Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wang, C.
Right arrow Articles by Eaton, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, C.
Right arrow Articles by Eaton, D. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Toxicological Sciences 70, 20-26 (2002)
Copyright © 2002 by the Society of Toxicology


BIOTRANSFORMATION AND TOXICOKINETICS

Complementary DNA Cloning, Protein Expression, and Characterization of Alpha-Class GSTs from Macaca fascicularis Liver

Charles Wang*, Theo K. Bammler{dagger} and David L. Eaton{dagger},1

* Cedars Sinai Medical Center, Davis Building G150, 8700 Beverly Blvd., Los Angeles, California 90048; and {dagger} Center for Ecogenetics and Environmental Health, University of Washington, 4225 Roosevelt Way NE, #100, Seattle, Washington 98105

Received June 14, 2002; accepted July 24, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Large species differences exist in sensitivity to aflatoxin B1 (AFB1)-induced liver cancer. Mice are resistant to AFB1-induced liver cancer because they express an alpha-class GST (mGSTA3-3) that has high activity toward the reactive intermediate aflatoxin B1-8,9-epoxide (AFBO). Rats constitutively express only small amounts of a GST with high AFBO activity (rGSTA5-5) and thus are sensitive to AFB1-induced hepatocarcinogenesis, although induction of rGSTA5-5 can confer resistance in rats. In contrast to rodents, constitutively expressed human hepatic alpha-class GSTs have little or no AFBO detoxifying activity. Recently, we found that the nonhuman primate, Macaca fascicularis (Mf), has significant constitutive hepatic GST activity toward AFBO and most of this activity belongs to mu-class GSTs. To determine if any alpha-class GSTs in Mf liver have AFBO activity, a cDNA library from a male Mf liver was constructed and screened using the human alpha-class GstA1 cDNA as a probe. Three different cDNA clones with full-length open reading frames were identified from the Mf hepatic cDNA library. Analyses of the cDNA deduced protein sequences indicated that these three alpha-class cDNA clones were 97–98% homologous with each other, and shared 93, 95, and 95% identity with human GSTA1, and were named mfaGSTA1, mfaGSTA2, and mfaGSTA3, respectively. Bacterially expressed mfaGSTA1-1 recombinant protein had similar activities toward classic GST substrates such as DCNB, CHP, and ECA, but slightly lower CDNB conjugating activity relative to human GSTA1-1. However, similar to hGSTA1-1, mfaGSTA1-1 had no AFBO conjugating activity. In addition, similar to human GSTA1 gene, cDNA-derived amino acid sequence analyses demonstrated that all of these Mf alpha-class GSTs genes (mfaGSTA1, mfaGSTA2, and mfaGSTA3) had none of the six critical residues that were identified previously to confer high AFBO activity in mouse alpha-class GSTA3-3. Thus, in contrast to rodents but similar to humans, alpha-class GSTs from the nonhuman primate, Mf, have little conjugating activity toward AFBO.

Key Words: glutathione S-transferase, alpha class; species differences; primate; aflatoxin biotransformation; liver; clone.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A large difference in susceptibility to aflatoxin B1 (AFB1)-induced liver cancer exists among different species (Eaton and Gallagher, 1994Go; Ramsdell and Eaton, 1990Go). Rats are very sensitive (Wogan and Newberne, 1967Go), whereas mice are highly resistant to the hepatocarcinogenic effects of aflatoxins (Wogan, 1973Go). Constitutive expression of certain forms of alpha-class GSTs is an important determinant of resistance of rodents to AFB1-induced liver cancer (Eaton et al., 1994Go; Hayes et al., 1991aGo,bGo, 1992Go, 1994Go, 1996Go). Although the mouse has very high microsomal cytochrome P450 activity required to form the highly reactive and genotoxic AFB-8,9-exo-epoxide (exo-AFBO; Monroe and Eaton, 1987Go; Raney et al., 1992bGo), resistance of mice occurs because of the expression of an alpha-class GST isoform (mGSTA3-3) that has high activity toward the reactive intermediate AFBO (Buetler and Eaton, 1992Go; Hayes et al., 1992Go). In contrast, rats constitutively express only small amounts of an alpha-class GST isoform, rGSTA5-5, with high AFBO activity and thus are sensitive to AFB1-induced hepatocarcinogenesis. However, the sensitivity of rats to AFB1 is substantially reduced by pretreatment with anticarcinogenic agents such as oltipraz and ethoxyquin (Cabral and Neal, 1983Go), agents that induce the expression rGSTA5-5 with high activity toward the exo-AFBO stereoisomer (Buetler et al., 1992Go; Hayes et al., 1991aGo, 1994Go). rGSTA5 cDNA has 92% sequence homology with mGstA3 and thus appears to be the orthologous form of the constitutively expressed mGstA3 gene product, the dimer of which possesses high detoxifying activity toward AFBO (Eaton and Gallagher, 1994Go; Eaton et al., 1994Go; Hayes et al., 1991aGo, 1994Go).

