrease in androgen receptor (AR) mRNA level in the ventral prostate during the prepubertal period, and we proposed that this reduction of AR mRNA is one of the most sensitive adverse endpoints due to perinatal exposure to TCDD (S. Ohsako et al., 2001Go, Toxicol. Sci. 60, 132–143). In the present study, to investigate the mechanism of a decrease in AR mRNA level, we administered TCDD to rats at other developmental stages and compared possible alterations of the male reproductive system. Pregnant Sprague-Dawley rats were given a single oral dose of 1 µg TCDD/kg body weight on GD 15 or GD 18, or male pups born from untreated dams were subcutaneously given a single dose of 1 µg TCDD/kg body weight on postnatal day 2 (PND 2). Offspring exposed on GD 15, GD 18, and PND 2 were sacrificed on PND 70. TCDD exposure on GD 15 resulted in significant decreases in the urogenital complex and ventral prostate weights and urogenital-glans penis length of male rat offspring, but not on GD 18 and PND 2. Testicular and epididymal weights were also lower than control group only in the TCDD-exposed GD 15 group. Anogenital distance was significantly reduced in the TCDD-exposed GD 15 and GD 18 groups, but not in the TCDD-exposed PND 2 group. Semiquantitative RT-PCR analysis showed that AR mRNA levels were decreased in the TCDD-exposed GD 15 group only, and that the constitutive level of cytochrome P450 1A1 (CYP1A1) mRNA in the ventral prostate was not changed by TCDD in any of the exposed groups. No changes in AR mRNA level were detected in the testis or brain in any of the TCDD-exposed groups. These results suggest the presence of a critical window during development with regard to impairments of male reproductive organs by in utero and lactational exposure to a low dose of TCDD.

Key Words: TCDD; critical window; ventral prostate; androgen receptor.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Maternal exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) has been reported to cause diverse changes in the reproductive system of male offspring, including reduced sperm count, decrease of ventral prostate size and anogenital distance, and feminized sexual behavior (Bjerke and Peterson, 1994Go; Bjerke et al., 1994aGo,bGo; Faqi et al., 1998Go; Gray et al., 1995Go, 1997Go; Mably et al., 1992aGo,bGo,cGo; Sommer et al., 1996Go; Wilker et al., 1996Go). Among these abnormalities, the decreased size of the ventral prostate was reported to be one of the most sensitive landmarks, and intensive studies of the mechanism causing this change have been made (Roman et al., 1995Go, 1998aGo,Roman et al., bGo; Theobald et al., 2000Go). Recently we reported a decreased size of the ventral prostate and a reduction of anogenital distance in the male offspring of Holtzman rats that were exposed to a single and relatively low dose (lower than 50 ng/kg) of TCDD on GD 15 (Ohsako et al., 2001Go). Neither testicular weight nor daily sperm production were affected in this study, even at the highest dose of TCDD (800 ng/kg). These results suggest that dioxin shows overt toxicity in the development of male reproductive organs, which are known to respond to 5{alpha}-dihydrotestosterone (DHT). Peterson and coworkers stated that the androgen responsiveness of the ventral prostate is lowered in response to TCDD by yet-unknown mechanisms, although the male offspring exposed to TCDD in utero have a normal capability of producing androgen (Bjerke et al., 1994aGo; Theobald et al., 2000Go).

In our previous study, we found a dose-dependent decrease of androgen receptor (AR) mRNA level in the ventral prostate of pubertal male rats maternally exposed to TCDD (Ohsako et al., 2001Go). This finding is partly supported by earlier studies (Roman et al., 1998bGo; Theobald et al., 2000Go) in which AR immunoreactivity in the epithelium of TCDD-treated ventral prostate was weaker than that in the vehicle-treated control prostate. We hypothesize that this downregulation of AR gene expression might be a major factor that causes a decrease in androgen responsiveness of TCDD-exposed ventral prostate (Ohsako et al., 2001Go). The expression of AR gene is ingeniously controlled at the transcription level, and it is either upregulated or downregulated in an androgen-dependent manner, depending upon specific tissues and organs (Shan et al., 1990Go). This autoregulation mechanism has been demonstrated to be mediated by 2 androgen-responsive elements within the exons of AR gene and by AR protein itself (Dai and Burnstein, 1996Go; Grad et al., 2001Go). The decreased level of AR mRNA in rats exposed in utero and lactationally to TCDD was not likely to be caused by androgen-dependent downregulation, because the androgen production was not affected by TCDD (Ohsako et al., 2001Go; Roman et al., 1995Go; Theobald et al., 2000Go). Moreover, it was reported that AR protein level in the ventral prostate was not directly affected by TCDD (Johnson et al., 1992Go), and in our previous report, TCDD treatment did not alter the AR mRNA level in LNCaP cells, a human prostate cancer cell line (Jana et al., 1999Go). Therefore, the decreased level of AR mRNA in the ventral prostate of rats exposed in utero and lactationally to TCDD could be explained by a yet-unknown TCDD-mediated mechanism rather than the alteration of steroidogenesis and direct inhibition of AR gene transcription by TCDD.

It is extremely important to clarify the period most sensitive to TCDD and/or the target organ most sensitive in response to TCDD during fetal development in terms of human health risk assessment. Our previous data obtained by high resolution gas chromatography–mass spectrometry (GC–MS) revealed that the body burden of TCDD in newborns or pups just before weaning, born from dams treated with TCDD on GD 15, was 5-fold higher than that in fetuses, suggesting that the total amount of TCDD transferred to pups from mother's milk via lactation contributed to the body burden much more than it did via in utero transfer (Miyabara et al., 2000Go). This finding is consistent with earlier reports (Nau and Bass, 1981Go; Van den Berg et al., 1987Go). These data made us speculate that exposure to TCDD from mother's milk might be a major responsible factor for male reproductive disorder by perinatal exposure to TCDD. Providing information on the extent of the contribution of lactational TCDD exposure to the occurrence of possible disorders in humans is very important.

In the present paper, we focused on developmental stage specificity of TCDD actions on the reduction of rat ventral prostate weight and the decrease of AR mRNA level and we tried to clarify the most sensitive stage. We compared the effects of GD 15 and GD 18 TCDD administrations (oral, dam) and postnatal day (PND) 2 injections (sc, pups) in order to understand the effects of a relatively low dose of TCDD.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials.
The 2,3,7,8-TCDD was purchased from Cambridge Isotope Laboratory (Andover, MA), and its purity was higher than 99.5%. Dimethylsulphoxide (DMSO) and corn oil used for dissolving TCDD were from Sigma (St. Louis, MO). SuperScriptTM II RNase H-reverse transcriptase and oligo(dT)12–18 primer were from Life Technologies (Rockville, MD). LA TaqTM with 2x GC buffer I and Ex TaqTM with 10x Ex TaqTM buffer were from TaKaRa Biomedicals (Otsu, Japan). The plasmid pGEM-TEasy vector was obtained from Promega Corp. (Madison, WI).

