ToxSci Advance Access originally published online on July 25, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences 75, 333-342 (2003)
Copyright © 2003 by the Society of Toxicology
IMMUNOTOXICOLOGY |
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Alters the Regulation and Posttranslational Modification of p27kip1 in Lipopolysaccharide-Activated B Cells

* Department of Pharmacology and Toxicology, National Food Safety and Toxicology Center, Michigan State University, East Lansing, Michigan 48824, and
Department of Biology, Kyonggi University, Paldal-gu, Suwon-Si, Korea
Received April 30, 2003; accepted July 13, 2003
| ABSTRACT |
|---|
|
|
|---|
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) alters B-cell differentiation, as evidenced by a marked decrease in immunoglobulin M (IgM) secretion and in the number of antibody-forming cells (AFC) induced by antigenic stimulation. The objective of the present studies was to evaluate the effect of TCDD on the level of p27kip1, a cyclin-dependent kinase inhibitor that is a critical regulator of cellular differentiation. In the well-characterized B-cell line, CH12.LX, a modest decrease in p27kip1was observed during the initial 24-h post-LPS (lipopolysaccharide) activation, which then gradually increased above background at 48 and 72 h. Conversely, in the presence of TCDD, p27kip1was not induced and remained unchanged from LPS unstimulated cells throughout the entire 72-h period post-LPS activation. In addition, Western blotting revealed that TCDD treatment altered the profile of p27kip1 migration as compared to the LPS-activated control. Time-of-addition studies demonstrated that the greatest sensitivity of p27kip1 to TCDD treatment occurred within the initial 24-h post-LPS activation. Interestingly, LPS-induced Ig
light chain and IgM secretion also exhibited the greatest period of sensitivity (i.e., inhibition) to TCDD during the first 24-h post-LPS activation. In addition, TCDD markedly suppressed the LPS-induced differentiation of CH12.LX cells into IgM secreting AFC, with a modest but cumulative effect on cell proliferation over a 72-h period. Collectively, these findings show that TCDD altered the cellular concentration and posttranslational modification of p27kip1 in this activated B-cell line model, which occurred concomitantly with altered B-cell differentiation and suggests that cyclin-dependent kinase inhibitors may be an important intracellular target in TCDD-mediated inhibition of B-cell differentiation. Key Words: TCDD; B cell; p27kip1; LPS; cyclin-dependent kinase inhibitor.
| INTRODUCTION |
|---|
|
|
|---|
The B cell has been widely established as a sensitive immunological target of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), as evidenced by a marked suppression of immunoglobulin (Ig) production (Dooley and Holsapple, 1988
A critical aspect to the bridging of early cellular activation events with subsequent B-cell differentiation occurs through the appropriate regulation of the cell cycle. In response to antigen-specific and T-cell-derived activation signals, B cells undergo an initial proliferative burst followed by cell-cycle arrest and differentiation into Ig secreting cells (Paul and Seder, 1994
; Vazquez et al., 1986
). Cell cycle progression is controlled by a family of serine/threonine kinases called the cyclin-dependent kinases (cdk). Activation of cdk is regulated through association with regulatory subunits called cyclins. Unlike cdk, which are constitutively expressed, cyclin expression oscillates with respect to the cell cycle, allowing for controlled activation of cdk as well as substrate specificity (Fisher, 1997
; Morgan, 1995
). Cyclin-cdk complexes are controlled through several mechanisms, including accumulation of cyclins, positive and negative phosphorylation or dephosphorylation of critical tyrosine and serine/threonine residues, and specific cdk inhibitors (CKI) (Morgan 1995
; Sherr and Roberts 1995
). Several recent studies demonstrate that CKI proteins are important for B-cell activation and differentiation (Bouchard et al., 1997
; Schrantz et al., 2000
). In addition, TCDD and other AhR ligands have previously been demonstrated to alter the cellular concentration of several regulatory cell-cycle proteins, including CKI, in hepatocytes, thymocytes, and in several immature B-cell lines (Kolluri et al., 1999
; Rininger et al., 1997
; Ryu et al., 2003
). Based on the identification of a DRE (dioxin response element) in the p27kip1 promoter and the demonstration of p27kip1 modulation by TCDD, the objective of the present studies was to investigate the effects of TCDD on p27kip1 in activated B cells (Kolluri, 1999
; Kwon et al., 1996
). For these studies, the CH12.LX B-cell line was employed due to our previous characterization, showing that this cell line closely mimics the response of primary B cells to LPS activation (i.e., robust induction of IgM secretion) and sensitivity to inhibition by TCDD (Sulentic et al., 1998
, 2000
). In the present study we show that the cellular concentration of p27kip1 was significantly altered by TCDD in LPS-activated CH12.LX cells and was closely associated with the disruption of Ig regulation. These findings are concordant with several recent reports demonstrating a link between p27kip1 and differentiation in other cellular models (Bouchard et al., 1997
; Durand et al., 1997
; Hengst and Reed, 1996
; Kranenburg et al., 1995
; Schrantz et al., 2000
). Therefore, an altered effect on CKI regulation by TCDD may represent a critical event contributing to altered B-cell differentiation and Ig regulation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals.
