ToxSci Advance Access originally published online on March 7, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences 72, 201-209 (2003)
Copyright © 2003 by the Society of Toxicology
CARCINOGENICITY |
Male Mice Deficient in Microsomal Epoxide Hydrolase Are Not Susceptible to Benzene-Induced Toxicity

* CIIT Centers for Health Research, Research Triangle Park, North Carolina 27709; and
National Cancer Institute, Bethesda, Maryland 20892
Received October 23, 2002; accepted December 11, 2002
| ABSTRACT |
|---|
|
|
|---|
Enzymes involved in benzene metabolism are likely genetic determinants of benzene-induced toxicity. Polymorphisms in human microsomal epoxide hydrolase (mEH) are associated with an increased risk of developing leukemia, specifically those associated with benzene. This study was designed to investigate the importance of mEH in benzene-induced toxicity. Male and female mEH-deficient (mEH/) mice and background mice (129/Sv) were exposed to inhaled benzene (0, 10, 50, or 100 ppm) 5 days/week, 6 h/day, for a two-week duration. Total white blood cell counts and bone marrow cell counts were used to assess hematotoxicity and myelotoxicity. Micronucleated peripheral blood cells were counted to assess genotoxicity, and the p21 mRNA level in bone marrow cells was used as a determinant of the p53-regulated DNA damage response. Male mEH/ mice did not have any significant hematotoxicity or myelotoxicity at the highest benzene exposure compared to the male 129/Sv mice. Significant hematotoxicity or myelotoxicity did not occur in the female mEH/ or 129/Sv mice. Male mEH/ mice were also unresponsive to benzene-induced genotoxicity compared to a significant induction in the male 129/Sv mice. The female mEH/ and 129/Sv mice were virtually unresponsive to benzene-induced genotoxicity. While p21 mRNA expression was highly induced in male 129/Sv mice after exposure to 100-ppm benzene, no significant alteration was observed in male mEH/ mice. Likewise, p21 mRNA expression in female mEH/ mice was not significantly induced upon benzene exposure whereas a significant induction was observed in female 129/Sv mice. Thus mEH appears to be critical in benzene-induced toxicity in male, but not female, mice.
Key Words: benzene; bone marrow; genotoxicity; hematotoxicity; leukemia; mEH; micronuclei.
| INTRODUCTION |
|---|
|
|
|---|
Benzene, a commonly used industrial chemical, is a carcinogen, genotoxin, and hematotoxin in humans and rodents (Sanz et al., 1997
The metabolism of benzene is complex and consists of many possible pathways (Fig. 1
). Cytochrome P4502E1 (CYP2E1) is essential for benzene metabolism; without this enzyme, no hematotoxicity or genotoxicity was observed in mice (Valentine et al., 1996
). Many of the metabolites, such as benzene oxide and 1,4-benzoquinone can lead to toxic effects (Ross, 2000
; Smith, 1996
). The pathway most commonly studied with respect to benzene-induced toxicity is the hydroquinone pathway (Ross, 2000
; Smith, 1996
). Microsomal epoxide hydrolase (mEH; E.C. 3.3.2.3) converts benzene oxide to benzene dihydrodiol, which is then converted to catechol by a dehydrogenase (Ross, 2000
). In an in vitro system, mEH can convert benzene oxide to hydroquinone and phenol metabolites (Snyder et al., 1993
). In addition, there is significant controversy regarding the production of trans,trans-muconaldehyde through the dihydrodiol intermediate in the mEH pathway (Witz et al., 1996
). Thus the importance of mEH in benzene metabolism is unclear.
|
The hydrolysis of xenobiotic epoxides to form the vicinal dihydrodiol is catalyzed by mEH (Fretland and Omiecinski, 2000
C substitution causing a histidine to replace a tyrosine at residue 113, results in a 4050% decrease in enzyme activity (slow-activity) (Hassett et al., 1994
G substitution results in an arginine replacing a histidine at residue 139, leading to a 25% increase in activity (fast-activity) (Hassett et al., 1994
Mice deficient in mEH expression and activity have a portion of exon 2 deleted and have no unusual phenotype, suggesting that mEH is not essential for reproduction and physiological homeostasis (Miyata et al., 1999
). The mEH-deficient mice did not bioactivate 7,12-dimethylbenz[a]anthracene (DMBA) to the carcinogenic metabolite 3,4-diol-1,2-oxide and are therefore highly resistant to DMBA-induced carcinogenesis (Miyata et al., 1999
). This finding supports a role for mEH in bioactivating certain polycyclic aromatic hydrocarbons. We hypothesized that mice deficient in mEH have a reduced response to benzene-induced toxicity due to a decrease in the amount of toxic metabolites produced. In this study, using 129/sv (background) and mEH/ mice, we demonstrate that mEH is critical in benzene-induced genotoxicity, hematotoxicity, and induction of the p53 DNA damage response in male, but not female, mice.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animal husbandry.