Animals and TCDD administration.
Pregnant and male Sprague-Dawley rats (Crj:CD(SD)IGS) were purchased from Charles River Co., Japan, and maintained in air conditioned isolated racks in the SPF area of Panapharm Laboratory Co. (Kurizaki, Kumamoto, Japan). The day of sperm-positive evidence was defined as gestation day 0 (GD 0). A total of 30 pregnant rats at the same gestation day (GD 7) were utilized for experiments at the same time, given food and distilled water ad libitum, and housed individually in clear plastic cages with heat-treated wood chips as bedding. The following 3 TCDD exposures were sequentially executed, and then the necropsies were performed at PND 70. TCDD was dissolved in DMSO, followed by further dilution in corn oil to make a TCDD concentration of 0.2 µg/ml. For vehicle treatment, we used DMSO diluted with corn oil as prepared for the TCDD solution. On either GD 15 or 18, pregnant rats (n = 5) were given a single oral dose of TCDD (1 µg/kg body weight; 5 ml/kg dosing preparation) or an equivalent volume of vehicle. For treatment of male pups on PND 2, male pups born from nontreated dams (n = 5) were given a single subcutaneous dose of TCDD (1 µg/kg pup body weight; 5 ml/kg) or an equivalent volume of vehicle. After weaning, 3 males were housed per cage and 2 of them were randomly sacrificed under diethylether anesthesia on PND 70. Because one rat dam in the GD 15 TCDD-treated group died one day after administration, and one dam in the GD 15 TCDD-treated group and one in the PND 2 TCDD-treated group delivered only one male pup, the number of samples examined in the GD 15 and PND 2 treated groups were 7 and 9, respectively.

Sample collection and processing.
The anogenital distance (AGD), the length between the base of the genital tubercle and the anterior edge of the anus, was measured with a digital caliper. At the same time, the length between the tip of the nose and the anterior edge of the anus was measured as crown-anal length (CAL). The testis and epididymis of both sides were excised from the abdomen, and the surrounding adipose tissue was carefully removed. After removing urine from the bladder, deferent ducts were cut at the base of the bladder. The glans penis and urethra were dissected from the pelvis. The length between the anterior end of the urethra and the glans penis, labeled as the urogenital–glans penis length (UGL) was measured. The anterior end of the urethra was then cut and the remaining complex of sex accessory glands, including all lobes of prostates and seminal vesicle, was collected as a urogenital complex, which was weighed, dissected, and the ventral prostate reweighed. The data on tissue weight were expressed as the percentage of the body weight of each animal. All tissue samples were frozen in liquid nitrogen immediately after dissection and kept at –80°C until measurement of daily sperm production and sperm reserve, or RNA extraction.

Daily sperm production and epididymal sperm reserve.
The testes and cauda epididymis were homogenized in phosphate-buffered saline using a polytoron homogenizer. Homogenization-resistant spermatid nuclei were counted with a hemocytometer. The numbers of homogenization-resistant spermatid nuclei per testis were calculated and then divided by 6.1 days to convert them to testicular daily sperm production (DSP) (Robb et al., 1978Go). The numbers of homogenization-resistant sperm heads per cauda epididymis were defined as the cauda epididymal sperm reserve.

Gas chromatograph-mass spectrometry.
The tissue content of TCDD was determined according to the methods described previously (Miyabara et al., 1999Go). Briefly, a tissue sample (0.1–1 g) was spiked with 20 pg of (13C) 2,3,7,8-TCDD as an internal standard and then digested in 2 mol/l potassium hydroxide solution for 12 h. The TCDD in the digested material was extracted with n-hexane. The solution was applied to a silica gel column that was connected to an activated carbon-silica gel column, and then eluted with toluene. The final eluate was concentrated, and the residue was dissolved in n-hexane. The GC-MS analysis was performed in the selected ion mode on a JMS700 high performance, double focusing mass spectrometer (JEOL, Japan). Identification was based on the correct isotope ratio of M+ to (M+2)+ (±15%), recoveries (50–120%) and retention time (±4.0 s) of the GC separation. The area of mass profile peaks of the quantification ions was used for the quantitative analysis of TCDD.

Semiquantitative RT-PCR.
Semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR) was performed as described previously (Ohsako et al., 2001Go). Briefly, total RNA was extracted from testes, ventral prostates and brains (n = 5) by the protocol of Chomczynski and Sacchi (1987). The RNA samples (4 µg) were reverse-transcribed for 50 min at 42°C in a 20-µl reaction with 200 units of SuperScriptTM II reverse transcriptase and 0.5 µg of oligo(dT)12–18 primer by the standard protocol of the supplier. For AR mRNA amplification, 200 µl of a PCR mixture containing 4 µl of the reverse transcriptase reaction, 10 units of TaKaRa LA TaqTM polymerase, 1x GC buffer I, 0.4 mM dNTP mixture, and 0.4 µM primer was equally divided into 4 tubes. The primers were designed to amplify a 630-bp fragment for rat AR (forward, ATCGAGGAGCGTTCCAGAATCTG; reverse, ATATGGTCGAATTGCCCCCTAGG; GenBank accession # M20133). PCR was subsequently performed using an optimized protocol consisting of between 16 and 50 cycles. Each cycle consisted of the following: 94°C, 30 s; 63°C, 30 s; 72°C, 1.5 min. For CYP1A1 and cyclophilin mRNA amplification, 200 µl of PCR mixture containing 4 µl of the reverse transcriptase reaction, 5 units of TaKaRa Ex TaqTM polymerase, 1x Ex TaqTM buffer, 0.2 mM dNTP mixture and 0.4 µM of each primer was equally divided into 4 tubes. The primers were designed to amplify a 349-bp cDNA fragment for rat CYP1A1 (forward, CCATGACCAGGAACTATGGG; reverse, TCTGGTGAGCATCCAGGACA; GenBank accession # X00469) and a 524-bp fragment for cyclophilin (forward, TCTGAGCACTGGGGAGAAAG; reverse, AGGGGAATGAGGAAAATATGG; GenBank accession # M19533). Several cycles of PCR were subsequently performed with the following parameters: 94°C, 30 sec; 56°C, 30 sec; 72°C, 1 min for CYP1A1; and 94°C, 30 s; 55°C, 30 s; 72°C, 45 s for cyclophilin. The PCR products were separated by 2% agarose gel. The relative amounts of PCR products for AR and CYP1A1 were then quantified by standardizing with the PCR products of cyclophilin using Scion Images software (Scion Corporation, Frederick, MD). PCR products for AR and CYP1A1 were evaluated using 30 cycles. The PCR product for cyclophilin at 20 cycles was used as an internal standard. The PCR products for rat AR, CYP1A1 and cyclophilin were subcloned into pGEM-TEasy vectors and sequenced by the dideoxynucleotide chain termination method using the ABI Prism BigDye terminator cycle sequencing kit (PE-Biosystems, Foster City, CA).