TCDD was purchased from AccuStandard, Inc. (New Haven, CT) in 100% dimethyl sulfoxide (DMSO). The certificate of product analysis stated that the purity of TCDD was 99.1%, as determined by AccuStandard using GC/MS. DMSO and LPS were purchased from Sigma-Aldrich (St. Louis, MO).
Cell line.
The CH12.LX B cell line derived from the murine CH12 B-cell lymphoma (Arnold et al., 1983
) has been previously characterized by Bishop and Haughton, (1986)
, and was a generous gift from Dr. Geoffrey Haughton (University of North Carolina). CH12.LX cells were grown in RPMI-1640 (Gibco BRL, Grand Island, NY) supplemented with heat-inactivated 10% bovine calf serum (Hyclone, Logan, UT), 13.5 mM HEPES, 23.8 mM sodium bicarbonate, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1.0 mM sodium pyruvate, and 50 µM ß-mercaptoethanol. Cells were maintained at 37°C in an atmosphere of 5% CO2. The day before treatment, CH12.LX cells (2.5 x 104 cells/ml) were cultured in treatment media (growth media as stated above but with 5% heat-inactivated bovine calf serum [BCS]) overnight at 37°C in an atmosphere of 5% CO2.
Western blot analysis.
Western blot analysis was performed on cell lysates from CH12.LX cells. Cell lysates were prepared in HEDG (25 mM HEPES, 2 mM EDTA, 1 mM DTT, and 10% glycerol), sonicated 3 times for 5 s to break open the nuclei, and centrifuged at 100,000 x g for 1 h at 4°C. Protein concentrations were determined by the Bradford protein assay (Bio-Rad, Hercules, CA). Where indicated, cell lysates were incubated with 400 U/ml protein phosphatase (New England Biolabs, Beverly, MA) for 30 min at 30°C. Cell lysate proteins were resolved by denaturing SDSPAGE (Life Science Products, Inc., Denver, CO). The percent acrylamide, which ranged between 10 and 14%, is indicated in the figure legends. The proteins were transferred to nitrocellulose following electrophoresis (Amersham Pharmacia Biotech, Arlington Heights, IL). Protein blots were blocked in BLOTTO buffer (4% low-fat dry milk/1% BSA in 0.1% Tween-20 TBS) for 12 h at room temperature. Rabbit anti-mouse p27kip1 and rabbit anti-mouse phospho-Ser10 p27kip1 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). In addition, a second rabbit anti-mouse phospho-Ser10 p27kip1 antibody was purchased from Zymed (San Francisco, CA). Sheep HRP-conjugated anti-mouse IgG and donkey HRP-conjugated anti-rabbit IgG were purchased from Amersham Pharmacia Biotech. Immunochemical staining was performed as previously described (Williams et al., 1996
). Detection was performed using the ECL method (Amersham Pharmacia Biotech). Where indicated, protein blots were stripped and reprobed. Stripping was performed by submerging the membrane in stripping buffer [100 mM 2-ME, 2% SDS, and 62.5 mM Tris (pH 6.7)] for 30 min at 50°C. Protein blots were then washed, blocked, and reprobed as stated above. Optical density for the protein of interest was measured by densitometry using a model 700 imaging system (Bio-Rad). All blots were stripped and normalized by reprobing for ß-actin, using an anti-mouse ß-actin antibody (Sigma-Aldrich).
Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR).
Quantitative RT-PCR was performed as previously described (Williams et al., 1996
) with several modifications. Briefly, total RNA from each sample was isolated using Tri Reagent (Sigma-Aldrich). RNA samples were first analyzed for DNA contamination by PCR analysis without reverse transcriptase. Total DNA-free RNA (100 ng) and internal standard (rcRNA) were reverse transcribed simultaneously in the same reaction tube. Final reaction concentrations for the kip1 PCR reaction were 4 mM MgCl2, and 2.5 units Taq DNA polymerase (Promega, Madison, WI). Samples were cycled 30 times, with each cycle consisting of 94°C for 15 s, 57°C for 30 s, and 72°C for 45 s. PCR products were visualized by ethidium bromide staining. Quantitation was performed by assessing the optical density for both the target gene and internal standard using a Gel Doc 1000 video imaging system (Bio Rad). The number of transcripts was calculated from a standard curve generated from the density ratio between the gene of interest and a specific internal standard concentration. Primer sequences for kip1 are as follows: FP, CCGAGGAGGAAGATGTCAAACG; RP, CCAGGGGCTTATGATTCTGAAAG, with a product size of 223 bp.
DNA synthesis.
CH12.LX cells were pre-incubated overnight at 37°C in 5% CO2, then treated with TCDD (130 nM) or vehicle (0.02% DMSO) followed by LPS (5 µg/ml) stimulation at 37°C in 5% CO2. Cells were pulsed with 1 µCi of [3H]-thymidine (NEN, Boston, MA) after 18 h of stimulation and were harvested at 24 h. [3H]-thymidine incorporation was measured using a liquid scintillation analyzer and expressed as mean counts per min (CPM) ± SD.
Antibody-forming-cell (AFC) assay and cell proliferation.
One milliliter of CH12.LX cells at a density of 2.5 x 104 cells/ml was added to each well of a 24-well culture plate and pre-incubated overnight at 37°C in 5% CO2. The next day the cells were treated with TCDD (0.0110 nM) or vehicle (0.01% DMSO) and stimulated with LPS (5 µg/ml) in quadruplicate, for each treatment group, to determine the cell counts and the number of AFC. To determine the number of viable cells, 22,500 pronase units (CalBioChem, La Jolla, CA) were added to each sample and incubated for 10 min to break up cell clumps and remove nonviable cells. Ten milliliters of Isoton II (Coulter Corp., Hialeah, FL) was then added to each sample and the cells were enumerated on a model Z1 Coulter Particle Counter (Coulter Corp.). Cell viability was monitored throughout the course of the entire experiment by trypan blue (Sigma-Aldrich) exclusion. Since CH12.LX cells secrete antibodies directed against an epitope on the sheep erythrocyte (Bishop, 1986
; Mercolino, 1986) 72 h post-LPS treatment, the number of AFCs was assayed using a modification of the Jerne plaque assay as previously described (Delaney and Kaminski 1993
).
ELISA (enzyme-linked immunosorbent assay).
After a 48-h incubation at 37°C in 5% CO2, supernatants were harvested from naïve or LPS (5 µg/ml)-activated CH12.LX cells that were treated with 10 nM TCDD or vehicle (0.01% DMSO). Supernatants were analyzed for IgM by sandwich ELISA, as previously described (Sulentic et al., 1998
). Briefly, 100 µl of supernatant or standard (mouse IgM
light chain) were added to wells of a 96-well microtiter plate (Immulon 4, Dynex Technologies, Inc., Chantilly, VA) previously coated with anti-mouse Ig capture antibody (Roche Molecular Biochemicals, Indianapolis, IN), and then incubated at 37°C for 1.5 h. After the incubation period, the plate was washed with 0.05% Tween-20 PBS and H2O. A horseradish peroxidase-linked anti-mouse IgM detection antibody was added to the plate and incubated for 1.5 h at 37°C. Unbound detection antibody was washed from the plate with 0.05% Tween-20 PBS and H2O. ABTS substrate (Roche Molecular Biochemicals) was added and colorimetric detection was performed over a 1-h period, using an EL808 automated microplate reader with a 405 nm filter (Bio-Tek, Winooski, VT). The concentration of total IgM in the supernatants was calculated using a standard curve generated from the absorbance readings of known IgM
concentrations.