Remarkably, the soluble (cytosolic) fraction of human liver has extremely low GST activity toward AFBO, although total activity towards other common GST substrates is similar to that seen in rodents (Raney et al., 1992bGo; Slone et al., 1995Go). Consistent with the low total GST activity toward AFBO, cDNA-expressed human alpha-class GSTs (hGSTA1-1 and hGSTA2-2) have little or no AFBO detoxifying activity (Buetler et al., 1996Go; Johnson et al., 1997Go; Raney et al., 1992bGo). However, we found that liver cytosol from the nonhuman primate, Macaca fascicularis (Mf), does have significant constitutive hepatic cytosolic GST activity toward AFBO (Wang and Eaton, 1998Go). This activity is at least 10–100-fold higher than observed in human liver, although it is also about 100-fold lower than that seen in mouse liver. We recently demonstrated that mu-class GSTs appear to be responsible for most of the constitutive AFBO conjugating activity in Mf liver (Wang et al., 2000Go), although some contribution from alpha-class GSTs could not be ruled out. Alpha-class protein was present at relatively high levels in Mf liver, as demonstrated by Western blot analysis and activity assays (Wang et al., 2000Go).

Because Mf is an important nonhuman primate species sometimes used in metabolism and disposition studies of pharmaceutical agents, we completed the characterization of the alpha-class hepatic GSTs in this species, with an emphasis on comparison to human alpha-class GSTs. The objective of this study was to clone and sequence hepatic Mf alpha-class GSTs to determine (1) sequence and catalytic similarities to human alpha-class GSTs, and (2) if they possess significant AFBO conjugating activity, with the hope of identifying a primate alpha-class GST that is orthologous to rodent alpha-class GSTs with high catalytic activity toward AFBO.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals and reagents.
AFB1, reduced glutathione (GSH), NADPH, 1-chloro-2,4-dinitrobenzene (CDNB), 1,2-dichloro-4-nitrobenzene (DCNB), ethacrynic acid (ECA), S-hexylglutathione (SHG), and glutathione agarose (GSHA) were obtained from Sigma Chemical Co. (St. Louis, MO). HPLC solvents were of analytical reagent grade and were obtained from J. T. Baker, Inc. (Phillipsburg, NJ). Nytran membranes were obtained from Schleicher & Schuell (Keene, NH). Oligomers were synthesized by Oligos Etc. Inc. (Wilsonville, OR). All other reagents were of analytical reagent grade and were obtained from various commercial sources. pET 17b was purchased from Novagen (Madison, WI).

Construction of complementary DNA library.
An Mf liver cDNA library was constructed from an adult, castrated male Mf using the ZAP-cDNA synthesis kit (Stratagene, La Jolla, CA). The liver tissue was obtained through the tissue acquisition program of the Regional Primate Research Center at the University of Washington. A castrated male Mf was chosen because of (1) availability of tissue (only castrated Mf was available) and (2) relatively high AFBO activity was observed in hepatic cytosol from this animal. Briefly, cDNA library construction was initiated with first strand cDNA synthesis using 10 µg mRNA isolated from the Mf liver with a poly(A) mRNA isolation kit (Stratagene, La Jolla, CA), in the presence of StrataScriptTM RNase H- reverse transcriptase (RT), nucleotides and a 50-base oligonucleotide; the linker-primer with the following sequence:

5‘-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3‘

"GAGA" sequence Xho IPoly(dT)

This oligonucleotide was designed with a "GAGA" sequence to protect the Xho I restriction enzyme recognition site and an 18-base poly(dT) sequence. The restriction site allowed the finished cDNA to be inserted into the Uni-ZAP XR vector in a sense orientation (EcoR I-Xho I) with respect to the lacZ promoter. The nucleotide mixture for the first strand contains normal dATP, dGTP, and dTTP plus the analog 5-methyl dCTP. The complete first strand containing a methyl group on each cytosine base protected the cDNA from restriction enzymes used in subsequent cloning steps. During second strand synthesis, RNase H was used to nick the RNA bound to the first strand cDNA to produce a multitude of fragments, which serve as primers for DNA polymerase I. DNA polymerase I was used to "nick-translate" these RNA fragments into second strand cDNA. The second strand nucleotide mixture was supplemented with dCTP to reduce the probability of 5-methyl incorporation in the second strand. This ensures that the restriction sites in the linker-primer will be susceptible to restriction enzyme digestion. The uneven termini of the double-stranded cDNA were clipped or filled in with Klenow, and EcoR I adapters were ligated to the blunt ends. The adapters have the sequence shown below.