Statistical analysis.
For statistical analysis, StatView for Windows version 5.0 (SAS Institute, Cary, NC) was used. All results represented are means ± SE. One-way analysis of variance (ANOVA) was used to confirm no significant variations in the parameters among the 3 control groups (GD 15, GD 28, PND 2). Two-tailed Student's t-test was used to compare the means between the experimental and control groups. A p value less than 0.05 was considered to indicate statistical significance.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TCDD Concentration
Figure 1Go represents the TCDD concentrations in the kidney and ventral prostate from PND 70 male rats. TCDD concentrations in the kidney were 1.60 pg/g wet tissue in the GD 15 group, 3.34 pg/g wet tissue in the GD 18 group, and 2.32 pg/g wet tissue in the PND 2 group, the data of which exceeded the measurement limit of 0.3 pg/g wet tissue by more than tenfold with this method (Ohsako et al., 2001Go) and showed that retained TCDD in the GD 15 group was the lowest among all treated groups. On the other hand, TCDD concentrations in the ventral prostate were 8.63 pg/g wet tissue from the GD 15 group, 8.98 pg/g wet tissue from the GD 18 group, and 5.70 pg/g wet tissue from the PND 2 group, showing that retained TCDD in the PND 2 group was the lowest among all treated groups. Overall, the amount of retained TCDD on PND 70 was the highest in the GD 18 treated group.



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 1. Comparison of TCDD concentration in the kidney and ventral prostate of male rat offspring exposed to TCDD on GD 15, GD 18, and PND 2. The TCDD concentration in the kidney and ventral prostate of PND 70 animals was measured by GC-MS, as described in Materials and Methods. Left kidneys or ventral prostates were collected from 3 animals in each treated group at random and extracted as described in Materials and Methods.

 
Testicular Weight and DSP
TCDD exposure on GD 15 significantly reduced absolute testicular weight on PND 70 from that of the corresponding control group (Table 1Go). On the other hand, the no-statistical-significance classification was observed for the relative testicular weight of GD 15 TCDD-exposed group to body weight. This reduction was due to the testes from 2 rats having clear atrophy (approximately 42.9% and 54.2% reduction in size compared to the average vehicle-control testis) out of 7 rats examined. When these two rats were excluded from calculation, no statistically significant difference from the control was observed, either in absolute or relative weight (Table 1Go). DSP was not significantly affected by TCDD exposure during any stage, even when including the 2 atrophic rats (Table 1Go). In the rats exposed to TCDD on GD 18 and PND 2, there were no statistically significant differences from any control group, either in testicular weight or DSP.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Effects of GD 15-, GD 18-, and PND 2-TCDD Exposure on Male Rat Reproductive Outcomes on PND 70
 
Epididymal Weight and Cauda Epididymal Sperm Reserve
Although no difference between the vehicle- and TCDD-treated groups was shown in the GD 18 and PND 2 exposed groups, statistically significant reductions of paired epididymal and cauda epididymal weight were detected in the GD 15 TCDD-treated group, either at absolute or relative weight levels (Table 1Go). The magnitude of reduction in caudal epididymal weight was 17%. However, it should also be noted here that the 2 rats showing testicular atrophy presented severe epididymal malformations, e.g., separation of the caput and caudal regions with a loss of corpus epididymis (data not shown). When we excluded the two atrophic rats, there was a significant reduction in absolute weight of the paired epididymis, but not in relative weight (Table 1Go). In addition, cauda epididymal sperm reserve in the GD15 TCDD-exposed group was 52.4% of the level in the control group (Table 1Go). No significant difference was observed in the GD 18 and PND 2 groups (Table 1Go).

Anogenital and Urogenital-Glans Penis Distances
AGD of rat offspring on PND 70 showed a statistically significant decrease in the GD 15 TCDD-treated groups (Table 1Go) compared to that of the corresponding vehicle-treated control group. When the AGD was divided by the crown-anal length (CAL; length between the tip of the rat nose and the anterior edge of the anus), the relative values were also statistically significant for this group. The significant reduction was observed even when excluding testicular atrophic rats. Interestingly, in the GD 18 TCDD-exposed group, significant reductions of AGD and AGD/CAL were observed (Table 1Go). On the other hand, AGD did not show a significant difference between the PND 2 TCDD-treated group and the vehicle-treated control group.

We also dissected the glans penis and urethra from the pelvis and measured the length between the anterior end of the urethra and the glans penis, labeling the measurement as the urogenital-glans penis length (UGL). Only the GD 15 TCDD-treated group showed a significant reduction in UGL compared to the vehicle-treated control group.

Urogenital Complex and Ventral Prostate Weight
The weight of the urogenital complex (UGC), a mixed organ complex including the seminal vesicle and all prostate lobes (Ohsako et al., 2001Go), was significantly decreased to 78.4% of control level in the TCDD-treated GD 15 group only (Table 1Go), and no change was observed in the GD 18 and PND 2 groups. The ventral prostate weight was also significantly decreased to 63.4% of the vehicle-treated control level (p < 0.001) by TCDD exposure on GD 15 (Table 1Go), indicating that the reduction of urogenital complex weight is mainly due to ventral prostate reduction. Excluding testicular atrophic rats did not affect the magnitude or statistical significance in reduction of both UGC and ventral prostate weights.

AR and CYP1A1 mRNA Expression
Amounts of specific transcripts in tissue samples from TCDD-exposed and control animals were compared by semiquantitative RT-PCR. Although this method does not have the capability of determining absolute amounts of mRNA molecules in total RNA samples, it was possible to compare the relative mRNA amounts among the same kinds of tissue samples by using an amplifying program with an appropriate number of cycles (log phase) before saturation (plateau phase). Relative arbitrary units were calculated by dividing the intensity of the band of each target gene product by the corresponding band intensity of cyclophilin.

