ToxSci Advance Access originally published online on December 22, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences 78, 68-77 (2004)
Copyright © 2004 by the Society of Toxicology
REGULAR ARTICLE |
Interactions between 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and Hypoxia Signaling Pathways in Zebrafish: Hypoxia Decreases Responses to TCDD in Zebrafish Embryos


,1
* Molecular and Environmental Toxicology Center and
School of Pharmacy, University of Wisconsin, Madison, Wisconsin 53705 and
Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, Oregon, 97331
1 To whom correspondence should be addressed at School of Pharmacy, University of Wisconsin, 777 Highland Ave., Madison, WI 53705-2222. Fax: (608) 265-3316. E-mail: wheidema{at}wisc.edu.
Received September 30, 2003; accepted December 2, 2003
ABSTRACT
The aryl hydrocarbon receptor (AHR) interacts with the aryl hydrocarbon receptor nuclear translocator (ARNT) to form a heterodimer that binds to promoters in target genes to alter transcription in response to xenobiotics such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The ARNT protein also forms heterodimers with other proteins such as HIF-1
and HIF-2
to alter gene expression in response to low oxygen conditions. Because ARNT is shared between multiple signaling pathways it is possible that activation of one ARNT-requiring pathway could inhibit the activation of other pathways that depend on ARNT. One hypothesis to explain TCDD toxicity in early life stage fish is that TCDD activation of zfAHR2 sequesters zfARNT2 away from the hypoxia signaling pathway. To test this hypothesis we measured the ability of TCDD to prevent induction of heme oxygenase by hypoxia (40% saturation), as well as the ability of hypoxia to increase the sensitivity of zebrafish to the effects of TCDD during the first week of life. As a further test of the model we examined mutant zebrafish that lack zfARNT2 for phenotypes that resemble the effects of TCDD exposure. Our results demonstrate that sequestration of zfARNT2 is not causing TCDD toxicity. TCDD did not inhibit hypoxia induction of heme oxygenase, hypoxia and TCDD exposures were not additive in causing developmental toxicity, and mutant embryos that lack zfARNT2 do not develop defects mimicking TCDD toxicity. However, our results demonstrate some level of cross talk between the two pathways in the zebrafish embryo. Hypoxia decreased TCDD induction of zfCYP1A mRNA, and decreased the potency of TCDD in causing edema. It is not clear whether this is mediated through competition for zfARNT2, or through other mechanisms.
Key Words: AHR2; ARNT2; CYP1A; TCDD; hypoxia; zebrafish; embryo; development; toxicity; edema; cardiovascular.
The aryl hydrocarbon receptor nuclear translocators (ARNTs) are members of the basic helix-loop-helix PAS family of transcription factors (Huang et al., 1993
). This family of proteins is involved in detection of, and adaptation to, environmental changes (reviewed by Gu et al., 2000
). Several proteins within this family function to "sense" environmental stimuli. For example, the aryl hydrocarbon receptor (AHR) "senses" potentially toxic xenobiotic compounds (Schmidt et al., 1996
) while HIF-1
(Wang and Semenza, 1995
) and HIF-2
(EPAS-1; Tian et al., 1997
) "sense" changes in cellular and atmospheric oxygen. Once activated, these sensor proteins form heterodimers with ARNT proteins, and these heterodimers can bind to response elements upstream of target genes to regulate gene expression. Formation of the active AHR/ARNT complex is regulated by ligands that bind to AHR. One of the most potent and well-studied AHR agonists is 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In response to TCDD binding, AHR translocates to the nucleus where AHR dissociates from chaperone proteins HSP90 (Perdew, 1988
) and ARA9 (also known as AIP, XAP2; Carver and Bradfield, 1997
; Ma and Whitlock, 1997
; Meyer et al., 1998
) and binds to ARNT. The nuclear AHR/ARNT heterodimer then produces alterations in gene expression. For example, in response to TCDD, the AHR/ARNT complex binds to xenobiotic response elements (XREs) found upstream of the cytochrome P4501A1 (cyp1a1) coding region, producing a strong induction of cyp1a1 transcription (Whitelaw et al., 1993
). ARNT also plays a role in regulating the expression of genes involved in responses to decreased oxygen tension by dimerizing with HIF-1
or HIF-2
. These dimers bind to hypoxia response elements (HREs) in target genes involved in changing vascular density, vascular permeability, erythropoiesis, and cellular energy metabolism (Salceda et al., 1996
; Wood et al., 1996
).