We maintained a pathogen-free mEH/ colony and a 129/Sv (background strain) colony in the CIIT animal facility after the animals were rederived at Charles River (Wilmington, MA). The mEH/ and 129/Sv mice were originally obtained from the National Cancer Institute colony (NCI, Bethesda, MD). All animal use was conducted in facilities accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care and approved by the Animal Care and Use Committee of the CIIT Centers for Health Research (CIIT). Mice were housed in shoebox-type cages in a humidity- and temperature-controlled room and provided water and pelleted open-formula rodent diet NIH-07 (Zeigler Brothers, Gardners, PA.) ad libitum. The mice were brother-sister mated, and the offspring then genotyped for mEH according to Miyata et al.(1999)
Experimental animals.
We used male and female mice that were 1012 weeks old at the start of the study. The mice were housed as described above until they were moved for acclimation to stainless steel wire mesh cages in a Hinners-style, whole-body inhalation chamber 2 weeks prior to benzene exposures. During this 2-week acclimation period, the mice were put on a reversed-light schedule (on at 1 A.M. and off at 1 P.M.), with exposures taking place during the light cycle. Only water was given during the exposures. Tissues were collected within 5 h after termination of exposure. Each exposure group, including air-exposed controls, was housed in a separate inhalation chamber. Mice used in the determination of basal CYP2E1 activity were not housed in suspended wire cages but remained in the polycarbonate shoebox caging.
CYP2E1 activity and protein content.
Liver microsomes were prepared using the method of (Guengerich, 1989
). Briefly, after mice were euthanized with 5 mg pentobarbital/mouse, livers were removed from naive male and female mice and then homogenized in 4 volumes of ice-cold buffer A (0.154 M KCl, 0.05 M Tris Base [Sigma, St. Louis, MO], pH 7.4). After centrifugation at 10,000 x g for 20 min at 4°C, the supernatant was transferred to an ultracentrifuge tube and spun at 105,000 x g for 60 min at 4°C. After removal of the supernatant, the pellet was resuspended in 7 ml of buffer B (0.05 M Tris, 0.25 M sucrose, 1 mM EDTA [Sigma], pH 7.4). The microsome solution was then centrifuged at 105,000 x g for 60 min at 4°C and the supernatant discarded. The microsome pellet was resuspended in an amount equivalent to the liver weight in buffer C (0.1 M K2HPO4, 0.25 M sucrose, pH 7.4) and frozen at 80°C until further use.
-Nitrophenol (PNP) hydroxylase activity was measured using a spectrophotometric assay (Reinke and Moyer, 1985
). Ninety percent of PNP hydroxylase activity reflects CYP2E1 activity, thus it was used as a measure of CYP2E1 activity (Tierney et al., 1992
). Incubation mixtures that contained 0.1M potassium phosphate buffer, 0.1 mM PNP, 1.0 mM ascorbate, and 0.4 mg/ml liver microsomal protein were preincubated for 3 min at 37°C prior to the addition of 1.0 mM NADPH. In control incubation mixtures, NADPH was replaced with an equivalent amount of deionized H2O. The total incubation volume was 1.0 ml. The incubation was performed for 7.5 min at 37°C in a shaking water bath and terminated by adding 0.2 ml 1.5 N perchloric acid. The sample was diluted 10:1 with 10 N NaOH, and the absorbance was measured at 546 nm on a Beckman DU 650 spectrophotometer (Fullerton, CA). The concentration of 4-nitrocatechol was determined using an extinction coefficient of 10.28 cm2/mol (Reinke and Moyer, 1985
).
Laemmli sample buffer (Bio-Rad, Hercules, CA) was added directly to microsomal protein and boiled for 5 min. Eight µg protein per sample was loaded onto a 10% polyacrylamide SDSPAGE gel. The gel was electrophoresed and then transferred onto Immobilon-P transfer membrane (Millipore, Bedford, MA). The membrane was blocked for 2 h in 5% milk plus 0.1% Tween-20 (Sigma, St. Louis, MO) in PBS (GibcoBRL-Gaithersburg, MD) followed by an overnight incubation at 4°C with the primary polyclonal rat cytochrome P450 CYP2E1 antibody (Gentest Corporation, Woburn, MA) at a 1:1000 dilution in 0.5% milk in PBS. After 3 washes in 1% milk plus 0.1% Tween-20, the secondary antibody anti-goat-horseradish peroxidase (Santa Cruz Biotechnologies, Santa Cruz, CA) was used at a 1:20,000 dilution in 0.5% milk in PBS for a 1-h incubation at room temperature, followed by more washes. The signal was detected using West Pico Chemiluminescence (Pierce Endogen, Rockford, IL). Densitometry was done using the BIO-RAD Quantity One Quantitation software (Ver. 4).