5‘-AATTCGGCACGAG-3‘

3‘- GCCGTGCTC-5‘

These adapters are composed of 9- and 13-mer complementary oligonucleotides, with an EcoR I cohesive end. The 9-mer oligonucleotide was phosphorylated to allow ligation to other blunt termini available in the form of cDNA and other adapters. The 13-mer oligonucleotide was maintained in a dephosphorylated state to prevent ligation to other cohesive ends. Following completion of adapter ligation, heat inactivation of ligase, the 13-mer oligonucleotide was phosphorylated to enable ligation into the dephosphorylated vector arms. Then digestion was completed with Xho I to release the EcoR I adapter and residual linker-primer from the 3‘ end of the cDNA, and the two fragments were separated on a Sephacryl S-400 spin column. The size-fractionated cDNAs were then precipitated and ligated to the Uni-ZAP XR vector arms (Stratagene, La Jolla, CA). The lambda library was packaged in a high-efficiency system, Gigapack II Gold packaging extract (Stratagene, La Jolla, CA), and plated on the E. coli strain XL1-Blue MRF (Stratagene, La Jolla, CA). Quality of the synthesized cDNA library was determined by both plaque-forming efficiency and positive actin clones, with mouse ß-actin as a probe. The constructed cDNA library had an efficiency of 1010 plaque-forming units/ml, and 0.04% of actin when checked using mouse ß-actin as a probe. Typically, highly expressed cDNA clones can be found in libraries yielding greater than 0.01% actin (Hagen et al., 1988Go).

Isolation and sequencing of Mf alpha-class GST clones.
Human alpha-class GST cDNA (hGSTA1, a gift from Dr. Chen-Pei D. Tu from the Pennsylvania State University) was used as a probe to screen the Mf hepatic cDNA library using a protocol provided by the manufacturer (Stratagene, La Jolla, CA). Positive clones from the primary screening were subjected to secondary and tertiary screenings with a higher stringency. The plasmids (pBluescripts) containing GST inserts were prepared, and sequence was obtained with an ABI 377 automatic sequencer, using T3, T7, and nested primers. Sequencing reactions were done on a thermal cycler using 0.5 µg of plasmid DNA and 8 µl of dye-terminator mix purchased from Perkin-Elmer (Foster City, CA). All sequences were analyzed with DNAide (Laboratoire de Biochimie, 91128 Palaiseau cedex, France), and DNA Strider (Service de Biochimie, Cedex, France) software.

Subcloning.
Because all cDNA clones isolated from tertiary cloning were not in a proper reading frame for GST protein expression, one of the three GST cDNAs was subcloned into an expression vector, pET 17b (Novagen, Madison, WI), for recombinant protein expression. mfaGSTA1 full-length cDNA has 992 bases including a 19-base polyA tail. Two primers, (forward primer [GAAGACTGCTCATATGGCAGAGAAA] and reverse primer [TACCGGGCCCCCCCTCGAGT]), were designed to subclone mfaGSTA1 cDNA into the pET 17b expression vector. A Nde I cloning site was introduced in the forward primer, and there was an Xho I cloning site in the reverse primer. The cDNAs generated with the above primers were digested with Nde I and Acc I (fragment A), whereas pBluescript plasmids containing mfaGSTA1 inserts were digested with Acc I and Xho I (fragment B). Both fragments A and B were then cloned into pET 17b, which had been digested with both Nde I and Xho I. This cloning strategy was used because the cDNA contained an internal Nde I site and digesting the cDNA with Acc I first facilitated directional cloning. This allowed for highly efficient expression of recombinant mfaGSTA1-1, because the starting codon (ATG) of mfaGSTA1 was aligned in optimal proximity to the upstream ribosome binding site in the expression vector (Fig. 1Go). The protein was expressed in Escherichia coli, BL21 (DE3; Novagen), and purified by glutathione-affinity chromatography as previously described (McHugh et al., 1996Go).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. Subcloning of mfaGSTA1 cDNA. A forward primer (GAAGACTGCTCATATGGCAGAGAAA) and a reverse primer (TACCGGGCCCCCCCTCGAGT) were designed to subclone mfaGSTA1 cDNA into the pET 17b expression vector. The cDNAs generated with the above primers were digested with Nde I and Acc I (fragment A), whereas pBluescript plasmids containing mfaGSTA1 inserts were digested with Acc I and Xho I (fragment B). Both fragments A and B were then cloned into pET 17b that had been digested with both Nde I and Xho I. P1, forward primer containing Nde I cloning site; P2, reverse primer containing Xho I cloning site; MCS, multiple cloning site; S-D site, Shine-Dalgarno site; Amp, ampicillin.

 
Northern blotting.
Twenty µg of Mf liver total RNA were separated on a 1.25% agarose/formaldehyde gel, blotted onto Nytran membranes, and hybridized with 32P labeled mfaGSTA1 cDNA probes. Blots were hybridized in QuickHyb® (Stratagene, La Jolla, CA) solution for 1 h at 68°C with cDNA probe. After hybridization, blots were washed twice at room temperature with a 2x SSC buffer and 0.1% (w/v) SDS wash solution, followed by an additional high stringency wash at 60°C with a 0.1x SSC buffer and 0.1% (w/v) SDS solution for 30 min in a hybridization oven (Robbins Scientific Corp., Sunnyvale, CA). Autoradiography was accomplished using Kodak X-OMAT AR film.