Because the ARNT protein is a general dimeric partner that can recognize a variety of sensor proteins, the possibility exists that activation of one pathway requiring ARNT could inhibit activation of other pathways, which also require ARNT. For example, activation of AHR could sequester a cell's available ARNT leaving little remaining to dimerize with other sensor proteins such as HIF-1
. Thus induction of AHR signaling could be coupled to inhibition of HIF-1
signaling. This possible cross talk between the AHR and HIF-1
signaling pathways has been addressed in vitro and in cell culture systems. Chan et al. (1999)
demonstrated that interference could occur in both directions, with activation of the AHR pathway inhibiting activation of the HIF-1
pathway, and activation of the HIF-1
pathway inhibiting activation of the AHR pathway. However, other groups have demonstrated only HIF-1
inhibition of the AHR pathway (Gassmann et al., 1997
; Gradin et al., 1996
; Kim and Sheen, 2000a
; Pollenz et al., 1999
). Clearly competition for ARNT must be possible, given limiting ARNT concentrations and activation of a binding partner present in excess. However, the real physiological significance of the interactions between these signaling pathways, and whether cross talk between ARNT pathways causes TCDD toxicity is still unclear.
The zebrafish is an important model organism for studying the developmental toxicity caused by TCDD (Henry et al., 1997
), and a functional AHR signaling pathway has been identified in the zebrafish. Two distinct zebrafish AHR genes have been identified: zfahr1 and zfahr2 (Andreasen et al., 2002a
; Tanguay et al., 1999
). A single ARNT gene with multiple splice variants, zfarnt2, has also been cloned (Hsu et al., 2001
; Tanguay et al., 2000
; Wang et al., 2000
). The presence of a single arnt gene is consistent with what has been observed in all other fish species studied (reviewed by Powell and Hahn, 2000
). zfAHR2 and zfARNT2b form a functional heterodimer in vitro that specifically recognizes XREs in gel shift experiments and induces XRE-driven transcription in COS-7 cells treated with TCDD (Tanguay et al., 1999
). It has also been demonstrated in vivo using an antisense morpholino that zfAHR2 plays an essential role in mediating TCDD toxicity in the zebrafish embryo (Prasch et al., 2003
; Teraoka et al., 2003
). In addition, in vitro evidence demonstrates that all three splice forms of zfARNT2 function with HIF-2
to induce HRE-driven transcription in COS-7 cells (Tanguay et al., 2000
). Because zfARNT2 is functional in both the TCDD and hypoxia signaling pathways, the possibility exists that cross talk could occur between these two pathways.
Zebrafish embryos exposed to TCDD display the endpoints of developmental toxicity observed in other fish species. Many of these endpoints, including reduction in peripheral blood flow, hemorrhage, and edema of the pericardial and yolk sacs, are consistent with cardiovascular dysfunction (Henry et al., 1997
; Tanguay, 2003
; Walker, 1994
). Both rainbow trout and lake trout display defects in yolk sac vasculature and decreased blood flow in the vitelline vein after TCDD treatment (Guiney et al., 2000
; Hornung et al., 1999
). TCDD also disrupts erythropoiesis in zebrafish embryos (Belair et al., 2001
). Both arnt-/- and hif-1
-/- mice display embryonic lethality with blocks in developmental angiogenesis and cardiovascular malformations (Iyer et al., 1998
; Kozak et al., 1997
; Maltepe et al., 1997
; Ryan and Johnson, 1998
) demonstrating that signaling through the HIF-1
pathway is required for normal development of the cardiovascular system. The cardiovascular system of developing zebrafish also appears to be responsive to hypoxic signals because rearing embryos in a hypoxic environment can modify cardiac activity, organ perfusion, and blood vessel formation (Pelster, 2002
). Because TCDD exposure leads to signs of toxicity that resemble what might be expected with defects in hypoxia sensing in zebrafish embryos, we hypothesized that activation of zfAHR2 by TCDD could produce toxicity by sequestering zfARNT2 away from HIF-1
and HIF-2
, thereby limiting hypoxia responses.