Experimental design.
This study used three benzene exposure groups (10, 50, and 100 ppm benzene) and one control air-exposed group (0 ppm). Exposure levels were chosen based on a pilot study using 0, 10, and 100 ppm benzene exposure levels in older mice (data not shown). Mice were exposed to benzene 5 days/week, for 6 h/day for a 2-week duration, in all experiments based on previous studies (Farris et al., 1997
).
A previous time course in male 129/SvJ (Jackson Laboratories) mice demonstrated that the optimal sampling time point for determining peak levels of micronucleated reticulocytes (MN-RET; immature RBC) and p21 mRNA expression was within 5 h postexposure relative to 12 or 24 h post exposure (A.K. Bauer and L. Recio, unpublished data). Following termination of exposure and chamber off gasing, mice were brought to the necropsy facilities and euthanized with an ip injection of 5 mg pentobarbital/mouse (Abbott Laboratories, Chicago, IL). Blood was collected by cardiac puncture into microcontainers (Becton Dickenson, San Jose, CA) containing EDTA for total white blood cell counts. Additional blood was collected for MN analysis. The bones were then removed, femurs followed by humerus.
Benzene exposure.
Benzene exposure methods are described in detail (Healy et al., 2001
). Benzene (Sigma, St. Louis, MO) purity was assessed prior to inhalation by the CIIT inhalation facility, and all benzene exposures were controlled by the Andover Infinity system (Andover Controls, Corp., Andover, MA). Benzene exposure atmospheres were measured at least six times per exposure with infrared spectrophotometers (MIRAN 1A, The Foxboro Co., Foxboro, MA). The chambers were operated with a continuous flow of HEPA-filtered air at approximately 1800 L/min. Control mice (0 ppm) were exposed to a continuous flow of conditioned HEPA-filtered air in inhalation chambers.
MN analysis in blood.
The enumeration of MN is a measure of genotoxicity (Hayashi et al., 2000
). The Prototype Microflowplus Mouse Micronucleus Analysis Kit and protocol (Litron Laboratories, Rochester, NY) was used to determine the frequency or percentage of MN-RET and MN-normochromatic erythrocytes (NCE) in mouse blood by flow cytometry. Briefly, approximately 50 µl of blood was collected and suspended in 300 µl anticoagulant (solution B; proprietary solution of Litron Laboratory). One hundred eighty µl of the suspension was then injected into 2 ml cold methanol (-80°C) and kept at 80°C until further processing. On the day of analysis, samples were inverted several times, followed by addition of solution C (proprietary solution of Litron Laboratory). Cells were then centrifuged at 4°C for 5 min and incubated with a CD71 (transferrin receptor)-FITC conjugated antibody and RNase. Propidium iodide (PI) solution was then added to the cells immediately prior to flow cytometry analysis on a FACSVantage (Becton Dickenson, San Jose, CA). Malaria-infected cells were used as a reference standard to consistently define the micronucleus analysis windows and to establish proper PMT voltages and compensation (Dertinger et al., 1996
). Nucleated cells in the peripheral blood other than the RET and NCE were gated out. MN were defined as PI-positive cells, RET were identified as CD71-positive cells, and NCE were identified as CD71-negative cells (Serke and Huhn, 1992
).
Hematology.
White blood cells were counted on an Advia 120 Hematology System (Bayer Diagnostics, Tarrytown, NY) by a contract hematology laboratory (Antech Diagnostics, New York, NY).
Bone marrow preparation.
After the bones were removed, the femur marrow cavity was flushed with RNAlater (Ambion, Austin, TX) to preserve the RNA. The RNA samples were kept at 4°C and processed within 6 weeks. Both humeri were flushed with Hanks balanced salt solution (Sigma) plus 5% albumin (Sigma) to preserve the cellular viability while manipulations were done. Total humoral cell counts were determined on a coulter counter (Model ZM, Coulter Electronics Ltd., Hialeah, FL) and used as a measure of myelotoxicity.
Real-time quantitative RT-PCR for p21 mRNA expression.