Statistical analysis of data.
The mean ± SD was generated for each treatment group. The statistical differences between treatment groups and the appropriate controls were determined by first performing a one-way ANOVA that was followed by a Dunnetts two-tailed t-test.
| RESULTS |
|---|
|
|
|---|
TCDD Alters the Cellular Concentration and Posttranslational Modification of p27kip1 in LPS-Activated B Cells
As demonstrated in primary B cells (Schrantz, et al., 2000
|
|
|
Phosphorylation of p27kip1 can lead either to rapid degradation through ubiquitination or increased stability, depending on the specific amino acid phosphorylated on p27kip1 (Ishida et al., 2002
phosphatase activity.
|
TCDD Targets B-Cell Differentiation
Since p27kip1 is a cell-cycle regulatory protein, the effect of TCDD on DNA synthesis and cellular proliferation of the CH12.LX cells was examined by measuring [3H]-thymidine incorporation and by determining the actual cell number, respectively, following treatment with LPS and TCDD. LPS modestly increased [3H]-thymidine incorporation at 24 h, which appeared to be inhibited by TCDD but not in a concentration-dependent manner (Fig. 5
light chain was also observed at 48 and 72 h after LPS activation in the TCDD-treated cells (Fig. 6
|
|
|
TCDD Alters the Cellular Concentration of P27kip1 if Added Prior to the First 24 H after LPS-Stimulation of CH12.LX Cells
Tucker and coworkers demonstrated that inhibition of the antibody-forming cell response by TCDD occurred only when TCDD was added within the first 24 h after addition of antigen (Tucker et al., 1986
light-chain protein, IgM secretion, and p27kip1 posttranslational modification were also critically dependent on the time of TCDD addition to culture after activation by antigen. The present study shows that TCDD must be added to cultures within 8 h of LPS stimulation for an inhibition of Ig
light chain protein and IgM secretion (Figs. 7
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The CKI, p27kip1, has been identified as a critical regulator of B-cell differentiation (Bouchard et al., 1997
An involvement of p27kip1 in cellular differentiation has been well established in a variety of cell types, including B cells (Bouchard et al., 1997
; Durand et al., 1997
; Hengst and Reed, 1996
; Kranenburg et al., 1995
; Schrantz et al., 2000
). In primary B cells, activation stimuli (LPS or CD40 ligand plus IL-10 and IL-2) initially produce a marked inhibition in the intracellular concentration of p27kip1, allowing for entry into the cell cycle. An initial proliferative burst is required for B-cell differentiation and is then followed by an increase in p21Waf1, which is associated with an arrest in the cell cycle allowing for B-cell differentiation (Bouchard et al., 1997
; Schrantz et al., 2000
). In CH12.LX cells, p21Waf1 was not detected (data not shown). Instead, p27kip1 appears to play a primary role in the differentiation process as suggested by the fact that it was downregulated during the first 24 h post-LPS stimulation and then upregulated during the differentiation phase (24 to 72 h post-LPS stimulation). The absence of p21Waf1 expression in the CH12.LX cells clearly distinguishes this cell line model from primary cells and may be due to the continuous cycling of CH12.LX cells and constitutive repression of certain cell-cycle regulatory proteins. That p27kip1 serves as the primary CKI in CH12.LX cells was in fact advantageous in addressing one of our study objectives, which was to determine whether an association could be established between the inhibition of B cell differentiation into an antibody-secreting cell by TCDD and changes in the regulation of CKIs. In primary cells, a number of CKIs perform distinct, as well as overlapping functions, making it significantly more complex to study their function.