Enzymatic assays.
AFBO conjugating activity was determined using an HPLC method as previously described (van Ness et al., 1998Go) in which mouse microsomes were used to generate AFBO, with an initial AFB1 substrate concentration of 128 µM. AFBO hydrolyzes rapidly in aqueous solution with a half-life of approximately 1 s (Johnson et al., 1997Go). AFBO endo- and exo-activities were determined using a method as previously described by Raney et al. (1992a)Go, with the following modifications: (1) mouse microsomes were used to generate AFBO, with an initial AFB1 substrate concentration of 128 µM; (2) 1 mM NADPH was used in place of an NADPH regenerating system. Other general enzymatic glutathione S-transferases activities were assayed using CDNB, DCNB, CHP, and ECA as substrates according to standard procedures (Habig and Jakoby, 1981Go).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Out of 70,000 phage plaques screened, 12 independent clones were isolated and purified. cDNA sequence was obtained on all 12 clones. Three different cDNA clones were identified, and named mfaGSTA1, mfaGSTA2, and mfaGSTA3, respectively. The cDNA-derived protein sequence analyses indicated that these three alpha-class cDNA clones were 97–99% homologous with each other, and shared 93, 95, and 95% similarity to human GSTA1 (Table 1Go). However, these three Mf alpha-class GST proteins had only 75, 76, and 76% identity with the high AFBO conjugating activity of mouse alpha-class GSTA3-3 (Table 1Go).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Amino Acid Sequence Similarities of Alpha-Class GSTs among Different Species
 
To examine their primary structures, three Mf alpha-class GST cDNA-derived amino acid sequences were aligned with alpha-class GSTs from other species (Fig. 2Go). Similar to hGSTA1-1, all three Mf alpha-class GSTs were comprised of 222 amino acids, which is one amino acid more than rodent alpha-class GSTs (mGSTA3, rGSTA3, and rGSTA5). Furthermore, none of the six critical residues conferring high AFBO conjugating activity in mouse alpha-class mGSTA3-3 were present in these three Mf alpha-class GSTs (Fig. 2Go; van Ness et al., 1998Go).



View larger version (92K):
[in this window]
[in a new window]
 
FIG. 2. Amino acid sequence alignment of alpha-class GSTs among different species. Asterisk (*) denotes critical residues for AFBO activity in mGSTA3-3; mGSTA3, mouse alpha-class GSTA3 cDNA derived amino acid sequence; rGSTA5, rat alpha-class GSTA5 cDNA derived amino acid sequence; rGSTA3, rat alpha-class GSTA3 cDNA derived amino acid sequence; mfaGSTA1, Mf alpha-class GSTA1 cDNA derived amino acid sequence; mfaGSTA2, Mf alpha-class GSTA2 cDNA derived amino acid sequence; mfaGSTA3, Mf alpha-class GSTA3 cDNA derived amino acid sequence; hGSTA1, human alpha-class GSTA1 cDNA derived amino acid sequence.

 
Considering the high similarity of these three Macaca alpha-class GSTs, only one cDNA, mfaGSTA1, was subcloned into pET 17b for protein expression in E. coli. Subcloning was required as none of these three clones were in the proper reading frames in the pBluescript plasmid and all three lacked a Shine-Dalgarno (S-D site) sequence required for prokaryotic transcription. The purified bacterially expressed mfaGSTA1-1 enzymatic activities were characterized utilizing CDNB, DCNB, CHP, ECA, and AFBO as substrates. These activities were compared with other alpha-class GSTs (rodent and human; Table 2Go). Except for CDNB activity (lower than human), mfaGSTA1-1 had a similar profile of DCNB, CHP, and ECA substrate conjugating activities (Table 2Go). In particular, similar to human GSTA1-1, mfaGSTA1-1 had no detectable AFBO conjugating activity. This is not surprising as none of the six amino acid residues that had been identified to be critical to the high AFBO activity of mouse GSTA3-3 were present (Fig. 2Go; van Ness et al., 1998Go).


View this table:
[in this window]
[in a new window]
 
TABLE 2 Comparison of Specific Activities of cDNA Expressed Alpha-class GSTs
 
Northern blot analysis (Fig. 3Go) showed that there were two different mRNA species expressed in all four Mf livers (including the one from which a hepatic cDNA library was derived), suggesting that there are two or more different alpha-class GSTs expressed in Mf liver. A similar expression pattern was observed in duodenum, with slightly lower expression levels of alpha-class GSTs. Interestingly, alpha-class GSTs were not detected in either kidney or lung in the one animal examined, although it could not be concluded definitively that alpha-class GSTs are not expressed in these two tissues, as only one animal was examined.