Total RNA from bone marrow was isolated using the Qiagen RNAeasy Kit (Qiagen, Valencia, CA), including DNase treatment. RNA was quantified by measuring the absorbance at 260 nm on a Beckman DU 650 Spectrophotometer (Beckman Coulter, Fullerton, CA). Reverse-transcription (RT) reactions were performed with 2 µg of total RNA, using the Reverse Transcription Kit from Applied Biosystems (Foster City, CA). The ABI 7700 Prism Sequence Detection System, using Sybr green (Applied Biosystems) was used to quantify p21 mRNA expression. PCR primers specific for p21 and gapdh (glyceraldehyde-3-phosphate dehydrogenase; for normalization) were determined using Primer Express Software (Applied Biosystems; Boley et al., 2002
). The primers 5'
3' are p21 (forward) atgtccaatcctggtgatgt, (reverse) tgcagcagggcagaggaagt; gapdh (forward) aatgtgtccgtcgtggatctga, (reverse) gatgcctgcttcaccaccttct (Boley et al., 2002
). The reaction conditions and data analysis were performed according to the manufacturers recommended protocol. All samples were run in triplicate using GAPDH as the calibrator gene, since GAPDH levels do not change across genotypes or with benzene exposure (Boley et al., 2002
).
Statistical analysis.
All data are presented as the mean ± standard error of the mean (SEM). A three-way analysis of variance (ANOVA) was done on each variable with the three main-effect factors of gender, strain, and exposure level and their first-order interactions. If any of the interactions were significant, additional analyses were done so that the nature of the interaction could be understood. Tukeys multiple comparison procedure was used to determine differences among significant factors with three or more levels; p < 0.05 was used as the level of significance for all statistical tests. A Pearson correlation coefficient was calculated for the two variables MN-RET percentages and p21 mRNA fold-increases. Statistical analyses were done using SAS Statistical Software (SAS Institute, Inc., Cary, NC).
| RESULTS |
|---|
|
|
|---|
Basal PNP hydroxylase activity and CYP2E1 protein content in liver microsomes of mEH/ and 129/Sv mice.
We determined whether the basal activity of CYP2E1 was altered in the mEH/ vs. 129/Sv mice to assure that any differences in benzene metabolism were not the result of altered CYP2E1 activity. Male 129/Sv mice had significantly higher PNP hydroxylase activity compared to male mEH/ mice; however, the fold increase was only 1.5-fold suggesting that this difference is likely not biologically relevant (Bauer et al., in press; Table 1
|
|
Hematotoxicity and myelotoxicity in mEH/ and 129/Sv mice exposed to benzene.
Benzene causes hematotoxicity, typically reflected in a decrease in WBC, and myelotoxicity in rodents (Farris et al., 1997
|
|
MN analysis as a measure of the genotoxic stress response in the peripheral blood of mice exposed to inhaled benzene.
Genotoxicity, measured by MN-RET and MN-NCE, was seen in the male 129/Sv mice at the 100-ppm exposure level (14-fold increase in MN-RET and 2.7-fold increase in MN-NCE) compared to 0 ppm, but barely seen in the male mEH/ mice (1.7-fold increase in MN-RET and 1.2-fold increase in MN-NCE) (Figs. 5A and 6A
|
|
Analysis of a DNA-damage response in mEH/ and 129/Sv mice exposed to benzene.
The p53 tumor suppressor is typically induced in response to DNA damage, followed by the induction of genes such as p21, which can lead to a cell cycle arrest (Prives and Hall, 1999
|
| DISCUSSION |
|---|
|
|
|---|
Although benzene has been linked to leukemia and lymphoma in humans since the 1970s, studies are still ongoing to determine the health risks of this chemical (Phillips and Johnson, 2001
In the present study, we found that male mice deficient in mEH enzyme activity were unresponsive to benzene in contrast to male 129/Sv mice, which developed significant benzene-induced hematotoxicity, myelotoxicity, and genotoxicity. Female 129/Sv mice exhibited very little response to benzene, as revealed by no significant differences in hematotoxicity, myelotoxicity, and genotoxicity between the female 129/Sv and mEH/ mice. Expression of p21 mRNA was greatly elevated in the male 129/Sv mice and to a lesser degree in the female 129/Sv mice, while no changes were seen in either gender of the mEH/ mice.
The gender differences seen in the 129/Sv strain are not unique. Other rodent studies have demonstrated gender differences in MN, sister chromatin exchanges, and benzene metabolism (Kenyon et al., 1995
; Luke et al., 1988
; Meyne and Legator, 1980
). The cause of these differences has not been discerned but may involve metabolic differences between the two genders (Kenyon et al., 1995
). Whether gender differences occur in humans with respect to benzene-induced toxicity is not clear. One study observed that women have a slightly lower risk of cancer mortality due to benzene compared to men (Li et al., 1994
). However, most epidemiological studies to date have not studied both genders (Aksoy and Erdem, 1978
; Rothman et al. (see above), 1997; Yin et al., 1996
). The present work suggests that more gender-specific studies are necessary to address this issue.