In the present study, a modest decrease in the intracellular concentration of p27kip1 corresponded closely to a modest increase in [3H]-thymidine incorporation. The less-than-profound nature of these effects on DNA synthesis are not surprising and may be due, in part, to the self-propagating characteristic of this cell line. However, the refractory nature of lymphocyte proliferation to TCDD treatment has also been widely reported in a number of previous studies utilizing primary lymphocytes (Dooley and Holsapple, 1988
; Luster et al., 1988
; Morris and Holsapple, 1991
; Morris et al., 1993
; Tucker et al., 1986
). To more directly assess the effects of TCDD and LPS treatment on CH12.LX cell proliferation, cell counts were performed at 24-h intervals over a 72-h culture period. These results show that TCDD exerted a modest decrease in the rate of CH12.LX cell proliferation after LPS activation, as evidenced by the increase in doubling time and the very modest decrease in DNA synthesis. Collectively, our interpretation is that TCDD exerted a modest but progressive and cumulative decrease in the rate of CH12.LX cell division after LPS activation that is reflected by a decrease in the total number of cells per culture over time, as presented in Table 1
.
Generally, the effects of LPS and TCDD on kip1 mRNA expression appeared to correlate with the changes observed on p27kip1 protein. However, the magnitude of this effect is in contrast to previous findings in other cell types. For example, TCDD treatment induced a five-fold induction in kip1 expression in 5L hepatoma cells. In that study, the authors concluded that increased kip1 expression in 5L hepatoma cells was responsible for the induction of p27kip1 protein (Kolluri et al., 1999
). Interestingly, a DRE-like site is present within the kip1 promoter (Kolluri et al., 1999
; Kwon et al., 1996
); however, deletion analysis of the kip1 promoter showed that TCDD induced the promoter through a fragment lacking the DRE-like site but contained several sites that resemble recognition half-sites for the AhR (Kolluri et al., 1999
). In the CH12.LX B cells, transcriptional regulation does not appear to account fully for the effects of LPS and TCDD on the cellular concentration of p27kip1, as evidenced by the overall modest effect produced by LPS and TCDD treatment on kip1 mRNA expression. Our findings are, in fact, consistent with the widely held belief that p27kip1 regulation occurs predominately at the posttranslational level through phosphorylation and ubiquitination. Thus far, at least two critical phosphorylation sites on p27kip1 have been identified, Thr187 and Ser10 (Hengst and Reed, 1996
; Pagano et al., 1995
). It has been reported that phosphorylation by cyclin E/cdk2 on Thr187 leads to a rapid degradation of p27kip1 by the ubiquitin-26S proteasome pathway (Sheaff et al. 1997
; Tsvetkov et al., 1999
). Conversely, phosphorylation of Ser10 leads to increased stability of p27kip1 (Ishida et al., 2000
). In the present study we demonstrate that TCDD alters the posttranslational modification of p27kip1 in LPS-activated CH12.LX cells. In the absence of TCDD, LPS tended to shift p27kip1 from resolving as a 23.6 kDa protein to a slower migrating 26.0 kDa form, as identified by Western blotting, which was previously demonstrated in several cell types as a hallmark of Ser10 phosphorylation (Ishida et al., 2000
). Increased protein stability due to Ser10 phosphorylation is consistent with the increased cellular p27kip1 at 48 and 72 h post-LPS stimulation. However, in spite of the fact that two different anti-phospho-Ser10 p27kip1 antibodies were employed in the present study, neither was able to confirm that the slower migrating 26.0 kDa p27kip1 immunoreactive band was in fact the Ser10 phosphorylated form of p27kip1. Since p27kip1 possesses multiple phosphorylation sites, a more general approach was employed in order to determine whether the changes in the migration of p27kip1 were at all associated with the phosphorylation status of the protein. Specifically, cell extracts from vehicle control CH12.LX cells were, at 48 h after LPS activation, subjected to
phosphatase treatment and then resolved by SDSPAGE. The 48-h sample was selected because of the strong shift in p27kip1 to a slower-migrating form at this specific time point. Interestingly, after
phosphatase treatment, the slower-migrating 26.0 kDa form of p27kip1 now resolved as a 24.7 kDa protein. No change was observed in the migration of the 23.6 kDa form of p27kip1. Collectively, these findings suggest that the change in the migration of p27kip1 from a 23.6 kDa protein to a 26.0 kDa protein in the LPS-activated CH12.LX cells is due, in part, to phosphorylation at sites other than Ser10. In addition to phosphorylation, p27kip1 must either still undergo some other posttranslational modification, or there are some phosphorylated residues on p27kip1 that are resistant to
phosphatase. In contrast to LPS activation alone, TCDD treatment of LPS-activated CH12.LX cells favored the faster-migrating 23.6 kDa form of p27kip1. Since TCDD has been previously shown to modulate the activity of protein kinases and phosphatases (Ashida et al., 2000
), TCDD may inhibit LPS-induced phosphorylation of p27kip1 by activating a phosphatase or by inhibiting the activation of a protein kinase, thus decreasing the stability, and therefore the cellular concentration of p27kip1. Although the specific events responsible for p27kip1 regulation in response to LPS activation of B cells in the presence and absence of TCDD treatment remain to be elucidated, this study clearly shows that TCDD altered the LPS-induced posttranslational modification of p27kip1 in CH12.LX B cells.