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 3. Expression of alpha-class GST mRNAs in Macaca fascicularis tissues. (A) Northern blotting with mfaGSTA1 cDNA probe. (B) Northern blotting with mouse ß-actin cDNA probe. L, liver; K, kidney; Lu, lung; Duo, duodenum. L1, liver RNA isolated from animal number 1; L2, liver RNA isolated from animal number 2; L3, liver RNA isolated from animal number 3; L4, liver RNA isolated from animal number 4; K4, kidney RNA isolated from animal number 4; Lu4; lung RNA isolated from animal number 4; Duo4, duodenum RNA isolated from animal number 4.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Compared to rat or mouse GSTs, human liver cytosolic GSTs have very low activity toward the exo-AFBO isomer (< 2 pmol/min/mg)—on the order of 100- and 5000-fold lower than that found in rat and mouse liver cytosol, respectively (Eaton and Gallagher, 1994Go; Eaton and Ramsdell, 1992Go; Moss and Neal, 1985Go; Slone et al., 1995Go). In contrast to human liver cytosol, there is readily measurable cytosolic exo-AFBO conjugating activity in liver from the nonhuman primate, Mf (28 pmol/min/mg; Wang and Eaton, 1998Go). Previous studies have demonstrated that the high catalytic activity in mouse and rat liver is due to the presence of one constitutively expressed alpha-class GST (mGSTA3-3, rGSTA5-5), whereas constitutively expressed human hepatic alpha-class GSTs, hGSTA1-1 and A2-2, have no detectable exo-AFBO detoxification activity (Buetler et al., 1996Go; Johnson et al., 1997Go; Raney et al., 1992bGo).

In the present study, three different cDNA clones (pBluescript-SK(-)-mfaGSTA1, pBluescript-SK(-)-mfaGSTA2, pBluescript-SK(-)-mfaGSTA3) were isolated from a Mf hepatic cDNA library and found to have high sequence homology (> 96%, Table 1Go). One of these clones, mfaGSTA1, was subcloned into an expression vector, pET17b, for recombinant GST protein expression in bacteria. Consistent with what was found in human alpha-class GSTA1-1, bacterially expressed recombinant mfaGSTA1-1 had no detectable AFBO conjugating activity (< 2 pmol/min/mg), and had a very similar activity profile to the human GSTA1-1 toward other substrates such as CDNB, DCNB, CHP, and ECA (Table 2Go). These results confirm our previous studies that suggested constitutively expressed alpha-class GSTs in Mf liver do not contribute substantially to overall hepatic cytosolic GST activity toward AFBO observed in this species (Wang and Eaton, 1998Go; Wang et al., 2000Go).

Whether humans (or other primate species) possess a nonconstitutively expressed, but inducible, alpha-class GST that is orthologous to the rodent GSTs with high catalytic activity toward AFBO is an important question relevant to dietary and/or chemointervention strategies to reduce AFB carcinogenesis in humans. Van Ness et al. (1998)Go identified six amino acid residues as being critical in conferring high AFBO activity to the rodent alpha-class GSTs, mGSTA3-3 and rGSTA5-5. Primary sequence analysis revealed that neither mfaGSTA1, mfaGSTA2 nor mfaGSTA3 shared any of those six residues with mGSTA3 and rGSTA5 (Fig. 2Go). Therefore, it is unlikely that the other two Mf alpha-class GST genes (mfaGSTA2 and mfaGSTA3) will result in proteins with any significant AFBO activity, given that (1) they share high similarity with human GSTA1, based on cDNA-derived amino acid sequence analyses, and (2) as is the case for hGSTA1subunit, they have none of the six critical amino acid residues associated with high exo-AFBO activity of rodent alpha-class GSTs (mGSTA3-3, rGSTA5-5; Fig. 2Go).

Thus, these results further suggest that strategies for chemoprevention against AFB1-induced human hepatocarcinogenesis should not rely upon induction of alpha-class GSTs. However, induction of other GSTs may be of some value. Oltipraz, a model chemopreventive agent that can induce an alpha-class GST, rGSTA5-5, with high activity toward the exo-AFBO in rats (Buetler et al., 1995Go, 1996Go; Hayes et al., 1996Go; Kensler, 1997Go; Kensler et al., 1992Go; Primiano et al., 1995Go), has been used on a phase IIa clinical trial in China (Kensler et al., 1998Go; Wang et al., 1999Go, 2001Go). Daily intervention with 125 mg oltipraz led to a 2.6-fold increase in median aflatoxin-mercapturic acid excretion (Kwak et al., 2001Go; Wang et al., 1999Go), suggesting that the treatment did induce GSTs with activity toward AFBO. Studies in isolated human hepatocytes demonstrated that oltipraz can induce human alpha-class GSTs, hGSTA1-1, and hGSTA2-2 (Morel et al., 1993Go). However, like Mf alpha-class GSTs (A1-1, A2-2, and A3-3), these two human alpha-class GSTs have no activity toward the exo-AFBO isomer and thus would not be expected to provide significant protection from AFB1-induced hepatocarcinogenesis (Buetler et al., 1996Go; Johnson et al., 1997Go; Raney et al., 1992bGo). Although the possibility of induction of certain unidentified nonconstitutively expressed human hepatic alpha-class GSTs possessing high activity toward exo-AFBO by oltipraz can not be excluded, evidence is mounting to suggest that induction of mu-class GSTs might be responsible, at least in part, for the increase in formation of AFB-GSH conjugates in humans (Raney et al., 1992bGo; Slone et al., 1995Go; Wang et al., 2000Go). Recent molecular epidemiology studies in populations at high risk for AFB-related liver cancer provide additional circumstantial evidence that human GSTM1 might contribute to hepatic detoxification of AFBO (Chen et al., 1996Go; Sun et al., 2001Go).


