Toxicological Sciences 69, 373-382 (2002)
Copyright © 2002 by the Society of Toxicology
MOLECULAR AND GENETIC TOXICOLOGY |
Vomitoxin-Induced Cyclooxygenase-2 Gene Expression in Macrophages Mediated by Activation of ERK and p38 but Not JNK Mitogen-Activated Protein Kinases

,
,1
* Department of Food Science and Human Nutrition;
Institute for Environmental Toxicology; and
Department of Microbiology and Molecular Genetics, Michigan State University, 234 G.M. Trout Bldg., East Lansing, Michigan 488241224
Received April 4, 2002; accepted June 4, 2002
| ABSTRACT |
|---|
|
|
|---|
Vomitoxin (VT) and other trichothecene mycotoxins mediate a broad range of immunotoxic effects via the induction of inflammation-associated genes in leukocytes. The purpose of this study was to test the hypothesis that VT induces cyclooxygenase-2 (COX-2) gene expression in macrophages and that this is regulated at the level of mitogen-activated protein kinases (MAPKs). Exposure of the murine macrophage cell line RAW 264.7 to 50250 ng/ml VT for 24 h markedly enhanced the production of prostaglandin E2 (PGE2), a major COX-2 metabolite. PGE2 elevation was preceded by increases in COX-2 mRNA (2 h) and COX-2 protein (15 h) in VT-treated cells. VT induced rapid (15 min) and persistent (up to 240 min) phosphorylation of extracellular, signal regulated protein kinases 1 and 2 (ERK1/2) and p38 MAPK as well as a rapid (15 min) but transient (up to 60 min) phosphorylation of c-Jun N-terminal kinases 1 and 2 (JNK1/2). The ERK inhibitor PD98059 and p38 inhibitor SB203580 suppressed VT-induced PGE2 and COX-2 protein expression, whereas impairment of JNK function by transient transfection with a dominant negative (dn) JNK vector had no effect on COX-2 protein expression. Relatedly, in cells transfected with a COX-2 promoter-luciferase construct, PD98059- and SB203580-, but not dnJNK-treatment, suppressed VT-induced luciferase transcription. VT also increased COX-2 mRNA stability, and this was inhibited by PD98059 but not by SB203580. Taken together, these results indicate that VT-induced PGE2 production and COX-2 expression by elevating transcriptional activity and mRNA stability. Enhanced transcriptional activity was modulated by ERK and p38 signaling pathways, whereas mRNA stability was promoted exclusively by VT-activated p38 phosphorylation. These data provide insight into possible general mechanisms by which VT and other trichlothecenes upregulate proinflammatory genes and impart immunotoxicity.
Key Words: tricothecenes; mycotoxins; vomitoxin; immunotoxins; COX-2 expression.
| INTRODUCTION |
|---|
|
|
|---|
The trichothecene mycotoxins are a group of sesquiterpenoid fungal metabolites that include some of the most potent eukaryotic protein-synthesis inhibitors known (Ueno, 1983
Animals exhibit feed refusal and weight loss upon chronic exposure to low dietary VT concentrations, whereas acute high-level exposure to VT can cause nausea, vomiting, and leukocytosis in experimental animals (Rotter et al., 1996
). The immune system is particularly susceptible to VT with macrophages, B cells, and T cells being highly sensitive to the toxin (Bondy et al., 2000
). Notably, mice exposed to VT develop clinical signs that mimic human IgA nephropathy (Dong et al.; 1991
). The broad spectrum of toxicity found for VT and other trichothecenes is likely to relate, in part, to their capacity to evoke production of proinflammatory mediators (Azcona-Olivera et al., 1995a
,b
; Ji et al., 1998
; Rizzo et al., 1992
, 1994
; Wong et al., 1998
; Zhou et al., 1997
, 1998
).
Metabolites of arachidonic acid are known to play key roles in the proinflammatory responses (Smith et al., 2000
). Cyclooxygenase (COX) is the rate-limiting enzyme that catalyzes the oxygenation of arachidonic acid to prostaglandin endoperoxides. These metabolites are converted enzymatically into prostaglandins and thromboxane A2, which play both physiologic and pathologic roles in a diverse array of inflammatory sequelae (Smith et al., 2000
; Vane et al., 1998
). Two distinct isoforms of COX have been identified. COX-1 is constitutively expressed at low levels in most tissues and may be related to housekeeping function. In contrast, COX-2, a 70-kD protein, is strongly induced by mitogenic and proinflammatory stimuli, superinduced by protein synthesis inhibitors, and can be regulated at both transcriptional and post-transcriptional levels (Dixon et al., 2000
; Fletcher et al., 1992
; Newton et al., 1997a
,b
Newton et al., 1998; Wadleigh et al., 2000
).
Several inflammatory stimuli that induce COX-2 gene expression also activate the mitogen-activated protein kinases (MAPKs). Among the MAPKs, c-Jun N-terminal kinases 1 and 2 (JNK1/2), extracellular signal-regulated protein kinases 1 and 2 (ERK1/2), and p38 MAPK have been extensively studied relative to their regulation of COX-2 gene expression (Guan et al., 1998
; Scherle et al., 1998
; Ridley et al., 1998
; Xie et al., 1995
). Upon exposure to the prototypic inflammagen lipopolysaccharide (LPS), transcriptional regulation of COX-2 gene expression is redundantly modulated by the 3 MAPK families (Mestre et al., 2001
; Wadleigh et al., 2000
), whereas p38 plays an important role in the signaling pathway for the stability of COX-2 mRNA (Dean et al., 1999
; Lasa et al. 2000
).
Several investigations have suggested that trichothecenes can increase arachidonic acid metabolism and upregulate prostaglandin production (Naseem et al., 1989
; Shohami and Feuerstein, 1986
). Recently, we have determined that a single acute exposure to VT induces COX-2 gene expression in the murine spleen (Islam et al., 2002
). Furthermore, trichothecenes have been suggested to activate MAPKs via a ribotoxic stress response (Shifrin and Anderson, 1999
; Yan et al., 2000
). Based on these observations, we hypothesized that VT induces COX-2 expression in macrophages, and that this was regulated at the level of MAPKs. The aim of this study was two-fold: first, to assess the effects of VT on COX-2 mRNA and protein expression in the RAW 264.7 macrophage model, and second, to relate VT-induced MAPK activation to transcriptional and post-transcriptional regulation of COX-2 gene expression. The results indicate that VT induces COX-2 expression and that MAPKs play critical roles in both transcriptional and post-transcriptional regulation of this gene response.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture.