The GD 15, and 18, and the PND 2 TCDD exposures did not alter AR mRNA levels in rat testes on PND 70 (Fig. 2Go). Consistent with the earlier report by Sommer et al. (1999), no PCR products for CYP1A1 were detected in any testis samples. On the other hand, in the ventral prostate, a reduction in the AR mRNA level was conspicuous in the GD 15 TCDD-exposed group compared to the vehicle-treated control (Fig. 3BGo), and the reduction was limited in the GD 15 group but not in the GD 18 or PND 2 groups. Although there was a tendency for CYP1A1 mRNA levels to increase slightly in the ventral prostate of the GD 18 TCDD-exposed group, constitutive expression of CYP1A1 mRNA was observed in all TCDD-treated groups without a statistically significant difference (Fig. 3CGo). In the brain, no significant changes in AR mRNA levels were observed in any of the TCDD-treated groups compared to levels in the corresponding vehicle-treated control groups (Fig. 4BGo). TCDD exposure resulted in a slight but significant increase in CYP1A1 mRNA levels in the PND 2 TCDD-exposed group but not in the GD 15 or GD 18 TCDD-exposed groups (Fig. 4CGo).



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 2. Semiquantitative RT-PCR analysis of the effects of perinatal exposure to TCDD on AR mRNA levels in the testis of PND 70 offspring. RT-PCR was carried out with total RNA from the testis, as described in Materials and Methods. (A) Agarose gel electrophoretic pattern of PCR products. (B) Relative amounts of PCR products to cyclophilin. The values expressed are the mean ± SE for 5 samples from each group. No decreased level of androgen receptor mRNA expression was detected.

 


View larger version (51K):
[in this window]
[in a new window]
 
FIG. 3. Semiquantitative RT-PCR analysis of the effects of perinatal exposure to TCDD on AR and CYP1A1 mRNA levels in the ventral prostate of PND70 offspring. (A) Agarose gel electrophoretic pattern of PCR products. (B) Relative amounts of PCR products of AR cDNA to cyclophilin. (C) Relative amounts of PCR products of CYP1A1 cDNA to cyclophilin. The values expressed are the mean ± SE for 5 samples from each group. Note that a significant decrease of AR mRNA level was observed only in the GD 15 TCDD-exposed group. Statistically significant difference between means and the corresponding vehicle-treated control was analyzed using Student's t-test (*p < 0.05).

 


View larger version (54K):
[in this window]
[in a new window]
 
FIG. 4. Semiquantitative RT-PCR analysis of the effects of perinatal exposure to TCDD on AR and CYP1A1 mRNA levels in the brain of PND 70 offspring. (A) Agarose gel electrophoretic pattern of PCR products. (B) Relative amounts of PCR products of AR cDNA to cyclophilin. (C) Relative amounts of PCR products of CYP1A1 cDNA to cyclophilin. The values expressed are the mea ± SE for 5 samples from each group. Note that a significant increase of CYP1A1 mRNA level was observed only in the PND 2 TCDD-exposed group. Statistically significant difference between means and the corresponding vehicle-treated control was analyzed using Student's t-test (*p < 0.05).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Maternal Exposure to TCDD Affects Epididymal Development of Offspring
In our previous experiment using Holtzman rats, in utero and lactational exposure to a dose of 800 ng TCDD/kg on GD 15 did not affect the epididymal weight or cauda epididymal sperm reserve of male offspring at ages PND 49 and PND 120 (Ohsako et al., 2001Go). In the present experiment, however, significant reductions in epididymal weight and cauda epididymal sperm reserve were observed in Sprague-Dawley rats (Crj:CD(SD)ICG) at a dose of 1 µg TCDD/kg on GD 15. Furthermore, we observed severe epididymal malformation, e.g., separation of the caput and caudal regions, with a loss of corpus epididymis in 2 individuals among the rats examined. Wilker et al. (1996) reported that Sprague-Dawley rats administered 2 µg TCDD/kg on GD 15 had segregated caput and caudal regions. These observations suggested that TCDD exposure on GD 15 affected epididymal development of male rat offspring, although the dose was not as low as the dose that was sufficient to decrease both ventral prostate weight and AGD as described below. TCDD administration affected epididymal development on GD 15 only, just as in the case with the reduction in urogenital complex and ventral prostate weights. These findings indicate that TCDD causes developmental stage-specific changes in the developing fetus, particularly epididymal malformation.

In contrast, testicular development and spermatogenesis were found to be less sensitive to TCDD; as noted in our earlier report, testicular weight and daily sperm production (DSP) were not changed by TCDD exposure on GD 15 (Ohsako et al., 2001Go). This observation is apparently inconsistent with the report by Mably et al. (1992c), who found that testicular weight and DSP of the TCDD-treated rats was significantly reduced in size and number in a dose-related fashion, even at the lowest dose of 64 ng TCDD/kg. However, we should point out that a testis from each of two rats, the same individuals that had epididymal malformation, when exposed to TCDD on GD 15, showed clear atrophy, though it did not produce a statistically significant reduction in testicular weight or DSP in the GD 15 TCDD-treated group. These results strongly suggest that there may be a threshold for the manifestation of testicular toxicity of TCDD, perhaps around or higher than a single administration of 1 µg TCDD/kg. We conclude that, overall, testicular development is less sensitive to TCDD exposure than development of the other male reproductive organs.

We have developed a working hypothesis that male reproductive organs, such as ventral prostate, urethra, and penis, which are sensitive to DHT, are selectively affected by in utero and lactational exposure to TCDD (Ohsako et al., 2001Go). The rat epididymis has also been described as a sex accessory gland that expresses a high level of 5{alpha}-reductase (Normington and Russell, 1992Go). TCDD is speculated to affect epididymal organogenesis on about GD 15 by decreasing androgen responsiveness, in the same manner as has been observed in the ventral prostate. Since DSP was not changed by TCDD, the reduction in cauda epididymal sperm reserve to 50% is probably the result of an insufficient volume of cavity of the cauda epididymal duct. Although we did not determine the sperm reserve in other portions of the epididymis, it is conceivable that a decrease in size of other portions, like corpus, of the epididymis is partly responsible for a reduction in sperm reserve in this organ (Sommer et al., 1996Go). Despite small effects on sperm production in testis, similar observations of a decrease in both epididymal sperm reserve and ejaculated sperm number were reported previously by Sommer et al. (1996) and Gray et al. (1997), who speculated that phagocytosis by the epithelium of the epididymis or deferent duct influenced the decreased sperm numbers, a conclusion that needs to be substantiated by future studies.