Perhaps most importantly, the effects of LPS and TCDD on p27kip1 correlated with the observed effects on B-cell differentiation. Specifically, LPS dramatically increased the intracellular concentration of both p27kip1 and Ig
light chain at 48 h post-LPS stimulation, while in the presence of TCDD neither of these proteins was induced. Since CH12.LX cells secrete antibodies directed against an epitope on sheep erythrocytes, it was possible to measure the effects of TCDD on the number of differentiated CH12.LX cells by performing a Jerne plaque assay. Past studies by this laboratory, using the CH12.LX cell as a model for elucidating the molecular mechanism for altered B-cell effector function by TCDD, have demonstrated a marked inhibition of IgM secretion and immunoglobulin heavy chain mRNA expression in LPS-activated CH12.LX cells. Although informative, those past experiments did not address whether TCDD simply inhibited IgM production and/or decreased the number of CH12.LX cells that ultimately differentiated into AFCs. The present study clearly shows that TCDD markedly suppressed the total number of CH12.LX cells that were induced by LPS to differentiate into AFCs. In addition, the studies once again confirm that TCDD produces its suppression of B-cell function by directly acting on the B lymphocyte.
Interestingly, previously reported time-of-addition studies with mouse splenocytes demonstrated a transient sensitivity, in that TCDD had to be added to culture within the first 24 h after antigen treatment in order to produce an inhibition of the anti-sheep erythrocyte IgM AFC response (Tucker et al., 1986
). This critical time period of sensitivity for TCDD-mediated inhibition of antibody responses in primary splenocytes was also observed in the present time-of-addition studies employing LPS-activated CH12.LX cells. Addition of TCDD concomitantly with LPS, or 8 h post-LPS activation, produced a marked inhibition of both IgM secretion and the intracellular concentration of the Ig
light chain protein. However, as in primary B cells, the inhibitory effect of TCDD on immunoglobulin production was temporally dependent as evidenced by a null effect when added 24 h after LPS activation. Similarly, the TCDD-mediated arrest of p27kip1 modulation following antigen stimulation was only achieved when TCDD was added prior to 24 h post-LPS activation. Collectively, these results suggest a relationship between B-cell differentiation and changes in the posttranslational modification of p27kip1 in this cell line model of B-cell differentiation. In addition, it is tempting to speculate that by dysregulating the effects of LPS on p27kip1, TCDD may alter the critical temporal events necessary for terminal B-cell differentiation.
| ACKNOWLEDGMENTS |
|---|
This work was supported by NIEHS grants RO1 ES02520 and NRSA ES05914.
| NOTES |
|---|
1 To whom correspondence should be addressed at the Department of Pharmacology and Toxicology, Michigan State University, 315 National Food Safety and Toxicology Center, East Lansing, MI 48824. Fax: (517) 432-3218. E-mail: kamins11{at}msu.edu.