RAW 264.7 murine macrophage cells (American Type Culture Collection, Rockville, MD; 2.5 x 105 per ml) were cultured in Dulbeccos Modified Eagles Medium (DMEM, Sigma Chemical Co., St. Louis, MO) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Atlanta Biologicals, Inc., Norcross, GA), 100 Unit/ml penicillin (Sigma, St. Louis, MO), and 100 µg/ml streptomycin (Sigma) in a 5% CO2-humidified incubator at 37°C. Macrophage cell number and viability were assessed by trypan blue (Sigma) dye exclusion using a hematocytometer, as described by Strober (1991).
Prostaglandin E2 (PGE2) assay.
PGE2 was measured using an EIA kit (Cayman Chemical Co., Ann Arbor, MI). Cell culture supernatants were collected 18 h after VT treatment. The aliquots were diluted 10-fold in fresh culture medium and the assays were conducted according to the instructions of the supplier.
Western blot analysis.
At the time of harvest, cells were washed with ice-cold phosphate buffer, lysed in boiling lysis buffer (1% [w/v] SDS, 1.0 mM sodium ortho-vanadate, and 10 mM Tris pH 7.4), and sonicated for 5 s. Protein was measured by the Bradford assay (Bio-Rad, Cambridge, MA). Extracts (10 µg) were mixed with Laemmli sample buffer (Bio-Rad) and boiled for 5 min before resolving on a 10% (w/v) acrylamide gel. Resolved proteins were transferred to PVDF membrane and blocked with Tris-buffered saline (10 mM TrisHCl pH 7.5, 100 mM NaCl) containing 0.1 % (v/v) Tween-20 and 1% (w/v) BSA (TBST-BSA). The membrane was incubated for 1 h with MAPK antibodies (rabbit IgG, New England Biolabs, Beverly, MA) at a 1:1000 dilution or COX-2 antibody (mouse IgG1; Transduction Laboratories, Lexington, KY) at a 1:250 dilution in TBST-BSA, and then was washed 3 times with TBST. The membrane was incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Cell Signaling, Beverly, MA) at a 1:5000 dilution in TBST-BSA for MAPK detection or with HRP-conjugated anti-mouse IgG (Sigma, St. Louis, MO) at a 1:10,000 dilution for COX-2 detection. After washing 3 times with TBST, bound HRP-conjugated antibody was detected with the Enhanced Chemiluminescence (ECL) kit (Amersham Pharmacia Biotech, Piscataway, NJ) according to the manufacturers instructions.
Reverse transcription-competitive polymerase chain reaction (RT-cPCR).
RNA was extracted with Trizol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturers instructions. RNA (100 ng) from each sample was transcribed to cDNA by reverse transcriptase, according to Riedy et al.(1995). COX-2 cDNA was amplified competitively with a truncated COX-2 cDNA internal standard constructed by the bridging-deletion method (Hall et al., 1998
). The amplification was performed in a 9600 Perkin Elmer Cycler (Perkin-Elmer Corp., Norwalk, CT) using the following parameters: 30 cycles of reactions of denaturation at 94°C for 30 s, annealing at 56°C for 45 s, and elongation at 72°C for 45 s. An aliquot of each PCR product was subjected to 1.5% (w/v) agarose gel electrophoresis and visualized by staining with ethidium bromide. Primers were synthesized at Michigan State Universitys Molecular Structure facility. The 5 forward and 3 reverse-complement PCR primers for amplification of mouse COX-2 cDNA were ACACTCTATCACTGGCATCC and GAAGGGACACCCTTTCACAT, respectively. Sizes of amplified COX-2 cDNA internal standard cDNA were 584 and 500 base pairs (bp), respectively. The densitometric ratio of COX-2 cDNA/COX-2 internal standard was used to construct a standard curve to calculate COX-2 cDNA concentrations in RT reaction products.
Plasmids and transfections.
The 5 upstream segment (-724/+7) of the mouse COX-2 gene from spleen chromosomal DNA was cloned into pXP2 (ATCC, Manassas, VA) at Hind III/Xho I restriction sites to construct a mouse COX-2 promoter-luciferase plasmid (pXP-5COX2). An expression vector for the dominant negative JNK1 (dnJNK) was kindly provided by Roger Davis (University of Massachusetts Medical School, Worcester, MA). All plasmids were purified with Endofree Plasmid Prep Kit (Qiagen, Valencia, CA).
For transfections, RAW 264.7 cells (4 x 105/ml) were washed twice in serum-free DMEM and then incubated for 3 h with a premixed complex of plasmid and lipopectamine (Life Technologies, Gaithersburg, MD) according to the manufacturers instructions. The cells were then replaced with fresh serum-containing DMEM and incubated for 24 h prior to VT exposure. pCMV-ß-Gal (BD Biosciences Clontech, Palo Alto, CA) was also co-transfected with 1 µg promoter-luciferase construct to standardize transfection efficiency.
JNK activity assay.
For determination of JNK activity, cells (5 x 105) were washed once with ice-cold PBS and incubated for 5 min with 0.5 ml ice-cold lysis buffer (20 mM Tris [pH 7.4] containing 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM ß-glycerolphosphate, 1 mM Na3 VO4, 1 µg/ml leupeptin, and 1 mM PMSF). After incubation, cells were harvested, sonicated, centrifuged at 14,000 rpm in a microcentrifuge for 10 min, and the supernatant was collected for the assay. c-Jun fusion protein beads (20 µg; Cell Signaling, Beverly, MA) were added to the supernatant (250 µl), and the mixture was incubated with gentle rocking overnight at 4EC. The bead complex was collected, suspended, and incubated with 100 µM ATP in kinase buffer (25 mM Tris (pH 7.5), 5 mM ß-glycerolphosphate, 2 mM DTT, 0.1 mM Na3 VO4, 10 mM MgCl2) for 30 min at 30°C. The reaction was terminated by Laemmli sample buffer and centrifuged. The supernatant was analyzed by Western immunoblotting with phospho-c-Jun rabbit antibody (Cell Signaling, Beverly, MA).
Luciferase and ß-galactosidase assays.
Cells were washed with cold PBS, lysed with lysis buffer (25 mM Tris-H3PO4: pH 7.8, 2 mM EDTA, 2 mM DTT, 10% [v/v] glycerol, 1% [v/v] Triton X-100) and then centrifuged at 12,000 x g for 2 min. Resultant supernatant was stored at 80°C until assessment of luciferase activity and ß-galactosidase. Luciferase activity was measured with a luminometer (Model 20e, Turner Designs Co., Sunnyvale, CA) after briefly mixing the supernatant with an equal-volume Luciferase Assay Systems substrate solution (Promega, Madison, WI). ß-Galactosidase activity was measured with ß-galactosidase Enzyme Assay Kit (Promega, Madison, WI). Luciferase activity was normalized against ß-galactosidase activity using the following formula: luciferase activity/ß-galactosidase activity.