Our results in the mEH/ mice demonstrating a male-specific effect are consistent with the recent article by Lebailly et al.(2002)
, describing chromosomal aberrations similar to those seen with benzene in men with the fast-activity phenotype of mEH. The similar chromosome abnormalities seen were translocations at chromosomes 8 and 21 and chromosome 7 deletions on 7q (Lebailly et al., 2002
). These investigators also found that only men with the high-activity phenotype are at a higher risk of developing AML. The Lebailly et al. association study suggests that polymorphisms in mEH may be risk factors for AML in those individuals with the chromosomal abnormalities discussed above. In addition, Cavalieri et al.(2002)
found that the quinone derived from catechol (1,2-benzoquinone) can form depurinating DNA adducts that could initiate cancer, which further supports the importance of this pathway in benzene metabolism. Our data demonstrates that male mice are affected by deleting part of the mEH gene. However, determining the importance of mEH in females is difficult because the females have such a small response to benzene. In addition to mEH, we recently studied mice deficient in NQO1 activity and found that female NQO1/ mice developed benzene-induced genotoxicity and hematotoxicity compared to the NQO1+/+ mice, which were unresponsive (Bauer et al., 2003
). However, male NQO1/ mice were only more sensitive to benzene hematotoxicity compared to the NQO1+/+ mice. These results further support the need to assess the many different enzymes and gender differences involved in benzene metabolism to identify individuals that are at a higher risk of benzene toxicity and possibly leukemogenesis. Additional studies determining differences in the benzene metabolism pathway will be done using the mEH/ mice to further understand the responses described here.
| ACKNOWLEDGMENTS |
|---|
We thank Jason Rose, Earl Tewksbury, Horace Parkinson, Jeanne Galbo, the CIIT necropsy and histopathology unit, the animal care unit, and the CIIT inhalation unit for all of their help with this study. We also thank Barbara Kuyper for editorial review, David Dorman and Kevin Gaido for critically reviewing the manuscript, and Dennis House for statistical analysis. This work was supported in part by NIEHS NRSA 1F32 ES1142401 (A.K.B.).
| NOTES |
|---|
1 To whom correspondence should be sent at present address: Laboratory of Pulmonary Pathobiology, E214, Bldg. 101, National Institute of Environmental Health Sciences, 111 T.W. Alexander Dr., Research Triangle Park, NC, 27709. Fax: (919) 541-4133. E-mail: bauer1{at}niehs.nih.gov.
| REFERENCES |
|---|
|
|
|---|
Aksoy, M., and Erdem, S. (1978). Followup study on the mortality and the development of leukemia in 44 pancytopenic patients with chronic exposure to benzene. Blood 52, 285292.
Bauer, A. K., Faiola, B., Abernethy, D. J., Marchan, R., Pluta, L. J., Wong, V. A., Roberts, K., Jaiswal, A. K., Gonzalez, F. J., Butterworth, B. E., et al. (2003). Genetic susceptibility to benzene-induced toxicity: Role of NAD(P)H: Quinone Oxidoreductase-1. Cancer Res. 63, 929935.
Benhamou, S., Reinikainen, M., Bouchardy, C., Dayer, P., and Hirvonen, A. (1998). Association between lung cancer and microsomal epoxide hydrolase genotypes. Cancer Res. 58, 52915293.
Boley, S. E., Wong, V. A., French, J. E., and Recio, L. (2002). p53 Heterozygosity alters the mRNA expression of p53 target genes in the bone marrow in response to inhaled benzene. Toxicol. Sci. 66, 209215.
Cavalieri, E. L., Li, K. M., Balu, N., Saeed, M., Devanesan, P., Higginbotham, S., Zhao, J., Gross, M. L., and Rogan, E. G. (2002). Catechol ortho-quinones: The electrophilic compounds that form depurinating DNA adducts and could initiate cancer and other diseases. Carcinogenesis 23, 10711977.