    ACKNOWLEDGMENTS
 
This work was supported by NIEHS Center Grant P30-ES07033, Primate Center P51-RR00166, and by NIEHS grant R01-ES05780. The excellent technical assistance of Mr. Dennis Slone is appreciated.


    NOTES
 
1 To whom correspondence should be addressed. Fax: (206) 685-4696. E-mail: deaton{at}u.washington.edu. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Buetler, T. M., Bammler, T. K., Hayes, J. D., and Eaton, D. L. (1996). Oltipraz-mediated changes in aflatoxin B1 biotransformation in rat liver: Implications for human chemointervention. Cancer Res. 56, 2306–2313.[Abstract/Free Full Text]

Buetler, T. M., and Eaton, D. L. (1992). Complementary DNA cloning, messenger RNA expression, and induction of alpha-class glutathione S-transferases in mouse tissues. Cancer Res. 52, 314–318.[Abstract/Free Full Text]

Buetler, T. M., Gallagher, E. P., Wang, C., Stahl, D. L., Hayes, J. D., and Eaton, D. L. (1995). Induction of phase I and phase II drug-metabolizing enzyme mRNA, protein, and activity by BHA, ethoxyquin, and oltipraz. Toxicol. Appl. Pharmacol. 135, 45–57.[Web of Science][Medline]

Buetler, T. M., Slone, D., and Eaton, D. L. (1992). Comparison of the aflatoxin B1-8,9-epoxide conjugating activities of two bacterially expressed alpha class glutathione S-transferase isozymes from mouse and rat. Biochem. Biophys. Res. Commun. 188, 597–603.[Web of Science][Medline]

Cabral, J. R., and Neal, G. E. (1983). The inhibitory effects of ethoxyquin on the carcinogenic action of aflatoxin B1 in rats. Cancer Lett. 19, 125–132.[Web of Science][Medline]

Chen, C. J., Yu, M. W., Liaw, Y. F., Wang, L. W., Chiamprasert, S., Matin, F., Hirvonen, A., Bell, D. A., Santella, R. M. (1996). Chronic hepatitis B carriers with null genotypes of glutathione S-transferase M1 and T1 polymorphisms who are exposed to aflatoxin are at increased risk of hepatocellular carcinoma. Am. J. Hum. Genet. 59, 128–134.[Web of Science][Medline]

Eaton, D. L., and Gallagher, E. P. (1994). Mechanisms of aflatoxin carcinogenesis. Annu. Rev. Pharmacol. Toxicol. 34, 135–172.[Web of Science][Medline]

Eaton, D. L., and Ramsdell, H. S. (1992). Species and diet-related differences in aflatoxin biotransformation. In Handbook of Applied Mycology: Mycotoxins in Ecological Systems (D. Bhatnagar, E. B. Lillehoj, and D. K. Arora, Eds.), pp. 157–182. Marcel Dekker, New York.

Eaton, D. L., Ramsdell, H. S., and Neal, G. E. (1994). Biotransformation of aflatoxins. In The Toxicology of Aflatoxins: Human Health, Veterinary, and Agricultural Significance (D. L. Eaton and J. D. Groopman, Eds.), pp. 45–72. Academic Press, New York.

Habig, W. H., and Jakoby, W. B. (1981). Assays for differentiation of glutathione S-transferases. Methods Enzymol. 77, 398–405.[Medline]

Hagen, F. S., Gray, C. L., and Kuijper, J. L. (1988). Assaying the quality of cDNA libraries. Biotechniques 6, 340–345.[Web of Science][Medline]

Hayes, J. D., Judah, D. J., McLellan, L. I., Kerr, L. A., Peacock, S. D., and Neal, G. E. (1991a). Ethoxyquin-induced resistance to aflatoxin B1 in the rat is associated with the expression of a novel alpha-class glutathione S-transferase subunit, Yc2, which possesses high catalytic activity for aflatoxin B1-8,9-epoxide. Biochem. J. 279, 385–398.