Statistics.
Data were analyzed using Sigma Stat for Windows (Jandel Scientific, San Rafael, CA). For comparisons of 2 groups of data, Students t-test was performed. For comparisons of multiple groups of data, a Kruskal-Wallis 1-way analysis of variance on ranks was performed. Differences were considered significant if p < 0.05. Quantitative results were expressed as mean ± SEM.
| RESULTS |
|---|
|
|
|---|
Induction of COX-2 activity and gene expression by VT in RAW 264.7 cells.
Since VT has previously been shown to induce proinflammatory cytokines as well as nitric oxide and hydrogen peroxide in the RAW 264.7 macrophage cell line (Ji et al., 1998
|
Relationship of MAPK activation to VT-induced COX-2 expression.
MAPKs are known to be important signaling modulators in COX-2 expression and these have been recently shown to be activated by trichothecene mycotoxins (Shifrin et al., 1999; Yang et al. 2000
|
Treatment with MAPK-signaling inhibitors PD98059 (an MEK1/2 inhibitor that inhibits ERK activation) or SB203580 (a p38 MAPK inhibitor) significantly reduced VT-induced PGE2 production (Fig. 3A
|
JNK is also an important MAPK family that has been shown to influence COX-2 expression in several systems (Subbaramaiah et al., 1998
|
In total, these data suggest that activation of ERK and p38 MAPK, but not JNK, were critical in VT-induced upregulation of COX-2 gene expression. The specific roles of these MAPKs on COX-2 transcription and mRNA stabilization were therefore examined further.
Role of MAPKs in VT-induced transcriptional activation of COX-2 expression.
To analyze the effect of VT on COX-2 promoter activity, the 5 COX-2 promoter region was cloned into a luciferase reporter vector (pXP2) system, and the resultant plasmid (pXP-5COX2) was transiently transfected into RAW 264.7 cells. VT, at concentrations of 10 to 250 ng/ml, significantly increased luciferase expression dose-dependently in the transfected cells at 12 h (Fig. 5
). LPS (200 ng/ml) was used as the positive control, because it has also been shown to activate COX-2 promoter activity in RAW 264.7 cells (Paul et al., 1999
; Wadleigh et al., 2000
). In contrast, VT had no effect on luciferase activity in cells transfected with the empty vector, pCMV5 (data not shown).
|
The involvement of MAPKs in VT-induced transcriptional activation was investigated. The MAPK inhibitors (SB203580 or PD98059) significantly suppressed luciferase reporter induction in VT-treated transfected cells (Figs. 6A and 6B
|
Taken together, the results indicate that ERK and p38 MAPK activation by VT contributed to transcriptional activation of the COX-2 gene, but JNK did not appear to be involved in the COX-2 promoter activation by VT.
Role of p38 MAPK in VT-induced post-transcriptional regulation of COX-2 expression.
Stability of mRNA is also a potentially important factor in COX-2 gene regulation. The direct effect of VT on the COX-2 mRNA stability was analyzed by measuring the kinetics of mRNA decay after induction with 200 ng/ml LPS. Cells were collected at intervals following transcriptional arrest by actinomycin-D (Act-D), with or without VT, 3 h after LPS induction (Fig. 7
). Marked decay of COX-2 mRNA was observed after transcriptional arrest in control cultures, whereas VT markedly delayed COX-2 mRNA degradation (Fig. 7
).
|
To specifically address the involvement of MAPK in the VT-enhanced mRNA stability, the effects of MAPK inhibitors (PD98059 and SB203580) were evaluated when COX-2 induction by VT was maximal (2 h after VT exposure). After the maximal induction, cells were arrested with Act-D in the absence or presence of MAPK inhibitors. Inhibition of ERK had no effect on COX-2 mRNA stability, with observed half-lives exceeding 8 h (Fig. 8A
|
| DISCUSSION |
|---|
|
|
|---|
This is the first report that a trichothecene can directly induce COX-2 gene expression in macrophages. This result is significant because induction of COX-2 metabolites, including the prostaglandins and thromboxanes, are well-known mediators of various inflammatory manifestations as well as immunological disorders such as hypersensitivity and autoimmune diseases (Myers et al., 2000
|
The VT concentrations used here to alter COX-2 or luciferase expression are consistent with levels of the toxin found in plasma and tissues of mice that had been treated orally with sufficient VT to upregulate COX-2 expression (Islam et al., 2002
The dose-response study on PGE2 production after 24 h suggests that the effects were non-linear, in that levels of this metabolite were identical at 100 and 250 ng/ml VT (Fig. 1
). This contrasts with the 15 h COX-2 protein and 2 h COX-2 mRNA data, which both increased as the VT dose increased from 50 to 250 ng/ml. The PGE2 threshold effect may relate to the fact that supernatant PGE2 reflects not only the sum total of COX-2 mRNA expression and translational efficiency but also substrate availability, receptor binding, and metabolism by the cells. Another possibility is that this effect is a reflection of VT cytotoxicity. Using the 3-(4,5-di-methylthizol-2-yl)-2,5 diphenyltetrazolium bromide (MTT) assay, we have found after 24 h that while 100 ng/ml of VT or less had no effect, 250 ng/ml typically inhibits the maximal response by 5 to 20 percent (data not shown). The capacity of VT to partially inhibit cell proliferation and/or reduce viability at the highest concentration is consistent with this toxins inhibitory effects on translation. Thus, it is possible that even if the amount of COX-2 per cell were higher in the 250 ng/ml VT treatment, the decreased cell number might contribute to the lack of change in PGE2 compared to the lower toxin dose. This effect might not have been observed in COX-2 protein and mRNA measurements because these employed equivalent concentrations of the respective extracted macromolecules rather than representing a culture aliquot, as does the MTT assay.