Dertinger, S. D., Torous, D. K., and Tometsko, K. R. (1996). Simple and reliable enumeration of micronucleated reticulocytes with a single-laser flow cytometer. Mutat. Res. 371, 283292.[CrossRef][Web of Science][Medline]
Farris, G. M., Robinson, S. N., Gaido, K. W., Wong, B. A., Wong, V. A., Hahn, W. P., and Shah, R. S. (1997). Benzene-induced hematotoxicity and bone marrow compensation in B6C3F1 mice. Fundam. Appl. Toxicol. 36, 119129.[CrossRef][Web of Science][Medline]
Fretland, A. J., and Omiecinski, C. J. (2000). Epoxide hydrolases: Biochemistry and molecular biology. Chem. Biol. Interact. 129, 4159.[CrossRef][Web of Science][Medline]
Guengerich, F. P. (1989). Analysis and characterization of enzymes. In Principles and Methods of Toxicology (A. W. Hayes, Ed.), 2nd ed., pp. 784-785. Raven Press, New York.
Harrison, D. J., Hubbard, A. L., MacMillan, J., Wyllie, A. H., and Smith, C. A. (1999). Microsomal epoxide hydrolase gene polymorphism and susceptibility to colon cancer. Br. J. Cancer 79, 168171.[CrossRef][Web of Science][Medline]
Hassett, C., Aicher, L., Sidhu, J. S., and Omiecinski, C. J. (1994). Human microsomal epoxide hydrolase: Genetic polymorphism and functional expression in vitro of amino acid variants. Hum. Mol. Genet.3, 421428.
Hayashi, M., MacGregor, J. T., Gatehouse, D. G., Adler, I. D., Blakey, D. H., Dertinger, S. D., Krishna, G., Morita, T., Russo, A., and Sutou, S. (2000). In vivo rodent erythrocyte micronucleus assay: II. Some aspects of protocol design including repeated treatments, integration with toxicity testing, and automated scoring. Environ. Mol. Mutagen 35, 234252.[CrossRef][Web of Science][Medline]
Hayes, R. B., Yin, S. N., Dosemeci, M., and Linet, M. (2001). Benzene and lymphohematopoietic malignancies in humans. Am. J. Ind. Med. 40, 117126.[CrossRef][Web of Science][Medline]
Healy, L. N., Pluta, L. J., James, R. A., Janszen, D. B., Torous, D., French, J. E., and Recio, L. (2001). Induction and time-dependent accumulation of micronuclei in peripheral blood of transgenic p53+/ mice, Tg.AC (v-Ha-ras) and parental wild-type (C57BL/6 and FVB/N) mice exposed to benzene by inhalation. Mutagenesis 16, 163168.
IARC (2002). Tobacco smoke and involuntary smoking: Summary of data reported and evaluation. In IARC monographs on the evaluation of carcinogenic risks to humans, Vol. 83. International Agency for Research on Cancer. http://193.51.164.11/htdocs/monographs/vol83/02-involuntary.html. Accessed September 10, 2002.
Kenyon, E. M., Seeley, M. E., Janszen, D., and Medinsky, M. A. (1995). Dose-, route-, and sex-dependent urinary excretion of phenol metabolites in B6C3F1 mice. J. Toxicol. Environ. Health 44, 219233.[Web of Science][Medline]
Lebailly, P., Willett, E. V., Moorman, A. V., Roman, E., Cartwright, R., Morgan, G. J., and Wild, C. P. (2002). Genetic polymorphisms in microsomal epoxide hydrolase and susceptibility to adult acute myeloid leukaemia with defined cytogenetic abnormalities. Br. J. Haematol. 116, 587594.[CrossRef][Web of Science][Medline]
Li, G. L., Linet, M. S., Hayes, R. B., Yin, S. N., Dosemeci, M., Wang, Y. Z., Chow, W. H., Jiang, Z. L., Wacholder, S., Zhang, W. U., et al. (1994). Gender differences in hematopoietic and lymphoproliferative disorders and other cancer risks by major occupational group among workers exposed to benzene in China. J. Occup. Med. 36, 875881.[Web of Science][Medline]
London, S. J., Smart, J., and Daly, A. K. (2000). Lung cancer risk in relation to genetic polymorphisms of microsomal epoxide hydrolase among African-Americans and Caucasians in Los Angeles County. Lung Cancer 28, 147155.[CrossRef][Web of Science][Medline]
Luke, C. A., Tice, R. R., and Drew, R. T. (1988). The effect of exposure regimen and duration on benzene-induced bone marrow damage in mice: II. Strain comparisons involving B6C3F1, C57B1/6, and DBA/2 male mice. Mutat. Res. 203, 273295.[Web of Science][Medline]
McGlynn, K. A., Rosvold, E. A., Lustbader, E. D., Hu, Y., Clapper, M. L., Zhou, T., Wild, C. P., Xia, X. L., Baffoe-Bonnie, A., Ofori-Adjei, D., et al. (1995). Susceptibility to hepatocellular carcinoma is associated with genetic variation in the enzymatic detoxification of aflatoxin B1. Proc. Natl. Acad. Sci. U.S.A. 92, 23842387.