If cross talk exists between TCDD and hypoxia signaling pathways, this could have important environmental implications. Depletion of dissolved oxygen in aquatic habitats is a growing concern. Over half of the major estuaries in the United States suffer from oxygen depletion at some point during the year (NOAA, 1998
), resulting in many fish species developing in hypoxic waters. Habitats with decreased dissolved oxygen may also contain pollutants that stimulate the AHR pathway. Competition for shared proteins between the two pathways could alter either the ability of fish to respond to hypoxic conditions or the sensitivity of the fish to environmental pollutants. Such combinations might produce mortality under conditions where either stress alone would not be lethal.
The purpose of this study was to determine whether cross talk can be detected between the hypoxia and TCDD signaling pathways in zebrafish embryos and whether activation of zfAHR2 actually reduces responses to hypoxia in living fish. Surprisingly, while we find some evidence for interactions between the pathways, TCDD does not block responses to hypoxia. Indeed, hypoxic exposure protected zebrafish larvae from some endpoints of TCDD developmental toxicity.
MATERIALS AND METHODS
Zebrafish embryos.
Fertilized eggs were obtained from AB strain zebrafish according to the procedures described by Westerfield (1995). Eggs were collected within 2 h postfertilization (hpf), pooled, and placed into clean water (60 mg/l Instant Ocean Salts, 24°C).
Waterborne exposure of embryos to TCDD.
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) of > 99% purity was obtained from Chemsyn (Lenexa, KS) and dissolved in 0.1% DMSO. Newly fertilized eggs (approximately 3-4 hpf) were exposed to vehicle (0.1% DMSO) or TCDD for 1 h in glass scintillation vials in a 20 ml volume with gentle rocking. Following the 1 h static exposure, embryos were rinsed with egg water and maintained in vehicle/TCDD-free water for the remainder of the experiments.
For dose response experiments, groups of 100 zebrafish embryos were exposed to vehicle or graded concentrations of TCDD (0.0125-4 ng/ml) within 4 hpf. Immediately after exposure, the embryos from each treatment group were put into the chronic hypoxia exposure apparatus. Half of the embryos from each exposure group were put into a normoxic chamber, and the other half were put into a hypoxic chamber. The embryos were observed every 24 h for toxicity. At 168 hpf the embryos were removed from the chambers and scored for the presence of yolk sac edema and inflated swimbladder using a Bausch & Lomb stereomicroscope (20-30X). The percent of embryos displaying each endpoint was determined for each treatment group.
Acute hypoxia exposure.
Acute hypoxia exposure was carried out in 500 ml glass flasks capped with rubber stoppers. Dissolved oxygen (DO) was reduced by bubbling nitrogen gas through the water, and DO was monitored using a calibrated oxygen electrode (YSI, Yellow Springs OH). Normoxic DO was 7.5 mg/l (100% saturation) for all experiments. Hypoxic DO was adjusted to 3.0 mg/l (40% saturation) for all experiments. The level of DO was monitored at the beginning and end of each exposure to confirm constant DO levels.
Chronic hypoxia exposure.
For time course studies, embryos were treated with TCDD (1 ng/ml) as described above within 4 hpf, and immediately transferred into the chronic exposure chambers. The 80 ml sealed acrylic chambers were supplied with continuous flow of either hypoxic or normoxic water at a flow rate of 800 ml/h. DO was adjusted by bubbling nitrogen gas through the water of a collapsible plastic water container impermeable to oxygen (Reliance). DO was monitored at each water change and ranged between 3.0 mg/l (40% saturation) and 4.0 mg/l (53% saturation) in the hypoxic treatment for all experiments. Normoxic water was kept in a separate source bag that was in equilibrium with the air and DO levels remained at 7.5 mg/l (100% saturation). The embryos were observed every 24 h for the presence of yolk sac edema and swimbladder inflation until 14 days post fertilization (dpf). For observations the embryos were removed from the chambers, scored in their surrounding water with a Bausch & Lomb stereomicroscope, and returned to the chambers within 5 min.
Northern blots.