Several intestinal tumor studies have suggested that MEK and its downstream ERK-signaling pathway are essential for both increased transcription and stability of COX-2 mRNA of K-Ras-induced COX-2 (Zhang et al., 2000
; Sheng et al., 2001
). ERK1/2 activation by VT was clearly involved in the transcriptional regulation of COX-2 expression but did not contribute to the mRNA stability. VT-activated ERK1/2 may be critical upstream signals regulating transcription factors rather than contributing to mRNA stability. Notably, ERK1/2 are crucial upstream kinases of CCAAAT/enhancer-binding protein-beta (C/EBPß) and cAMP response element-binding protein (CREB), which are major transcriptional factors involved in murine COX-2 expression (Davis et al., 2000
; Hu et al., 2001
). Consistent with such activity, we have recently observed that C/EBPß binding activities in RAW 264.7 cells was increased 2 and 8 h after VT exposure (Wong et al., 2002
). It is thus possible that VT-induced ERK activity contributes to increased activation of C/EPß and other transcription factors.
p38 is also known to mediate xenobiotic- or endogenous factor-induced COX-2 expression by transcriptional and post-transcriptional mechanisms (Fiebich et al., 2000
; Vogel, 2000
; Yan et al., 2000
). As shown here, p38 contributed to VT-induced COX-2 expression by both mechanisms. VT-induced transactivation of the COX-2 gene may result from p38-mediated activation of NF-
B and AP-1. Activation of these transcription factors by p38 has been described in LPS-exposed macrophages (Chen et al., 1999
). This possibility is supported by our recent observation that VT exposure also increases AP-1 and NF-
B activation in RAW 264.7 cells (Wong et al., 2002
).
Relative to p38 and post-transcriptional mechanisms, the presence of multiple copies of AUUUA pentamer in the 3-untranslated region (UTR) of COX-2 mRNA suggests the involvement of mRNA stability in the VT-induced upregulation of the gene. Some proteins such as AUF1, HuR, or tristetraprolin can differentially regulate COX-2 or cytokine mRNA stability by binding to the regulatory AU-rich elements (Dixon et al., 2000
, 2001
; Nabors et al., 2001
; Sirenko et al., 1997
; Zhu et al., 2001
). Notably, binding of tristetraprolin, a member of a family of zinc-finger proteins, is suppressed by p38-mediated phosphorylation (Zhu et al., 2001
). The observation that COX-2 mRNA stabilization via VT-activated p38 may be an important clue to global mechanisms of trichothecene-induced proinflammatory gene expression.
VT also activated JNK, which was transient relative to the other two MAPK families. Macrophage cells require the activation of JNK/MEKK1 in LPS-induced COX-2 transcription (Wadleigh et al., 2000
), and, more specifically, blocking JNK impairs both NF-
B- and C/EBPß-mediated transcription of COX-2 (Mestre et al., 2001
). In contrast, our results showed that blocking JNK activity with dnJNK did not affect VT-induced COX-2 expression. It is possible that, in the case of VT, the activated MAPK network functions redundantly in upregulating COX-2 gene transcription. In this case, impairment of JNK might be overcome by alternate pathways involving ERK and p38.
Interestingly, trichothecenes are also thought to induce leukocyte apoptosis via the p38 and JNK signaling pathways (Shifrin et al., 1999; Yang et al., 2000
). The VT concentrations employed here to induce COX-2 expression were non-cytotoxic to weakly cytotoxic. The possibility exists that trichothecene concentration may selectively dictate which MAPKs are activated and to what degree. The resultant effects may ultimately determine whether a cell generates a proinflammatory gene response or undergoes apoptosis. Further evaluation of how trichothecenes differentially regulate these two responses is warranted.
The potential exists that eicosanoid production might contribute to acute and chronic toxic effects associated with acute exposure to VT and other trichothecenes. Subchronic feeding of VT to mice results in a spectrum of immunologic effects including some manifestations that mimic human IgA nephropathy, an immune-complex disease (Dong et al., 1991
). Relative to the latter, VT enhances polyclonal autoreactive immunoglobulin A, which deposit in the kidney mesangium (Rasooly et al., 1994
; Rasooly and Pestka, 1994
). Of critical importance is the capacity of VT to elevate IL-6 expression, which is a critical mediator in the VT-induced IgA production (Pestka and Zhou, 2000
; Zhou et al., 1999
). PGE2 is known to enhance IL-6 in several inflammatory models such as endotoxemia, airway inflammation, and autoimmune arthritis (Anderson et al., 1996
; Myers et al., 2000
; Tavakoli et al., 2001
). In contrast, PGE2 selectively impairs the production of IFN
and Th1 immune function in both human and murine T-cell models (Betz and Fox, 1991
; Snijdewint et al., 1993
). PGE2 suppresses interleukin-12 (IL-12) p70 heterodimer, a major Th1-driving cytokine, whereas it participates in the induction of IL-12 p40, which can function as an antagonist of biologically active IL-12p70, thus favoring a Th2 response (Kalinski et al., 2001
). Interestingly, we have previously shown that VT induces IL-12p40 but not IL-12 p35, which would be inherently required for an increase in functionally active IL-12p70 (Zhou et al., 1997
). Thus, it is feasible that VT-induced PGE2 production might alter an optimal balance between Th1 and Th2 and drive increased IgA production that is observed in the subchronic feeding models.
Although COX-2 induction can be related to adverse effects such as tissue damage, COX-2 also can play a protective role in gastrointestinal inflammation (Langenbach et al., 1999
; Morteau, 1999
). It has been reported that COX-2-dependent arachidonic acid metabolites are essential modulators of the intestinal immune response to dietary antigens by promoting oral tolerance (Newberry et al., 1999
). Moreover, COX-2 products can be very important in the resolution of late-stage inflammation and may specifically involve an alternate set of prostaglandins such as those of the cyclopentenone family (Morteau, 1999
). Consistent with this observation, COX-2 knockout mice exhibit increased susceptibility to chemical-induced colitis (Morteau et al., 2000
). Therefore, the upregulation of COX-2 and its metabolites by VT as described herein might be interpretable as a protective defensive mechanism or compensatory stress response.
The mechanisms by which VT induces MAPK phosphorylation are unknown. Trichothecenes (Shifrin and Anderson, 1999
; Yang et al., 2000
) and other translational inhibitors (Iordanov et al., 1997
) that bind to eukaryotic ribosomes have been previously shown to activate MAPKs. Iordanov et al.(1997) observed that anisomycin and other antibiotics that bind to 28S rRNA are potent activators of JNK. Furthermore, two ribotoxic enzymes, ricin A chain and
-sarcin, both of which catalyze sequence-specific RNA damage in the 28S rRNA, are strong agonists of JNK1 and of its activator SEK1/MKK4. Anisomycin and the ribotoxic enzymes initiate signal transduction from the damaged 28S rRNA to JNK in active, but not inactive ribosomes. These investigators described this capacity of the ribosomes to sense cellular stress as the "ribotoxic stress response." The possibility exists that VTs capacity to activate MAPKs reflects a ribotoxic stress response and that this is manifested in transcriptional and postranscriptional upregulation of COX-2 mRNA.