Hayes, J. D., Judah, D. J., McLellan, L. I., and Neal, G. E. (1991b). Contribution of the glutathione S-transferases to the mechanisms of resistance to aflatoxin B1. Pharmacol. Ther. 50, 443–472.[Web of Science][Medline]

Hayes, J. D., Judah, D. J., Neal, G. E., and Nguyen, T. (1992). Molecular cloning and heterologous expression of a cDNA encoding a mouse glutathione S-transferase Yc subunit possessing high catalytic activity for aflatoxin B1-8,9-epoxide. Biochem. J. 285, 173–180.

Hayes, J. D., McLeod, R., Ellis, E. M., Pulford, D. J., Ireland, L. S., McLellan, L. I., Judah, D. J., Manson, M. M., and Neal, G. E. (1996). Regulation of glutathione S-transferases and aldehyde reductase by chemoprotectors: Studies of mechanisms responsible for inducible resistance to aflatoxin B1. IARC Sci. Publ. 175–187.

Hayes, J. D., Nguyen, T., Judah, D. J., Petersson, D. G., and Neal, G. E. (1994). Cloning of cDNAs from fetal rat liver encoding glutathione S-transferase Yc polypeptides. The Yc2 subunit is expressed in adult rat liver resistant to the hepatocarcinogen aflatoxin B1. J. Biol. Chem. 269, 20707–20717.[Abstract/Free Full Text]

Hayes, J. D., and Pulford, D. J. (1995) The glutathione S-transferase supergene family: Regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit. Rev. Biochem. Mol. Biol. 30, 445–600.[Web of Science][Medline]

Johnson, W. W., Ueng, Y. F., Widersten, M., Mannervik, B., Hayes, J. D., Sherratt, P. J., Ketterer, B., and Guengerich, F. P. (1997). Conjugation of highly reactive aflatoxin B1 exo-8,9-epoxide catalyzed by rat and human glutathione transferases: Estimation of kinetic parameters. Biochemistry 36, 3056–3060.[Medline]

Kensler, T. W. (1997). Chemoprevention by inducers of carcinogen detoxication enzymes. Environ. Health Perspect. 105, 965–970.

Kensler, T. W., Groopman, J. D., Eaton, D. L., Curphey, T. J., and Roebuck, B. D. (1992). Potent inhibition of aflatoxin-induced hepatic tumorigenesis by the monofunctional enzyme inducer 1,2-dithiole-3-thione. Carcinogenesis 13, 95–100.[Abstract/Free Full Text]

Kensler, T. W., He, X., Otieno, M., Egner, P. A., Jacobson, L. P., Chen, B., Wang, J. S., Zhu, Y. R., Zhang, B. C., Wang, J. B., Wu, Y., Zhang, Q. N., Qian, G. S., Kuang, S. Y., Fang, X., Li, Y. F., Yu, L. Y., Prochaska, H. J., Davidson, N. E., Gordon, G. B., Gorman, M. B., Zarba, A., Enger, C., Munoz, A., Helzlsouer, K. J., and et al. (1998). Oltipraz chemoprevention trial in Qidong, People’s Republic of China: Modulation of serum aflatoxin albumin adduct biomarkers. Cancer Epidemiol. Biomarkers Prev. 7, 127–134.[Abstract]

Kwak, M. K., Egner, P. A., Dolan, P. M., Ramos-Gomez, M., Groopman, J. D., Itoh, K., Yamamoto, M., and Kensler, T. W. (2001). Role of phase 2 enzyme induction in chemoprotection by dithiolethiones. Mutat. Res. 480–481, 305–315.

Mannervik, B., Awasthi, Y. C. , Board, P. G., Hayes, J. D., Di Ilio, C., Ketterer, B., Listowsky, I., Morgenstern, R., Muramatsu, M., Pearson, W. R., et al. (1992) Nomenclature for human glutathione transferases. Biochem. J. 282, 305–306.

McHugh, T. E., Atkins, W. M., Racha, J. K., Kunze, K. L., and Eaton, D. L. (1996). Binding of the aflatoxin-glutathione conjugate to mouse glutathione S-transferase A3-3 is saturated at only one ligand per dimer. J. Biol. Chem. 271, 27470–27474.[Abstract/Free Full Text]

Monroe, D. H., and Eaton, D. L. (1987). Comparative effects of butylated hydroxyanisole on hepatic in vivo DNA binding and in vitro biotransformation of aflatoxin B1 in the rat and mouse. Toxicol. Appl. Pharmacol. 90, 401–409.[Web of Science][Medline]

Morel, F., Fardel, O., Meyer, D. J., Langouet, S., Gilmore, K. S., Meunier, B., Tu, C. P., Kensler, T. W., Ketterer, B., and Guillouzo, A. (1993). Preferential increase of glutathione S-transferase class alpha transcripts in cultured human hepatocytes by phenobarbital, 3-methylcholanthrene, and dithiolethiones. Cancer Res. 53, 231–234.[Abstract/Free Full Text]