Reduction Anogenital Distance
In the present study, AGD was significantly reduced in the GD 18 TCDD-exposed group, as well as in the GD 15 group. Based on this data, the sensitive period for AGD reduction appears to be distributed in broader ranges than those for the epididymis and ventral prostate. Our new finding on the TCDD-caused shortening of urogenital-glans penis length appears to explain the reduction of urethra and penis length, which at least partly causes AGD reduction.

However, the shortening of the urogenital-glans penis length observed by the GD 18 TCDD-exposed group apparently failed to affect AGD in the same group, suggesting that other factors, such as a change in the position of the genital tubercle, might have influenced the reduction of AGD. It should be noted that the growth and development of the urethra and penis of rats have been reported to be highly sensitive to DHT (Normington and Russell, 1992Go). In utero treatment with a 5{alpha}-reductase inhibitor, finastride, reduced both anogenital distance and ventral prostate weight, and the most sensitive period was determined to be between the GD 16 and 17 (Clark et al., 1993Go). These features very much resemble the phenotypes after TCDD treatment in the present study, strongly suggesting that a TCDD-dependent reduction in DHT level at a specific period during fetal development causes these disorders.

Impairment of the Ventral Prostate
In the present study, the GC-MS analysis showed that retained TCDD in the kidney and ventral prostate of PND 70 rats in the GD 18 group was higher than that in the GD 15 group, indicating that total amounts of TCDD transferred to pups of the GD 18 group were higher than amounts transferred to pups of the GD 15 group. Nevertheless, the reductions of ventral prostate weight and epididymal weight were observed only in the GD 15 group, suggesting that a factor activated/inactivated by TCDD in the fetus, causing the reduction of male sex accessory organs, is less affected by TCDD exposure after GD 18. Gray et al. (1995) compared the effects of TCDD on male reproductive organs between GD 8 and GD 15 TCDD exposures (1 µg/kg, a single shot) in Long-Evans hooded rats. In their report, interestingly, reduced weights of the male sex accessory glands were seen only in rats exposed on GD 15, while the group exposed on GD 8 did not show changes in any reproductive endpoints. Considering their finding with that of other researchers, we conclude that a critical window for the impairment of male reproductive systems, including reduction of ventral prostate weight, occurs around GD 15 in rats.

By cross-fostering newborn pups exposed to TCDD in utero and pups from intact Holtzman rat dams, Bjerke and Peterson (1994) compared the effects of GD 15 TCDD exposure (1 µg/kg) on reproductive systems of male offspring, among in utero (IU), lactational (L), and in utero plus lactational (IUL) routes. They concluded that the testicular weight and DSP were lowered by IU and IUL routes, but the ventral prostate weight was reduced by all 3 routes of exposure. The magnitude of reduction of the ventral prostate was 80.4% of that of vehicle-exposed control rats by the IU route, 79.4% by the L route, and 57.7% by the IUL route, suggesting that both the IU and L routes appeared to contribute strongly to the malformation of the sex accessory glands. The present data, therefore, show support for somewhat different findings than those of the Bjerke and Peterson report. This might be due to the difference between the dams treated on GD 15 and on GD 18, concerning the ratio of transferred TCDD to pups from dam's milk, or other unknown effects of the dam during nursing. However, most recently, Peterson's group reported that in a more detailed cross-fostering experiment using mice, GD 13–16 appeared to be the most sensitive period with regard to impairment of the ventral prostate, and the L route was less effective than the IU route (Simanainen et al., 2001Go). For further assessment in rats, more detailed experiments will be necessary to investigate the magnitude of effects on ventral prostate development by using a constant body burden and standardized methods of administration.

TCDD amounts taken up by infants are quite high because of the greater accumulation of TCDD in mammary glands of dams that were chronically exposed to TCDD (Jensen 1987Go; Nau and Bass, 1981Go; Van den Berg et al., 1987Go). Our earlier data (Miyabara et al., 2000Go) showed that total body burden of TCDD in pups was much higher than that in fetuses when dams were exposed to TCDD on GD 15 and that the data is consistent with the above-cited reports. Although the present study indicated that the ventral prostate and epididymis were reduced in size by the mid-gestational but not by the late-gestational or postnatal periods, cumulative amounts of TCDD received via milk were substantial. According to Bjerke et al. (1994a,b) and Mably et al. (1992b), the alteration of sexual behavior after castration and hormone treatment, as characterized by the lordosis index, was sensitive only to postnatal TCDD exposure. Thus, we propose that a critical window on GD 15 could be applied only to disorders of male reproductive organs such as the ventral prostate and epididymis. Therefore, it will be necessary to investigate other landmarks affected by TCDD during growth and development of fetuses and pups in the search of critical windows for each landmark, and to classify the landmarks by the critical window and TCDD dose.

Downregulation of AR mRNA Level in the Ventral Prostate
A decrease in AR mRNA level was detected only in the GD15 TCDD-treated group (Fig. 3Go), whereas the level of cytochrome P450 1A1 (CYP1A1) mRNA, the transcriptional activation directly mediated by TCDD-aryl hydrocarbon receptor (AhR) complex (Denison and Whitlock, 1995Go; Gonzalez, 1990Go; Hankinson, 1995Go), was not changed and remained at the constitutive level in all treated groups. Gene expression of AhR and AhR nuclear transporter (ARNT) were constitutively expressed in all the male reproductive organs including the ventral prostate, and TCDD administration induced CYP1A1 in all organs except the testis (Roman et al., 1998aGo; Sommer et al., 1999Go). The retained TCDD concentration in the ventral prostate on PND 70 appeared to be already too weak to transcriptionally activate TCDD-AhR complex–dependent genes (Fig. 3Go). Thus, the lower levels of AR mRNA observed in only the GD 15 TCDD group could be explained by other mechanisms than transcriptional inactivation mediated by the TCDD-AhR complex. Actually, injection of a relatively high dose of TCDD (12.5, 25, or 50 µg/kg) to adult male rats did not change AR protein levels in the prostate (Johnson et al., 1992Go). Moreover, exposure to TCDD did not affect AR mRNA expression in a human prostate cancer cell line (Jana et al., 1999Go). Although it has not been reported whether the promoter sequence of AR gene contains xenobiotic-responsive element (XRE), the downregulation of AR mRNA by in utero TCDD treatment seems to be modulated by unknown mechanisms other than TCDD-AhR binding to the AR gene.