In conclusion, the results presented herein revealed that VT induced PGE2 production and COX-2 expression by elevating transcriptional activity and mRNA stability. Enhanced transcriptional activity was modulated by ERK and p38 signaling pathways whereas mRNA stability was promoted exclusively by VT-activated p38 phosphorylation. Future studies will be directed toward identifying MAPK-regulated transcription factors and stabilizing factors binding to 3-UTR of VT-induced COX-2 gene. Additional investigation is needed at the in vivo level relative to the role of COX-2 products in VT-induced immunopathogenic and physiological sequelae.
| ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service Grants ES-03358 (JJP) and ES-09521 (JJP) and from the National Institute for Environmental Health Sciences.
| NOTES |
|---|
1 To whom correspondence should be addressed. Fax: (517) 353-8963. E-mail: pestka{at}msu.edu.
| REFERENCES |
|---|
|
|
|---|
Abouzied, M. M., Azcona-Olivera, J. I., Braselton, W. E., and Pestka, J. J. (1991). Immunochemical assessment of mycotoxins in 1989 grain foods: Evidence for deoxynivalenol (vomitoxin) contamination. Appl. Environ. Microbiol. 57, 672677.
Anderson, G. D., Hauser, S. D., McGarity, K. L., Bremer, M. E., Isakson, P. C., and Gregory, S. A. (1996). Selective inhibition of cyclooxygenase (COX)-2 reverses inflammation and expression of COX-2 and interleukin 6 in rat adjuvant arthritis. J. Clin. Invest. 97, 26722679.[Web of Science][Medline]
Azcona-Olivera, J. I., Quyang, Y., Murtha, J., Chu, F. F., and Pestka, J. J. (1995a). Induction of cytokine mRNAs in mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): Relationship to toxin distribution and protein synthesis inhibition. Toxicol. Appl. Pharmacol. 133, 109120.[Web of Science][Medline]
Azcona-Olivera, J. I., Quyang, Y. L., Warner, R. L., Linz, J. E., and Pestka, J. J. (1995b). Effects of vomitoxin (deoxynivalenol) and cycloheximide on IL-2, 4, 5, and 6 secretion and mRNA levels in murine CD4+ cells. Food. Chem. Toxicol 35, 433441.
Betina, V. (1989). Trichothecenes. In Mycotoxins. (V. Betina, Ed.), pp. 192241. Elsevior, New York.
Betz, M., and Fox, B. S. (1991). Prostaglandin E2 inhibits production of Th1 lymphokines but not of Th2 lymphokines. J. Immunol. 146, 108113.[Abstract]
Bhat, R., Beedu, S. R., Ramakrishna, Y., and Munshi, K. L. (1989). Outbreak of trichothecene mycotoxicosis associated with consumption of mould-damaged wheat production in Kashmir Valley, India. Lancet 1, 3537.[Web of Science][Medline]
Bondy, G. S., and Pestka, J. J. (2000). Immunomodulation by fungal toxins. J. Toxicol. Environ. Health B Crit. Rev. 3, 109143.[Web of Science][Medline]
Callejas, N. A., Castrillo, A., Bosca, L., and Martin-Sanz, P. (1999). Inhibition of prostaglandin synthesis upregulates cyclooxygenase-2 induced by lipopolysaccharide and peroxisomal proliferators. J. Pharmacol. Exp. Ther. 288, 12351241.
Chen, C., Chen, Y. H., and Lin, W. W. (1999). Involvement of p38 mitogen-activated protein kinase in lipopolysaccharide-induced iNOS and COX-2 expression in J774 macrophages. Immunology 97, 124129.[Web of Science][Medline]
Davis, S., Vanhoutte, P., Pages, C., Caboche, J., and Laroche, S. (2000). The MAPK/ERK cascade targets both Elk-1 and cAMP response element-binding protein to control long-term potentiation-dependent gene expression in the dentate gyrus in vivo. J. Neurosci. 20, 45634572.
Dean, J. L., Brook, M., Clark, A. R., and Saklatvala, J. (1999). The p38 mitogen-activated protein kinase regulates cyclooxygenase-2 mRNA stability and transcription in lipopolysaccharide-treated human monocytes. J. Biol. Chem. 274, 264269.
Dixon, D. A., Kaplan, C. D., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (2000). Post-transcriptional control of cyclooxygenase-2 gene expression: The role of the 3-untranslated region. J. Biol. Chem. 275, 1175011757.
Dixon, D. A., Tolley, N. D., King, P. H., Nabors, L. B., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (2001). Altered expression of the mRNA stability factor HuR promotes cyclooxygenase-2 expression in colon cancer cells. J. Clin. Invest. 108, 16571665.[Web of Science][Medline]
Dong, W., Sell, J. E., and Pestka, J. J. (1991). Quantitative assessment of mesangial immunoglobulin A (IgA) accumulation, elevated circulating IgA immune complexes, and hematuria during vomitoxin-induced IgA nephropathy. Fundam. Appl. Toxicol. 17, 197207.[Web of Science][Medline]
Fiebich, B. L., Mueksch, B., Boehringer, M., and Hull, M. (2000). Interleukin-1ß induces cyclooxygenase-2 and prostaglandin E(2) synthesis in human neuroblastoma cells: Involvement of p38 mitogen-activated protein kinase and nuclear factor-
B. J. Neurochem. 75, 20202028.[Web of Science][Medline]
Fletcher, B. S., Kujubu, D. A., Perrin, D. M., and Herschman, H. R. (1992). Structure of the mitogenic-inducible TIS10 gene and demonstration that the TIS10-encoded protein is a functional prostaglandin G/H synthase. J. Biol. Chem. 267, 43384344.
Guan, Z., Buckman, S. Y., Miller, B. W., Springer, L. D., Morrison, A. R. (1998). Interleukin 1ß-induced cyclooxygenase-2 expression requires activation of both c-Jun NH2-terminal kinase and p38 MAPK signal pathways in rat renal mesangial cells. J. Biol. Chem. 273, 2867028676.
Hall, L. L., Bicknell, G. R., Primrose, L., Pringle, J. H., Shaw, J. A., and Furness, P. N. (1998). Reproducibility in the quantification of mRNA levels by RT-PCR-ELISA and RT competitive-PCR ELISA. Biotechniques 24, 652658.[Web of Science][Medline]
Hu, J., Roy, S. K., Shapiro, P. S., Rodig, S. R., Reddy, S. P., Platanias, L. C., Schreiber, R. D., and Kalvakolanu, D. V. (2001). ERK1 and ERK2 activate CCAAAT/enhancer-binding protein-beta-dependent gene transcription in response to interferon-gamma. J. Biol. Chem. 276, 287297.