| REFERENCES |
|---|
|
|
|---|
Arnold, L. W., LoCascio, N. J., Lutz, P. M., Pennell, C. A., Klapper, D., and Haughton, G. (1983). Antigen-induced lymphomagenesis: Identification of a murine B-cell lymphoma with known antigen specificity. J. Immunol. 131, 20642068.[Abstract]
Ashida, H., Nagy, S., and Matsumura, F. (2000). 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induced changes in activities of nuclear protein kinases and phosphatases affecting DNA binding activity of c-Myc and AP-1 in the livers of guinea pigs. Biochem. Pharmacol. 59, 741751.[CrossRef][Web of Science][Medline]
Bishop, G. A., and Haughton, G. (1986). Induced differentiation of a transformed clone of Ly-1+ B cells by clonal T cells and antigen. Proc. Natl. Acad. Sci. U.S.A. 83, 74107414.
Bouchard, C., Fridman, W. H., and Sautes, C. (1997). Effect of TGF-ß1 on cell cycle regulatory proteins in LPS-stimulated normal mouse B lymphocytes. J. Immunol. 159, 41554164.[Abstract]
Delaney, B., and Kaminski, N. E. (1993). Induction of serum-borne immunomodulatory factors in B6C3F1 mice by carbon tetrachloride: I. Carbon tetrachloride-induced suppression of helper T-lymphocyte function is mediated by a serum-borne factor. Toxicology 85, 6784.[CrossRef][Web of Science][Medline]
Dooley, R. K., and Holsapple, M. P. (1988). Elucidation of cellular targets responsible for tetrachlorodibenzo-p-dioxin (TCDD)-induced suppression of antibody responses: I. The role of the B lymphocyte. Immunopharmacology 16, 167180.[CrossRef][Web of Science][Medline]
Durand, B., Gao, F. B., and Raff, M. (1997). Accumulation of the cyclin-dependent kinase inhibitor p27/Kip1 and the timing of oligodendrocyte differentiation. EMBO J. 16, 306317.[CrossRef][Web of Science][Medline]
Fisher, R. P. (1997). CDKs and cyclins in transition(s). Curr. Opin. Genet. Dev. 7, 3238.[CrossRef][Web of Science][Medline]
Hengst, L., and Reed, S. I. (1996). Translational control of p27Kip1 accumulation during the cell cycle. Science 271, 18611864.[Abstract]
Ishida, N., Hara, T., Kamura, T., Yoshida, M., Nakayama, K., and Nakayama, K. I. (2002). Phosphorylation of p27Kip1 on serine 10 is required for its binding to CRM1 and nuclear export. J. Biol. Chem. 277, 1435514358.
Ishida, N., Kitagawa, M., Hatakeyama, S., and Nakayama, K. (2000). Phosphorylation at serine 10, a major phosphorylation site of p27(Kip1), increases its protein stability. J. Biol. Chem. 275, 2514625154.
Kolluri, S. K., Weiss, C., Koff, A., and Gottlicher, M. (1999). P27Kip1 induction and inhibition of proliferation by the intracellular Ah receptor in developing thymus and hepatoma cells. Genes Dev. 13, 17421753.
Kranenburg, O., Scharnhorst, V., Van der Eb, A. J., and Zantema, A. (1995). Inhibition of cyclin-dependent kinase activity triggers neuronal differentiation of mouse neuroblastoma cells. J. Cell Biol. 131, 227234.
Kwon, T. K., Nagel, J. E., Buchholz, M. A., and Nordin, A. A. (1996). Characterization of the murine cyclin-dependent kinase inhibitor genep27Kip1. Gene 180, 113120.[CrossRef][Web of Science][Medline]
Luster, M. I., Germolec, D. R., Clark, G., Wiegand, G., and Rosenthal, G. J. (1988). Selective effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and corticosteroid on in vitro lymphocyte maturation. J. Immunol. 140, 928935.[Abstract]
Montagnoli, A., Fiore, F., Eytan, E., Carrano, A. C., Draetta, G. F., Hershko, A., and Pagano, M. (1999). Ubiquitination of p27 is regulated by cdk-dependent phosphorylation and trimeric complex formation. Genes Dev. 13, 11811190.