The AR gene itself is a target for androgen that regulates AR mRNA expression in a tissue-specific fashion (Grad et al., 1999Go; Shan et al., 1990Go). In the normal ventral prostate of adult rats, AR mRNA levels have been shown to be downregulated by androgens (Lubahn et al., 1989Go; Prins et al., 1995Go). This downregulation has been demonstrated by detailed analysis on the AR gene at the molecular level (Dai and Burnstein, 1996Go; Grad et al., 2001Go). They revealed that an exon of the AR gene has 2 functional androgen-responsive elements (AREs) and that androgen-AR protein complex could regulate AR gene transcription by binding these elements, suggesting there is an autoregulation system on the AR gene. Since TCDD exposure in utero did not alter serum gonadotropins or testosterone levels during prepuberty (Ohsako et al., 2001Go) but somewhat reduced testosterone levels in fetal and newborn rats (Mably et al., 1992aGo), it is not likely that the decreased AR mRNA level in the ventral prostate is due to this AR autoregulation system.

Relation to Aryl Hydrocarbon Receptor Gene
We suspect that exposure to TCDD around GD 15 specifically reduced the weight of male reproductive organs and that the AR mRNA level in the ventral prostate is mediated by temporal alterations in the expression of unknown genes in fetuses. This alteration might indirectly influence AR gene expression in the ventral prostate from birth through puberty. Probably this reduction in AR is involved in the decrease of androgen responsiveness. Much remains to be studied to gain understanding of the physiological states with regard to the relationship between AR expression level and prostate weight.

The yet-unidentified genes, whose expression was altered by TCDD in the fetus, are thought to be regulated in an AhR-dependent manner, since Peterson and coworkers recently reported that AhR-null mice did not show reduction of the ventral prostate by in utero or lactational TCDD exposure (Lin et al., 2001Go). When we administered TCDD to AhR-null mice in utero, in a colony generated by Mimura et al. (1997), we observed no reduction in anogenital distance in these mice in contrast to the occurrence of such a reduction in TCDD-treated wild-type mice (Ohsako et al., unpublished result), which strongly suggested that the reduction in ventral prostate weight and anogenital distance occurs in an AhR-dependent manner. Genes responsible for these alterations appear to have tissue and developmental stage specificity. Thus, the effects of maternal TCDD exposure are limited to the prostate and epididymis, not the brain and testis. This gene might be deeply involved in the DHT dependence of the prostate and epididymis.

Proposed Model for the Mechanism of Decrease in Androgen Responsiveness
Based on the present findings, we would propose a scheme for the mechanism of alteration of the male reproductive system by in utero exposure to TCDD. In the case of rats, TCDD could either induce or suppress the expression of putative genes temporally, around GD 15, which appears to be directly regulated by TCDD-AhR complex. This developmental stage-specific alteration indirectly causes downregulation of AR gene expression, via interactions of several factors in fetal and pup tissues that will be DHT-sensitive after puberty. The lowered levels of AR might be due to the decrease of androgen responsiveness, and then the male reproductive changes include a reduction in the size of the ventral prostate, epididymis, or AGD. Further studies are needed to determine whether the decreased level of AR mRNA we observed directly causes a reduction of male reproductive organ weight. In addition, studies are needed to examine whether the TCDD-AhR indirectly causes the decrease of the AR mRNA level and to characterize a set of AhR-dependent genes that are altered around GD 15 by TCDD. It is likely that the AhR-dependent genes have more sensitive structures than those of all AhR-dependent genes known at the present time, making them able to respond to the lowest level of TCDD in fetal tissues.


    ACKNOWLEDGMENTS
 
The authors thank Mr. Shuichi Kurosawa (Science University of Tokyo), Miss Satoko Takahashi (University of Tsukuba), and Miss Yoko Takeuchi (Environment Research Center) for their excellent technical help in this experiment.


    NOTES
 
1 To whom correspondence should be addressed at the Molecular and Cellular Toxicology Section, Environmental Health Sciences Division, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba 305-8506, Japan. Fax: +81-298-50-2588. E-mail: ohsako{at}nies.go.jp. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bjerke, D. L., Brown, T. J., MacLusky, N. J., Hochberg, R. B., and Peterson, R. E. (1994a). Partial demasculinization and feminization of sex behavior in male rats by in utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin is not associated with alterations in estrogen receptor binding or volumes of sexually differentiated brain nuclei. Toxicol. Appl. Pharmacol. 127, 258–267.[Web of Science][Medline]

Bjerke, D. L., and Peterson, R. E. (1994). Reproductive toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in male rats: Different effects of in utero versus lactational exposure. Toxicol. Appl. Pharmacol. 127, 241–249.[Web of Science][Medline]

Bjerke, D. L., Sommer, R. J., Moore, R. W., and Peterson, R. E. (1994b). Effects of in utero and lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure on responsiveness of the male rat reproductive system to testosterone stimulation in adulthood. Toxicol. Appl. Pharmacol. 127, 250–257.[Web of Science][Medline]

Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.[Web of Science][Medline]

Clark, R. L., Anderson, C. A., Prahalada, S., Robertson, R. T., Lochry, E. A., Leonard, Y. M., Stevens, J. L., and Hoberman, A. M. (1993). Critical developmental periods for effects on male rat genitalia induced by finasteride, a 5{alpha}-reductase inhibitor. Toxicol. Appl. Pharmacol. 119, 34–40.[Web of Science][Medline]

Dai, J. L., and Burnstein, K. L. (1996). Two androgen response elements in the androgen receptor-coding region are required for cell-specific upregulation of receptor messenger RNA. Mol. Endocrinol. 10, 1582–1594.[Abstract/Free Full Text]

Denison, M. S., and Whitlock, J. P., Jr. (1995). Xenobiotic-inducible transcription of cytochrome P450 genes. J. Biol. Chem. 270, 18175–18178.[Free Full Text]

Faqi, A. S., Dalsenter, P. R., Merker, H. J., and Chahoud, I. (1998). Reproductive toxicity and tissue concentrations of low doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin in male offspring rats exposed throughout pregnancy and lactation. Toxicol. Appl. Pharmacol. 150, 383–392.[Web of Science][Medline]

Gonzalez, F. J. (1990). Molecular genetics of the P-450 superfamily. Pharmacol. Ther. 45, 1–38.[Web of Science][Medline]