Iordanov, M. S., Pribnow, D., Magun, J. L., Dinh, T. H., Pearson, J. A., Chen, S. L., and Magun, B. E. (1997). Ribotoxic stress response: Activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the
-sarcin/ricin loop in the 28S rRNA. Mol. Cell Biol. 17, 33733381.
Islam, Z., Moon, Y. S., Zhou, H. R., King, L. E., Fraker, P. J., and Pestka, J. J. (2002). Endotoxin potentiation of trichothecene-induced lymphocyte apoptosis is mediated by up-regulation of glucocorticoids. Toxicol. Appl. Pharmacol. 180, 4355.[Web of Science][Medline]
Ji, G. E., Park, S. Y., Wong, S. S., and Pestka, J. J. (1998). Modulation of nitric oxide, hydrogen peroxide, and cytokine production in a clonal macrophage model by the trichothecene vomitoxin (deoxynivalenol). Toxicology 125, 203214.[Web of Science][Medline]
Kalinski, P., Vieira, P. L., Schuitemaker, J. H., de Jong, E. C., and Kapsenberg, M. L. (2001). Prostaglandin E(2) is a selective inducer of interleukin-12 p40 (IL-12p40) production and an inhibitor of bioactive IL-12p70 heterodimer. Blood 97, 34663469.
Kotsonis, F. N., Buedock, G. A., and Flamm, W. G. (1996). Food toxicology. In Casarett & Dulls Toxicology, The Basic Science of Poisons. (C. D. Klaassen, Ed.), pp. 909949. McGraw-Hill, New York.
Langenbach, R., Loftin, C., Lee, C., and Tiano, H. (1999). Cyclooxygenase knockout mice: Models for elucidating isoform-specific functions. Biochem. Pharmacol. 58, 12371246.[Web of Science][Medline]
Lasa, M., Mahtani, K. R., Finch A., Brewer, G., Saklatvala, J., and Clark, A. R. (2000). Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated, protein kinase p38 signaling cascade. Mol. Cell. Biol. 20, 42654274.
Mestre, J. R., Mackrell, P. J., Rivadeneira, D. E., Stapleton, P.P., Tanabe, T., and Daly, J. M. (2001). Redundancy in the signaling pathways and promoter elements regulating cyclooxygenase-2 gene expression in endotoxin-treated macrophage/monocytic cells. J. Biol. Chem. 276, 39773982.
Morteau, O. (1999). COX-2: promoting tolerance. Nat. Med. 5, 867868.[Web of Science][Medline]
Morteau, O., Morham, S. G., Sellon, R., Dieleman, L. A., Langenbach, R., Smithies, O., and Sartor, R. B. (2000). Impaired mucosal defense to acute colonic injury in mice lacking cyclooxygenase-1 or cyclooxygenase-2. J. Clin. Invest. 105, 469478.[Web of Science][Medline]
Myers, L. K., Kang, A. H., Postlethwaite, A. E., Rosloniec, E. F., Morham, S. G., Shlopov, B. V., Goorha, S., and Ballou, L. R. (2000). The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis. Arthritis Rheum. 43, 26872693.[Web of Science][Medline]
Nabors, L. B., Gillespie, G. Y., Harkins, L., and King, P. H. (2001). HuR, an RNA stability factor, is expressed in malignant brain tumors and binds to adenine- and uridine-rich elements within the 3 untranslated regions of cytokine and angiogenic factor mRNAs. Cancer Res. 61, 21542161.
Naseem, S. M., Hines, H. B., and Creasia, D. A. (1989). Effect of toxins on arachidonic acid metabolism in rat cultured pulmonary alveolar macrophages. Biochem Int. 19, 583592.[Web of Science][Medline]
Newberry, R. D., Stenson, W. F., and Lorenz, R. G. (1999). Cyclooxygenase-2-dependent arachidonic acid metabolites are essential modulators of the intestinal immune response to dietary antigen. Nat. Med. 5, 900906.[Web of Science][Medline]
Newton, R., Seybold, J., Liu, S. F., and Barnes, P.J. (1997a). Alternate COX-2 transcripts are differentially regulated: Implications for post-transcriptional control. Biochem. Biophys. Res. Commun. 234, 8589.[Web of Science][Medline]
Newton, R., Stevens, D. A., Hart, L. A., Lindsay, M., Adcock, I. M., and Barnes, P. J. (1997b). Superinduction of COX-2 mRNA by cycloheximide and interleukin-1ß involves increased transcription and correlates with increased NF-
B and JNK activation. FEBS Lett. 418, 135138.[Web of Science][Medline]
Pang, L. (2001). COX-2 expression in asthmatic airways: the story so far. Thorax 56, 335336.
Pang, L., and Hoult, J. R. (1996). Induction of cyclooxygenase and nitric oxide synthase in endotoxin-activated J774 macrophages is differentially regulated by indomethacin: Enhanced cyclooxygenase-2 protein expression but reduction of inducible nitric oxide synthase. Eur. J. Pharmacol. 317, 151155.[Web of Science][Medline]
Paul, A., Cuenda, A., Bryant, C. E., Murray, J., Chilvers, E. R., Cohen, P., Gould, G. W., and Plevin, R. (1999). Involvement of mitogen-activated protein kinase homologues in the regulation of lipopolysaccharide-mediated induction of cyclo oxygenase-2, but not nitric oxide synthase, in RAW 264.7 macrophages. Cell Signal. 11, 491497.[Web of Science][Medline]
Peraica, M., Radic, B., Lucic, A., and Pavlovic, M. (1999). Toxic effects of mycotoxins in humans. Bull. World Health Organ. 77, 754766.[Web of Science][Medline]
Pestka, J. J., and Bondy, G. S. (1994). Mycotoxin-induced immunomodulation. In Immunotoxicology and Immunopharmacology. (J. H. Dean., M. I. Luster., A. E. Munson., and I. Kimber, Eds.), pp.163182. Raven Press, New York.