Meyne, J., and Legator, M. S. (1980). Sex-related differences in cytogenetic effects of benzene in the bone marrow of Swiss mice. Environ. Mutagen 2, 4350.[Web of Science][Medline]
Miyata, M., Kudo, G., Lee, Y. H., Yang, T. J., Gelboin, H. V., Fernandez-Salguero, P., Kimura, S., and Gonzalez, F. J. (1999). Targeted disruption of the microsomal epoxide hydrolase gene. Microsomal epoxide hydrolase is required for the carcinogenic activity of 7,12-dimethylbenz[a]anthracene. J. Biol. Chem. 274, 2396323968.
Oesch, F. (1973). Mammalian epoxide hydrases: Inducible enzymes catalyzing the inactivation of carcinogenic and cytotoxic metabolites derived from aromatic and olefinic compounds. Xenobiotica 3, 305340.[Web of Science][Medline]
Phillips, S. C., and Johnson, C. E. (2001). Lympho-haematopoietic Cancer and Exposure to Benzene in the Australian Petroleum Industry: Technical Report and Appendices. Exxon Mobil Corporation, Washington, D.C., 8EHQ-0901-15006.
Prives, C., and Hall, P. A. (1999). The p53 pathway. J. Pathol. 187, 112126.[CrossRef][Web of Science][Medline]
Raaschou-Nielsen, O., Hertel, O., Thomsen, B. L., and Olsen, J. H. (2001). Air pollution from traffic at the residence of children with cancer. Am. J. Epidemiol. 153, 433443.
Reinke, L. A., and Moyer, M. J. (1985). p-Nitrophenol hydroxylation. A microsomal oxidation which is highly inducible by ethanol. Drug Metab. Dispos. 13, 548552.[Abstract]
Ross, D. (2000). The role of metabolism and specific metabolites in benzene-induced toxicity: Evidence and issues. J. Toxicol. Environ. Health 61, 357372.
Ross, D., Kepa, J. K., Winski, S. L., Beall, H. D., Anwar, A., and Siegel, D. (2000). NAD(P)H:quinone oxidoreductase 1 (NQO1): Chemoprotection, bioactivation, gene regulation and genetic polymorphisms. Chem. Biol. Interact. 129, 7797.[CrossRef][Web of Science][Medline]
Rothman, N., Smith, M. T., Hayes, R. B., Traver, R. D., Hoener, B., Campleman, S., Li, G. L., Dosemeci, M., Linet, M., Zhang, L., Xi, L., Wacholder, S., Lu, W., Meyer, K. B., Titenko-Holland, N., Stewart, J. T., Yin, S., and Ross, D. (1997). Benzene poisoning, a risk factor for hematological malignancy, is associated with the NQO1 609C
T mutation and rapid fractional excretion of chlorzoxazone. Cancer Res. 57, 28392842.
Runion, H. E., and Scott, L. M. (1985). Benzene exposure in the United States 1978-1983: An overview. Am. J. Ind. Med. 7, 385393.[Web of Science][Medline]
Sanz, G. F., Sanz, M. A., and Vallespi, T. (1997). Etiopathogeny, prognosis, and therapy of myelodysplastic syndromes. Hematol. Cell Ther. 39, 277294.[CrossRef][Web of Science][Medline]
Serke, S., and Huhn, D. (1992). Identification of CD71 (transferrin receptor) expressing erythrocytes by multiparameter-flow-cytometry (MP-FCM): Correlation to the quantitation of reticulocytes as determined by conventional microscopy and by MP-FCM using an RNA-staining dye. Br. J. Haematol. 81, 432439.[Web of Science][Medline]
Sims, P., Grover, P. L., Swaisland, A., Pal, K., and Hewer, A. (1974). Metabolic activation of benzo(a)pyrene proceeds by a diol-epoxide. Nature 252, 326328.[CrossRef][Medline]
Smith, M. T. (1996). The mechanism of benzene-induced leukemia: A hypothesis and speculations on the causes of leukemia. Environ. Health Perspect. 104(Suppl. 6.), 12191225.
Smith, M. T., Zhang, L., Wang, Y., Hayes, R. B., Li, G., Wiemels, J., Dosemeci, M., Titenko-Holland, N., Xi, L., Kolachana, P., Yin, S., and Rothman, N. (1998). Increased translocations and aneusomy in chromosomes 8 and 21 among workers exposed to benzene. Cancer Res. 58, 21762181.