Grad, J. M., Dai, J. L., Wu, S., and Burnstein, K. L. (1999). Multiple androgen-responsive elements and a Myc consensus site in the androgen receptor (AR) coding region are involved in androgen-mediated upregulation of AR messenger RNA. Mol. Endocrinol. 13, 1896–1911.[Abstract/Free Full Text]

Grad, J. M., Lyons, L. S., Robins, D. M., and Burnstein, K. L. (2001). The androgen receptor (AR) amino-terminus imposes androgen-specific regulation of AR gene expression via an exonic enhancer. Endocrinology 142, 1107–1116.[Abstract/Free Full Text]

Gray, L. E., Kelce, W. R., Monosson, E., Ostby, J. S., and Birnbaum, L. S. (1995). Exposure to TCDD during development permanently alters reproductive function in male Long Evans rats and hamsters: Reduced ejaculated and epididymal sperm numbers and sex accessory gland weights in offspring with normal androgenic status. Toxicol. Appl. Pharmacol. 131, 108–118.[Web of Science][Medline]

Gray, L. E., Ostby, J. S., Jr., and Kelce, W. R. (1997). A dose-response analysis of the reproductive effects of a single gestational dose of 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin in male Long-Evans hooded rat offspring. Toxicol. Appl. Pharmacol. 146, 11–20.[Web of Science][Medline]

Hankinson, O. (1995). The aryl hydrocarbon receptor complex. Annu. Rev. Pharmacol. Toxicol. 35, 307–340.[Web of Science][Medline]

Jana, N. R., Sarkar, S., Ishizuka, M., Yonemoto, J., Tohyama, C., and Sone, H. (1999). Cross talk between 2,3,7,8-tetrachlorodibenzo-p-dioxin and testosterone signal transduction pathways in LNCaP prostate cancer cells. Biochem. Biophys. Res. Commun. 256, 462–468.[Web of Science][Medline]

Jensen, A. A. (1987). Polychlorobiphenyls (PCBs), polychlorodibenzo-p-dioxins (PCDDs) and polychlorodibenzofurans (PCDFs) in human milk, blood and adipose tissue. Sci. Total Environ. 64, 259–293.[Medline]

Johnson, L., Dickerson, R., Safe, S. H., Nyberg, C. L., Lewis, R. P., and Welsh, T. H., Jr. (1992). Reduced Leydig cell volume and function in adult rats exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin without a significant effect on spermatogenesis. Toxicology 76, 103–118.[Web of Science][Medline]

Lin, T. M., Rasmussen, N. T., and Peterson, R. E. (2001). Prenatal 5{alpha}-dihydrotestosterone (DHT) treatment does not protect against 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced inhibition of prostatic bud formation. Toxicologist 60, 1284.

Lubahn, D. B., Tan, J. A., Quarmby, V. E., Sar, M., Joseph, D. R., French, F. S., and Wilson, E. M. (1989). Structural analysis of the human and rat androgen receptors and expression in male reproductive tract tissues. Ann. N.Y. Acad. Sci. 564, 48–56.[Web of Science][Medline]

Mably, T. A., Bjerke, D. L., Moore, R. W., Gendron-Fitzpatrick, A., and Peterson, R. E. (1992c). In utero and lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin. 3. Effects on spermatogenesis and reproductive capability. Toxicol. Appl. Pharmacol. 114, 118–126.[Web of Science][Medline]

Mably, T. A., Moore, R. W., Goy, R. W., and Peterson, R. E. (1992b). In utero and lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin. 2. Effects on sexual behavior and the regulation of luteinizing hormone secretion in adulthood. Toxicol. Appl. Pharmacol. 114, 108–117.[Web of Science][Medline]

Mably, T. A., Moore, R. W., and Peterson, R. E. (1992a). In utero and lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin. 1. Effects on androgenic status. Toxicol. Appl. Pharmacol. 114, 97–107.[Web of Science][Medline]

Mimura, J., Yamashita, K., Nakamura, K., Morita, M., Takagi, T. N., Nakao, K., Ema, M., Sogawa, K., Yasuda, M., Katsuki, M., and Fujii-Kuriyama, Y. (1997). Loss of teratogenic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice lacking the Ah (dioxin) receptor. Genes Cells 2, 645–654.[Abstract]

Miyabara, Y., Hashimoto, S., Sagai, M., and Morita, M. (1999). PCDDs and PCDFs in vehicle exhaust particles in Japan. Chemosphere 39, 143–150.[Medline]

Miyabara, Y., Nishimura, N., Ohsako, S., Ishimura, R., Nohara, K., Sone, H., Tohyama, C., and Yonemoto, J. (2000). Transfer of 2,3,7,8-tetrachlorodibenzo-p-dioxin in rats throughout pregnancy and lactation. Toxicologist 54, 638.

Nau, H., and Bass, R. (1981). Transfer of 2,3,7,8-tetrachlorodibenzo-p-dioxin to the mouse embryo and fetus. Toxicology 20, 299–308.[Web of Science][Medline]

Normington, K., and Russell, D. W. (1992). Tissue distribution and kinetic characteristics of rat steroid 5{alpha}-reductase isozymes: Evidence for distinct physiological functions. J. Biol. Chem. 267, 19548–19554.[Abstract/Free Full Text]

Ohsako, S., Miyabara, Y., Nishimura, N., Kurosawa, S., Sakaue, M., Ishimura, R., Sato, M., Takeda, K., Aoki, Y., Sone, H., Tohyama, C., and Yonemoto, J. (2001). Maternal exposure to a low dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) suppressed the development of reproductive organs of male rats: Dose-dependent increase of mRNA levels of 5{alpha}-reductase type 2 in contrast to decrease of androgen receptor in the pubertal ventral prostate. Toxicol. Sci. 60, 132–143.[Abstract/Free Full Text]

Prins, G. S., and Woodham, C. (1995). Autologous regulation of androgen-receptor messenger ribonucleic acid in the separate lobes of the rat prostate gland. Biol. Reprod. 53, 609–619.[Abstract]

Robb, G. W., Amann, R. P., and Killian, G. J. (1978). Daily sperm production and epididymal sperm reserves of pubertal and adult rats. J. Reprod. Fertil. 54, 103–107.[Abstract/Free Full Text]