Pestka, J. J., and Zhou, H. R. (2000). Interleukin-6-deficient mice refractory to IgA dysregulation but not anorexia induction by vomitoxin (deoxynivalenol) ingestion. Food Chem. Toxicol. 38, 565575.[Web of Science][Medline]
Rasooly, L., Abouzied, M. M., Brooks, K. H., and Pestka, J. J. (1994). Polyspecific and autoreactive IgA secreted by hybridomas derived from Peyers patches of vomitoxin-fed mice: Characterization and possible pathogenic role in IgA nephropathy. Food Chem. Toxicol. 32, 337348.[Web of Science][Medline]
Rasooly, L., and Pestka, J. J. (1994). Polyclonal autoreactive IgA increase and mesangial deposition during vomitoxin-induced IgA nephropathy in the BALB/c mouse. Food Chem. Toxicol. 32, 329336.[Web of Science][Medline]
Ridley, S. H., Dean, J. L., Sarsfield, S. J., Brook, M., Clark, A. R., and Saklatvala, J. (1998). A p38 MAP kinase inhibitor regulates stability of interleukin-1-induced cyclooxygenase-2 mRNA. FEBS Lett. 439, 7580.[Web of Science][Medline]
Riedy, M. C., Timm, E. A., Jr., and Stewart, C. C. (1995). Quantitative RT-PCR for measuring gene expression. Biotechniques 18, 7076.[Web of Science][Medline]
Rizzo, A. F., Atroshi, F., Ahotupa, M., Sankari, S., and Elovaara, E. (1994). Protective effect of antioxidants against free radical-mediated lipid peroxidation induced by DON or T-2 toxin. Zentralbl. Veterinarmed. A 41, 8190.[Medline]
Rizzo, A. F., Atroshi, F., Hirvi, T., and Saloniemi, H. (1992). The hemolytic activity of deoxynivalenol and T-2 toxin. Nat. Toxins 1, 106110.[Medline]
Rotter, B. A., Prelusky, D. B., and Pestka, J. J. (1996) Toxicology of deoxynivalenol (vomitoxin). J. Toxicol. Environ. Health 48, 134.[Web of Science][Medline]
Samad, T. A., Moore, K. A., Sapirstein, A., Billet, S., Allchorne, A., Poole, S., Bonventre, J. V., and Woolf, C. J. (2001). Interleukin 1ß-mediated induction of Cox-2 in the CNS contributes to inflammatory pain hypersensitivity. Nature 410, 471475.[Medline]
Scherle, P. A., Jones, E. A., Favata, M. F., Daulerio, A. J., Covington, M. B., Nurnberg, S. A., Magolda, R. L., and Trzaskos, J. M. (1998). Inhibition of MAP kinase kinase prevents cytokine and prostaglandin E2 production in lipopolysaccharide-stimulated monocytes. J. Immunol. 161, 56815686.
Scott, P. M. (1990). Trichothecenes in grains. Cereal Foods World 35, 661666.
Sheng, H., Shao, J., and Dubois, R. N. (2001). K-Ras-mediated increase in cyclooxygenase 2 mRNA stability involves activation of the protein kinase B1. Cancer Res. 61, 26702675.
Shifrin, V. I., and Anderson, P. (1999). Trichothecene mycotoxins trigger a ribotoxic stress response that activates c-Jun N-terminal kinase and p38 mitogen-activated protein kinase and induces apoptosis. J. Biol. Chem. 274, 1398513992.
Shohami, E., and Feuerstein, G. (1986). T-2 toxemia and brain prostaglandins. Prostaglandins 31, 307319.[Web of Science][Medline]
Shohami, E., Wisotsky, B., Kempski, O., and Feuerstein, G. (1987). Therapeutic effect of dexamethasone in T-2 toxicosis. Pharm. Res. 4, 527530.[Web of Science][Medline]
Sirenko, O. I., Lofquist, A. K., DeMaria, C. T., Morris, J. S., Brewer, G., and Haskill, J. S. (1997). Adhesion-dependent regulation of an A + U-rich element-binding activity associated with AUF1. Mol. Cell. Biol. 17, 38983906.
Smith., W. L., DeWitt, D. L., and Garavito, R. M. (2000). Cyclooxygenases: Structural, cellular, and molecular biology. Annu. Rev. Biochem. 69, 145182.[Web of Science][Medline]
Snijdewint, F. G., Kalinski, P., Wierenga, E. A., Bos, J. D., and Kapsenberg, M. L. (1993). Prostaglandin E2 differentially modulates cytokine secretion profiles of human T helper lymphocytes. J. Immunol. 150, 53215329.[Abstract]
Strober, W. (1991). Trypan blue exclusion test for cell viability. In Current Protocols in Immunology.. (J. E. Coligan, A. M. Kruisbeek, D. H. Marguiles, E. M. Shevach, and W. Strober, Eds.), pp. A.3.34. Wiley, New York.
Subbaramaiah, K., Chung, W. J., and Dannenberg, A. J. (1998). Ceramide regulates the transcription of cyclooxygenase-2: Evidence for involvement of extracellular signal-regulated kinase/c-Jun N-terminal kinase, and p38 mitogen-activated protein kinase pathways. J. Biol. Chem. 273, 3294332949.
Tavakoli, S., Cowan, M. J., Benfield, T., Logun, C., and Shelhamer, J. H. (2001). Prostaglandin E(2)-induced interleukin-6 release by a human airway epithelial cell line. Am. J. Physiol. Lung Cell. Mol. Physiol. 280, L127133.
Ueno, Y. (1983). General toxicology. In Trichothecenes: Chemical, Biological, and Toxicological Aspects. (Y. Ueno, Ed.), pp 135-1446. Elsevier, New York.
Vane, J. R., Bakhle, Y. S., and Botting, R. M. (1998). Cyclooxygenases 1 and 2. Annu. Rev. Pharmacol. Toxicol. 38, 97120.[Web of Science][Medline]
Vogel, C. (2000). Prostaglandin H synthases and their importance in chemical toxicity. Curr. Drug Metab. 1, 391404.[Web of Science][Medline]
Wadleigh, D. J., Reddy, S. T., Kopp, E., Ghosh, S., and Herschman, H. R. (2000). Transcriptional activation of the cyclooxygenase-2 gene in endotoxin-treated RAW 264.7 macrophages. J. Biol. Chem. 275, 62596266.
Wong, S. S., Zhou, H. R., Marin-Martinez, M. L., Brooks, K., and Pestka, J. J. (1998). Modulation of IL-1ß, IL-6, and TNF-
secretion and mRNA expression by the trichothecene vomitoxin in the RAW 264.7 murine macrophage cell line. Food. Chem. Toxicol. 36, 409419.[Web of Science][Medline]
Wong, S. S. Zhou, H.-R., and Pestka, J. J. (2002). Effects of vomitoxin (deoxynivalenol) on the binding of transcription factors AP-1, NF-
B and NF-IL6 in RAW 264.7 macrophage cells. J. Toxicol. Environ. Health (in press).
Xie, W., and Herschman, H. R. (1995). V-src induces prostaglandin synthase-2 gene expression by activation of the c-Jun N-terminal kinase and the c-Jun transcription factor. J. Biol. Chem. 270, 2762227628.