At 48 hpf approximately 200 embryos were exposed to 2 ng/ml TCDD to activate the AHR/ARNT pathway, or to vehicle (DMSO) as a control. At 72 hpf one half of each treatment group was exposed to acute hypoxia as described above, and the remaining half of the embryos were exposed to normoxic conditions (100 embryos for each of the 4 groups). At 78 hpf embryos were removed from the water, snap frozen in liquid nitrogen, and used for RNA isolation using Tri-reagent (Molecular Research Laboratories) according to the manufacturer's instructions. Samples of total RNA (25 µg/lane) were run out on a 1.2% agarose gel and transferred to a Hybond+ (Amersham) nylon membrane. The blot was probed with 32P labeled gene specific probes. The cDNA encoding Heme Oxygenase was obtained as an EST (EST name fc27c04.y1, GenBank Accession number AI722910). The probe was made by cutting the full-length sequence out of the vector using a Not1, Sal1 digestion. The partial zfCYP1A sequence was obtained from Dr. C. H. Hu of National Taiwan University and the probe was made by cutting the sequence out of the vector with BamH1, Nco1 digestion. The zebrafish ß-actin probe was made by PCR amplification from cDNA using gene specific primers (forward primer, 5'-aagcaggagtacgatgagtc-3'; reverse primer 5'-tggagtcctcagatgcattg-3'). Results were quantitated using a PhosphorImager (Molecular Dynamics) and ImageQuant® software.
LightCycler analysis.
Pools of 250 zebrafish embryos were exposed to vehicle or 1 ng/ml TCDD as described above. Immediately after dosing, half of the embryos from each exposure group were put into a normoxic flow chamber and the other half were put into a hypoxic flow chamber. Each chamber contained approximately 30 embryos. Embryos were removed from the chambers at 18, 48, 96, 144, and 192 hpf. Upon removal, the embryos were snap-frozen in liquid nitrogen. RNA was extracted from pools of 15 embryos using Qiagen RNeasy Mini Kit according to manufacturer's instructions. cDNA was produced from 2 µg of each RNA pool using Superscript II (Invitrogen) and an oligo dT primer in a 20 µl volume. A LightCycler (Roche, Indianapolis, IN) was used for quantitative real-time PCR using SYBR Green according to the manufacturer's instructions. Both gel electrophoresis and thermal denaturation (melt curve analysis) were used to confirm specific product formation, and measurements of both zfCYP1A and ß-actin mRNA were made concurrently with standard curves derived from plasmid cDNA dilutions. Primers used to amplify zfCYP1A and ß-actin have been previously described (Andreasen et al., 2002b
).
zfarnt2-/- mutant embryos.
Insertional mutants disrupting zfarnt2 (ARNT2 hi1715) were generated in a large-scale retroviral mutagenesis screen (Amsterdam et al., 1996
; Golling et al., 2002
) and were gifts of Nancy Hopkins from the Center for Cancer Research and Depertment of Biology, Massachusetts Institute of Technology (Cambridge, MA). Adult fish heterozygous for the retroviral insertion were identified by PCR on DNA obtained from fin clips using one primer corresponding to a region of the gene flanking the retroviral insert (5'cggaaatgtcgctgttgttagttgtg3') and one primer located within the retroviral insert (5'tgcgatgccgtctactttga 3'). Heterozygous adults were pair mated to obtain homozygous zfarnt2-/- embryos. At 120 hpf zfarnt2-/- embryos were observed for pericardial and yolk sac edema, reduced blood flow, shortened lower jaw, hemorrhages, and lack of swimbladder inflation using a Nikon Eclipse TE300 inverted microscope. Untreated wild type (WT) embryos and WT embryos treated with 1 ng/ml TCDD were also observed (n = 12 embryos). Representative photographs were taken from each group using a Princeton Instruments Micromax charge-coupled device (CCD) camera. To confirm the genotype of the zfarnt2-/- mutants, fish were tested at 120 hpf for the touch insensitivity and swimbladder inflation defects characteristic of the homozygous zfarnt2-/- mutants. This was confirmed by genotyping using primers that flank the retroviral insert (5'gaactgagtttgcgcgtttgagac3', 5'cggaaatgtcgctgttgttagttgtg3').