Roman, B. L., Pollenz, R. S, and Peterson, R. E. (1998a). Responsiveness of the adult male rat reproductive tract to 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure: Ah receptor and ARNT expression, CYP1A1 induction, and Ah receptor downregulation. Toxicol. Appl. Pharmacol. 150, 228–239.[Web of Science][Medline]

Roman, B. L., Sommer, R. J., Shinomiya, K., and Peterson, R. E. (1995). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Impaired prostate growth and development without inhibited androgen production. Toxicol. Appl. Pharmacol. 134, 241–250.[Web of Science][Medline]

Roman, B. L., Timms, B. G., Prins, G. S., and Peterson, R. E. (1998b). In utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin impairs prostate development: II. Effects on growth and cytodifferentiation. Toxicol. Appl. Pharmacol. 150, 254–270.[Web of Science][Medline]

Shan, L. X., Rodriguez, M. C., and Janne, O. A. (1990). Regulation of androgen receptor protein and mRNA concentrations by androgens in rat ventral prostate and seminal vesicles and in human hepatoma cells. Mol. Endocrinol. 4, 1636–1646.[Abstract/Free Full Text]

Simanainen, U., Lin, T. M., and Peterson, R. E. (2001). Assessment of the ages at which ventral prostate development in mice is most vulnerable to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure. Toxicologist 60, 1583.

Sommer, R. J., Ippolito, D. L., and Peterson, R. E. (1996). In utero and lactational exposure of the male Holtzman rat to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Decreased epididymal and ejaculated sperm numbers without alterations in sperm transit rate. Toxicol. Appl. Pharmacol. 140, 146–153.[Web of Science][Medline]

Sommer, R. J., Sojka, K. M., Pollenz, R. S., Cooke, P. S., and Peterson, R. E. (1999). Ah receptor and ARNT protein and mRNA concentrations in rat prostate: Effects of stage of development and 2,3,7,8-tetrachlorodibenzo-p-dioxin treatment. Toxicol. Appl. Pharmacol. 155, 177–189.[Web of Science][Medline]

Theobald, H. M., Roman, B. L., Lin, T. M., Ohtani, S., Chen, S. W., and Peterson, R. E. (2000). 2,3,7,8-Tetrachlorodibenzo-p-dioxin inhibits luminal cell differentiation and androgen responsiveness of the ventral prostate without inhibiting prostatic 5alpha-dihydrotestosterone formation or testicular androgen production in rat offspring. Toxicol. Sci. 58, 324–338.[Abstract/Free Full Text]

Van den Berg, M., Heeremans, C., Veenhoven, E., and Olie, K. (1987). Transfer of polychlorinated dibenzo-p-dioxins and dibenzofurans to fetal and neonatal rats. Fundam. Appl. Toxicol. 9, 635–644.[Web of Science][Medline]

Wilker, C., Johnson, L., and Safe, S. (1996). Effects of developmental exposure to indole-3-carbinol or 2,3,7,8-tetrachlorodibenzo-p-dioxin on reproductive potential of male offspring. Toxicol. Appl. Pharmacol. 141, 68–75.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J EndocrinolHome page
M. Kakeyama, H. Sone, and C. Tohyama
Perinatal exposure of female rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin induces central precocious puberty in the offspring
J. Endocrinol., May 1, 2008; 197(2): 351 - 358.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. R. Bell, S. Clode, M. Q. Fan, A. Fernandes, P. M. D. Foster, T. Jiang, G. Loizou, A. MacNicoll, B. G. Miller, M. Rose, et al.
Relationships between Tissue Levels of 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), mRNAs, and Toxicity in the Developing Male Wistar(Han) Rat
Toxicol. Sci., October 1, 2007; 99(2): 591 - 604.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. R. Bell, S. Clode, M. Q. Fan, A. Fernandes, P. M. D. Foster, T. Jiang, G. Loizou, A. MacNicoll, B. G. Miller, M. Rose, et al.
Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin in the Developing Male Wistar(Han) Rat. I: No Decrease in Epididymal Sperm Count after a Single Acute Dose
Toxicol. Sci., September 1, 2007; 99(1): 214 - 223.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. R. Bell, S. Clode, M. Q. Fan, A. Fernandes, P. M. D. Foster, T. Jiang, G. Loizou, A. MacNicoll, B. G. Miller, M. Rose, et al.
Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin in the Developing Male Wistar(Han) Rat. II: Chronic Dosing Causes Developmental Delay
Toxicol. Sci., September 1, 2007; 99(1): 224 - 233.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
V. J. Drake, S. L. Koprowski, N. Hu, S. M. Smith, and J. Lough
Cardiogenic Effects of Trichloroethylene and Trichloroacetic Acid Following Exposure during Heart Specification of Avian Development
Toxicol. Sci., November 1, 2006; 94(1): 153 - 162.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. T. Okino, D. Pookot, L.-C. Li, H. Zhao, S. Urakami, H. Shiina, M. Igawa, and R. Dahiya
Epigenetic Inactivation of the Dioxin-Responsive Cytochrome P4501A1 Gene in Human Prostate Cancer.
Cancer Res., August 1, 2006; 66(15): 7420 - 7428.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Mutoh, J. Taketoh, K. Okamura, T. Kagawa, T. Ishida, Y. Ishii, and H. Yamada
Fetal Pituitary Gonadotropin as an Initial Target of Dioxin in Its Impairment of Cholesterol Transportation and Steroidogenesis in Rats
Endocrinology, February 1, 2006; 147(2): 927 - 936.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
U. Simanainen, T. Haavisto, J. T. Tuomisto, J. Paranko, J. Toppari, J. Tuomisto, R. E. Peterson, and M. Viluksela
Pattern of Male Reproductive System Effects After in Utero and Lactational 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Exposure in Three Differentially TCDD-Sensitive Rat Lines
Toxicol. Sci., July 1, 2004; 80(1): 101 - 108.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
K. Ko, H. M. Theobald, and R. E. Peterson
In Utero and Lactational Exposure to 2,3,7,8-Tetrachlorodibenzo-p-dioxin in the C57BL/6J Mouse Prostate: Lobe-Specific Effects on Branching Morphogenesis
Toxicol. Sci., December 1, 2002; 70(2): 227 - 237.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
T.-M. Lin, U. Simanainen, R. W. Moore, and R. E. Peterson
Critical Windows of Vulnerability for Effects of 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Prostate and Seminal Vesicle Development in C57BL/6 Mice
Toxicol. Sci., September 1, 2002; 69(1): 202 - 209.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ohsako, S.
Right arrow Articles by Tohyama, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohsako, S.
Right arrow Articles by Tohyama, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?