Moss, E. J., and Neal, G. E. (1985). The metabolism of aflatoxin B1 by human liver. Biochem. Pharmacol. 34, 3193–3197.[Web of Science][Medline]

Primiano, T., Egner, P. A., Sutter, T. R., Kelloff, G. J., Roebuck, B. D., and Kensler, T. W. (1995). Intermittent dosing with oltipraz: Relationship between chemoprevention of aflatoxin-induced tumorigenesis and induction of glutathione S-transferases. Cancer Res. 55, 4319–4324.[Abstract/Free Full Text]

Ramsdell, H. S., and Eaton, D. L. (1990). Mouse liver glutathione S-transferase isoenzyme activity toward aflatoxin B1-8,9-epoxide and benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide. Toxicol. Appl. Pharmacol. 105, 216–225.[Web of Science][Medline]

Raney, K. D., Coles, B., Guengerich, F. P., and Harris, T. M. (1992a). The endo-8,9-epoxide of aflatoxin B1: A new metabolite. Chem. Res. Toxicol. 5, 333–335.[Web of Science][Medline]

Raney, K. D., Meyer, D. J., Ketterer, B., Harris, T. M., and Guengerich, F. P. (1992b). Glutathione conjugation of aflatoxin B1 exo- and endo-epoxides by rat and human glutathione S-transferases. Chem. Res. Toxicol. 5, 470–478.[Web of Science][Medline]

Slone, D. H., Gallagher, E. P., Ramsdell, H. S., Rettie, A. E., Stapleton, P. L., Berlad, L. G., and Eaton, D. L. (1995). Human variability in hepatic glutathione S-transferase-mediated conjugation of aflatoxin B1-epoxide and other substrates. Pharmacogenetics 5, 224–233.[Web of Science][Medline]

Sun, C. A., Wang, L. Y., Chen, C. J., Lu, S. N., You, S. L., Wang, L. W., Wang, Q., Wu, D. M., and Santella, R. M. (2001). Genetic polymorphisms of glutathione S-transferases M1 and T1 associated with susceptibility to aflatoxin-related hepatocarcinogenesis among chronic hepatitis B carriers: A nested case-control study in Taiwan. Carcinogenesis 22, 1289–1294.[Abstract/Free Full Text]

van Ness, K. P., McHugh, T. E., Bammler, T. K., and Eaton, D. L. (1998). Identification of amino acid residues essential for high aflatoxin B1-8,9-epoxide conjugation activity in alpha class glutathione S-transferases through site-directed mutagenesis. Toxicol. Appl. Pharmacol. 152, 166–174.[Web of Science][Medline]

Wang, C., Bammler, T. K., Guo, Y., Kelly, E. J., and Eaton, D. L. (2000). Mu-class GSTs are responsible for aflatoxin B1-8,9-epoxide-conjugating activity in the nonhuman primate Macaca fascicularis liver. Toxicol. Sci. 56, 26–36.[Abstract/Free Full Text]

Wang, C., and Eaton, D. L. (1998). Identification of hepatic glutathione S-transferases involved in aflatoxin B1 detoxification in the non-human primate, Macaca fascicularis (Mf). Proceedings of the EightyNinth Annual Meeting American Association for Cancer Research 39, 456 (Abstract).

Wang, J. S., Huang, T., Su, J., Liang, F., Wei, Z., Liang, Y., Luo, H., Kuang, S. Y., Qian, G. S., Sun, G., He, X., Kensler, T. W., and Groopman, J. D. (2001). Hepatocellular carcinoma and aflatoxin exposure in Zhuqing Village, Fusui County, People‘s Republic of China. Cancer Epidemiol. Biomarkers Prev. 10, 143–146.[Abstract/Free Full Text]

Wang, J. S, Shen, X., He, X., Zhu, Y. R., Zhang, B. C., Wang, J. B., Qian, G. S., Kuang, S. Y., Zarba, A., Egner, P. A., Jacobson, L. P., Munoz, A., Helzlsouer, K. J., Groopman, J. D., and Kensler, T. W. (1999). Protective alterations in phase 1 and 2 metabolism of aflatoxin B1 by oltipraz in residents of Qidong, People‘s Republic of China. J. Natl. Cancer Inst. 91, 347–354.[Abstract/Free Full Text]

Wogan, G. (1973). Aflatoxin carcinogenesis. In Methods of Cancer Research (H. Busch, Ed.), pp. 309–344. Academic Press, New York.

Wogan, G. N., and Newberne, P. M. (1967). Dose-response characteristics of aflatoxin B1 carcinogenesis in the rat. Cancer Res. 27, 2370–2376.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wang, C.
Right arrow Articles by Eaton, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, C.
Right arrow Articles by Eaton, D. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?