Snyder, R., Chepiga, T., Yang, C. S., Thomas, H., Platt, K., and Oesch, F. (1993). Benzene metabolism by reconstituted cytochromes P450 2B1 and 2E1 and its modulation by cytochrome b5, microsomal epoxide hydrolase, and glutathione transferases: Evidence for an important role of microsomal epoxide hydrolase in the formation of hydroquinone. Toxicol. Appl. Pharmacol. 122, 172181.[CrossRef][Web of Science][Medline]
Tierney, D. J., Haas, A. L., and Koop, D. R. (1992). Degradation of cytochrome P450 2E1: Selective loss after labilization of the enzyme. Arch. Biochem. Biophys. 293, 916.[CrossRef][Web of Science][Medline]
Valentine, J. L., Lee, S. S., Seaton, M. J., Asgharian, B., Farris, G., Corton, J. C., Gonzalez, F. J., and Medinsky, M. A. (1996). Reduction of benzene metabolism and toxicity in mice that lack CYP2E1 expression. Toxicol. Appl. Pharmacol. 141, 205213.[Web of Science][Medline]
Wallace, L. (1990). Major sources of exposure to benzene and other volatile organic chemicals. Risk Anal. 10, 5964.
Ward, E., Hornung, R., Morris, J., Rinsky, R., Wild, D., Halperin, W., and Guthrie, W. (1996). Risk of low red or white blood cell count related to estimated benzene exposure in a rubberworker cohort (1940-1975). Am. J. Ind. Med. 29, 247257.[CrossRef][Web of Science][Medline]
Witz, G., Zhang, Z., and Goldstein, B. D. (1996). Reactive ring-opened aldehyde metabolites in benzene hematotoxicity. Environ. Health Perspect. 104(Suppl. 6), 11951199.
Wong, O. (2002). Investigations of benzene exposure, benzene poisoning, and malignancies in China. Regul. Toxicol. Pharmacol. 35, 126135.[CrossRef][Web of Science][Medline]
Yin, S. N., Hayes, R. B., Linet, M. S., Li, G. L., Dosemeci, M., Travis, L. B., Li, C. Y., Zhang, Z. N., Li, D. G., Chow, W. H., et al. (1996). A cohort study of cancer among benzene-exposed workers in China: Overall results. Am. J. Ind. Med. 29, 227235.[CrossRef][Web of Science][Medline]
Yoon, B. I., Hirabayashi, Y., Kawasaki, Y., Kodama, Y., Kaneko, T., Kim, D. Y., and Inoue, T. (2001). Mechanism of action of benzene toxicity: Cell cycle suppression in hemapoietic progenitor cells (CFU-GM). Exp. Hematol. 29, 278285.[CrossRef][Web of Science][Medline]
Zhao, H., Spitz, M. R., Gwyn, K. M., and Wu, X. (2002). Microsomal epoxide hydrolase polymorphisms and lung cancer risk in non-Hispanic whites. Mol. Carcinog. 33, 99104.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S Wilbur, D Wohlers, S Paikoff, L. Keith, and O Faroon ATSDR evaluation of health effects of benzene and relevance to public health Toxicology and Industrial Health, June 1, 2008; 24(5-6): 263 - 398. [Abstract] [PDF] |
||||
![]() |
H. Ahmad Khan Short Review: Benzene's toxicity: a consolidated short review of human and animal studies Human and Experimental Toxicology, September 1, 2007; 26(9): 677 - 685. [Abstract] [PDF] |
||||
![]() |
S.-H. Liang, C. Hassett, and C. J. Omiecinski Alternative Promoters Determine Tissue-Specific Expression Profiles of the Human Microsomal Epoxide Hydrolase Gene (EPHX1) Mol. Pharmacol., January 1, 2005; 67(1): 220 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Abernethy, E. V. Kleymenova, J. Rose, L. Recio, and B. Faiola Human CD34+ Hematopoietic Progenitor Cells Are Sensitive Targets for Toxicity Induced by 1,4-Benzoquinone Toxicol. Sci., May 1, 2004; 79(1): 82 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Faiola, A. K. Bauer, E. S. Fuller, V. A. Wong, L. J. Pluta, D. J. Abernethy, J. B. Mangum, J. I. Everitt, and L. Recio Variations in Prkdc and Susceptibility to Benzene-Induced Toxicity in Mice Toxicol. Sci., October 1, 2003; 75(2): 321 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Marrubini, A. F. Castoldi, T. Coccini, and L. Manzo Prolonged Ethanol Ingestion Enhances Benzene Myelotoxicity and Lowers Urinary Concentrations of Benzene Metabolite Levels in CD-1 Male Mice Toxicol. Sci., September 1, 2003; 75(1): 16 - 24. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