Yan, Z., Subbaramaiah, K., Camilli, T., Zhang, F., Tanabe, T., McCaffrey, T. A., Dannenberg, A. J., and Weksler, B. B. (2000). Benzo[a]pyrene induces the transcription of cyclooxygenase-2 in vascular smooth-muscle cells. Evidence for the involvement of extracellular signal-regulated kinase and NF-
B. J. Biol. Chem. 275, 49494955.
Yang, G. H., Jarvis, B. B., Chung, Y. J., and Pestka, J. J. (2000). Apoptosis induction by the satratoxins and other trichothecene mycotoxins: Relationship to ERK, p38 MAPK, and SAPK/JNK activation. Toxicol. Appl. Pharmacol. 164, 149160.[Web of Science][Medline]
Zhang, Z., Sheng, H., Shao, J., Beauchamp, R. D., and DuBois, R. N. (2000). Posttranscriptional regulation of cyclooxygenase-2 in rat intestinal epithelial cells. Neoplasia 2, 523530.[Web of Science][Medline]
Zhou, H. R., Harkema, J. R., Yan, D., and Pestka, J. J. (1999). Amplified proinflammatory cytokine gene expression and toxicity in mice coexposed to lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol). J. Toxicol. Environ. Health A 56, 115136.
Zhou, H. R., Yan, D., and Pestka, J. J. (1997). Differential cytokine mRNA expression in mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): Dose response and time course. Toxicol. Appl. Pharmacol. 144, 294305.[Web of Science][Medline]
Zhou, H. R., Yan, D., and Pestka, J. J. (1998). Induction of cytokine gene expression in mice after repeated and subchronic oral exposure to vomitoxin (deoxynivalenol): Differential toxin-induced hyporesponsiveness and recovery. Toxicol. Appl. Pharmacol. 151, 347358.[Web of Science][Medline]
Zhu, W., Brauchle, M. A., Di Padova, F., Gram, H., New, L., Ono, K., Downey, J. S., and Han, J. (2001). Gene suppression by tristetraprolin and release by the p38 pathway. Am. J. Physiol. Lung Cell. Mol. Physiol. 281, L499508.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. S. Gray, H. K. Bae, J. C. B. Li, A. S. Lau, and J. J. Pestka Double-Stranded RNA-Activated Protein Kinase Mediates Induction of Interleukin-8 Expression by Deoxynivalenol, Shiga Toxin 1, and Ricin in Monocytes Toxicol. Sci., October 1, 2008; 105(2): 322 - 330. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Bae and J. J. Pestka Deoxynivalenol Induces p38 Interaction with the Ribosome in Monocytes and Macrophages Toxicol. Sci., September 1, 2008; 105(1): 59 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li and J. J. Pestka Comparative Induction of 28S Ribosomal RNA Cleavage by Ricin and the Trichothecenes Deoxynivalenol and T-2 Toxin in the Macrophage Toxicol. Sci., September 1, 2008; 105(1): 67 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, J. R. Harkema, C. F. Cuff, and J. J. Pestka Deoxynivalenol Exacerbates Viral Bronchopneumonia Induced by Respiratory Reovirus Infection Toxicol. Sci., February 1, 2007; 95(2): 412 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Tran, Y.-T. Azuma, M. Chen, C. Weston, R. J. Davis, and R. A. Flavell Inactivation of JNK1 enhances innate IL-10 production and dampens autoimmune inflammation in the brain PNAS, September 5, 2006; 103(36): 13451 - 13456. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-R. Zhou, Z. Islam, and J. J. Pestka Induction of Competing Apoptotic and Survival Signaling Pathways in the Macrophage by the Ribotoxic Trichothecene Deoxynivalenol Toxicol. Sci., September 1, 2005; 87(1): 113 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, C. F. Cuff, and J. Pestka Modulation of Murine Host Response to Enteric Reovirus Infection by the Trichothecene Deoxynivalenol Toxicol. Sci., September 1, 2005; 87(1): 134 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kato, C. A. Lambert, A. C. Colige, P. Mineur, A. Noel, F. Frankenne, J.-M. Foidart, M. Baba, R.-I. Hata, K. Miyazaki, et al. Acidic Extracellular pH Induces Matrix Metalloproteinase-9 Expression in Mouse Metastatic Melanoma Cells through the Phospholipase D-Mitogen-activated Protein Kinase Signaling J. Biol. Chem., March 25, 2005; 280(12): 10938 - 10944. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Jia, H.-R. Zhou, M. Bennink, and J. J. Pestka Docosahexaenoic Acid Attenuates Mycotoxin-Induced Immunoglobulin A Nephropathy, Interleukin-6 Transcription, and Mitogen-Activated Protein Kinase Phosphorylation in Mice J. Nutr., December 1, 2004; 134(12): 3343 - 3349. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Souza, K. Shewmake, S. Pearson, G. A. Sarosi Jr., L. A. Feagins, R. D. Ramirez, L. S. Terada, and S. J. Spechler Acid increases proliferation via ERK and p38 MAPK-mediated increases in cyclooxygenase-2 in Barrett's adenocarcinoma cells Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G743 - G748. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Shifflett, S. L. Jones, A. J. Moeser, and A. T. Blikslager Mitogen-activated protein kinases regulate COX-2 and mucosal recovery in ischemic-injured porcine ileum Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G906 - G913. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-S. Chun, S.-H. Kim, Y.-S. Song, and Y.-J. Surh Celecoxib inhibits phorbol ester-induced expression of COX-2 and activation of AP-1 and p38 MAP kinase in mouse skin Carcinogenesis, May 1, 2004; 25(5): 713 - 722. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-R. Zhou, A. S. Lau, and J. J. Pestka Role of Double-Stranded RNA-Activated Protein Kinase R (PKR) in Deoxynivalenol-Induced Ribotoxic Stress Response Toxicol. Sci., August 1, 2003; 74(2): 335 - 344. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-R. Zhou, Z. Islam, and J. J. Pestka Rapid, Sequential Activation of Mitogen-Activated Protein Kinases and Transcription Factors Precedes Proinflammatory Cytokine mRNA Expression in Spleens of Mice Exposed to the Trichothecene Vomitoxin Toxicol. Sci., March 1, 2003; 72(1): 130 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Laskin, D. E. Heck, and D. L. Laskin The Ribotoxic Stress Response as a Potential Mechanism for MAP Kinase Activation in Xenobiotic Toxicity Toxicol. Sci., October 1, 2002; 69(2): 289 - 291. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