Morgan, D. O. (1995). Principles of CDK regulation. Nature 374, 131134.[CrossRef][Medline]
Morris, D. L., and Holsapple, M. P. (1991). Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on humoral immunity: II. B-cell activation. Immunopharmacology 21, 171181.[CrossRef][Web of Science][Medline]
Morris, D. L., Karras, J. G., and Holsapple, M. P. (1993). Direct effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on responses to lipopolysaccharide (LPS) by isolated murine B cells. Immunopharmacology 26, 105112.[CrossRef][Web of Science][Medline]
Pagano, M., Tam, S. W., Theodoras, A. M., Beer-Romero, P., Del Sal, G., Chau, V., Yew, P. R., Draetta, G. F., and Rolfe, M. (1995). Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science 269, 682685.
Paul, W. E., and Seder, R. A. (1994). Lymphocyte responses and cytokines. Cell 76, 241251.[CrossRef][Web of Science][Medline]
Rininger, J. A., Stoffregen, D. A., and Babish, J. G. (1997). Murine hepatic p53, RB, and CDK inhibitory protein expression following acute 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure. Chemosphere 34, 15571568.[Medline]
Ryu, H. Y., Mann, K. K., Schlezinger, J. J., Jensen, B., and Sherr, D. H. (2003). Environmental chemical-induced pro/pre-B-cell apoptosis: Analysis of c-myc, p27(Kip1), and p21(WAF1) reveals a death pathway distinct from clonal deletion. J. Immunol. 170, 48974904.
Schrantz, N., Beney, G. E., Auffredou, M. T., Bourgeade, M. F., Leca, G., and Vazquez, A. (2000). The expression of p18INK4 and p27kip1 cyclin-dependent kinase inhibitors is regulated differently during human B-cell differentiation. J. Immunol. 165, 43464352.
Sheaff, R. J., Groudine, M., Gordon, M., Roberts, J. M., and Clurman, B. E. (1997). Cyclin E-CDK2 is a regulator ofp27Kip1. Genes Dev. 11, 14641478.
Sherr, C. J., and Roberts, J. M. (1995). Inhibitors of mammalian G1 cyclin-dependent kinases. Genes Dev. 9, 11491163.
Sulentic, C. E., Holsapple, M. P., and Kaminski, N. E. (1998). Aryl hydrocarbon receptor-dependent suppression by 2,3,7,8-tetrachlorodibenzo-p-dioxin of IgM secretion in activated B cells. Mol. Pharmacol. 53, 623629.
Sulentic, C. E., Holsapple, M. P., and Kaminski, N. E. (2000). Putative link between transcriptional regulation of IgM expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin and the aryl hydrocarbon receptor/dioxin-responsive enhancer-signaling pathway. J. Pharmacol. Exp. Ther. 295, 705716.
Tsvetkov, L. M., Yeh, K. H., Lee, S. J., Sun, H., and Zhang, H. (1999). p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr. Biol. 9, 661664.[CrossRef][Web of Science][Medline]
Tucker, A. N., Vore, S. J., and Luster, M. I. (1986). Suppression of B-cell differentiation by 2,3,7,8-tetrachlorodibenzo-p- dioxin. Mol. Pharmacol. 29, 372327.[Abstract]
Vazquez, A., Gerard, J. P., Olive, D., Auffredou, M. T., Dugas, B., Karray, S., Delfraissy, J. F., and Galanaud, P. (1986). Different human B-cell subsets respond to interleukin 2 and to a high molecular weight B-cell growth factor (BCGF). Eur. J. Immunol. 16, 15031507.[Web of Science][Medline]
Williams, C. E., Crawford, R. B., Holsapple, M. P., and Kaminski, N. E. (1996). Identification of functional aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator in murine splenocytes. Biochem. Pharmacol. 52, 771780.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
B. S. Yoo, D. R. Boverhof, D. Shnaider, R. B. Crawford, T. R. Zacharewski, and N. E. Kaminski 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Alters the Regulation of Pax5 in Lipopolysaccharide-Activated B Cells Toxicol. Sci., February 1, 2004; 77(2): 272 - 279. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