In order to confirm that the mutant embryos lacked expression of zfARNT2, RT-PCR was performed on cDNA generated from mutant and WT embryos at 120 hpf. Total RNA was extracted from individual embryos using the Qiagen RNeasy Mini Kit and 750 ng was reverse transcribed using Superscript II (Invitrogen) and an oligo dT primer. PCR was performed on cDNA using one primer set with detects zfARNT2b/c (5'caggcaatatggcaacacc3', 5'cacagtgaaatattccttgatc3') and one primer set which detects zfARNT2a (5'gactgaattcttttcacgccac3', 5'cacagtgaaatattccttgatc3'). To ensure cDNA was of good quality primers against zfAHR2, which are known to span an intron, were also used (5'gacaactgaccaaccttctac3', 5'tgatacccagagcctctcat3').
Statistical analysis.
Significance was determined using a two-way ANOVA followed by the Fisher LSD test. Levene's test for homogeneity of variances was performed before the ANOVA. Data that did not pass Levene's test (Northern blot data for Heme Oxygenase and zfCYP1A) was transformed by log transformation and the transformed data was analyzed by the ANOVA. All statistical analysis was performed using the Statistica 6.0 software package. Results are presented as mean ± SE; level of significance was p
0.05.
RESULTS
Effect of TCDD Exposure on Hypoxia-Inducible Gene Expression
If TCDD activation of zfAHR2 sequesters zfARNT2 protein away from the hypoxia pathway, then TCDD should inhibit the upregulation of hypoxia inducible genes in zebrafish embryos. To test this, embryos were treated with vehicle or TCDD (2 ng/ml) at 48 hpf, a point at which the AHR/ARNT pathway in zebrafish is known to be responsive to TCDD. After 24 h of AHR/ARNT activation, TCDD-exposed and control embryos were then exposed to a 6 h hypoxia challenge to induce hypoxia responses. For these experiments we chose the lowest level of DO that allowed normal development. Below 40% saturation we noticed a significant increase in malformations and mortality in response to hypoxia alone. We therefore chose the 40% saturation level as a range that should produce hypoxic responses, yet allow for long-term experiments.
The mouse heme oxygenase gene contains HREs and is induced upon exposure to hypoxic conditions (Lee et al., 1997
; Morita et al., 1995
). Because of this, we chose the zebrafish gene for heme oxygenase as a test hypoxia-inducible gene. As expected, northern blots showed that Heme Oxygenase mRNA was induced approximately 10-fold in zebrafish embryos exposed to hypoxic conditions for 6 h (Fig. 1A and 1C). However, contrary to our hypothesis, treatment with TCDD prior to the hypoxia exposure did not reduce the hypoxic induction of heme oxygenase. Interestingly, TCDD treatment alone caused a significant induction in Heme Oxygenase mRNA levels compared to vehicle-treated embryos.
|
Effect of Hypoxia Exposure on TCDD-Inducible Gene Expression
While activation of the AHR/ARNT pathway with TCDD did not block hypoxia induction of Heme Oxygenase mRNA, hypoxia clearly decreased the ability of TCDD to induce zfcyp1a. The induction of mRNA for CYP1A is a hallmark of TCDD exposure across species (Hahn et al., 1994
Effect of Hypoxia on the Time Course of TCDD-Induced zfCYP1A Expression
Time course experiments were used to determine how long-term, chronic exposure to hypoxia would affect zfCYP1A mRNA induction by TCDD (Fig. 2). Embryos were exposed to DMSO or 1 ng/ml TCDD within 4 hpf and then maintained in either normoxic or hypoxic environments as described in the methods. Quantitative real-time PCR was used to measure zfCYP1A mRNA levels, normalizing with ß-actin message. In embryos raised in the normoxic environment, TCDD had significantly induced expression of zfCYP1A mRNA by 48 hpf, with a 68- (± 2.5) fold induction compared to vehicle-treated embryos. This TCDD-dependent induction was reduced to 35- (± 1.2) fold in embryos growing in hypoxic water. Induction of zfCYP1A by TCDD continued to increase over time, so that at 96 hpf the normoxic, TCDD-treated embryos had a level of zfCYP1A mRNA that was induced 194 (± 10.3) fold over the vehicle-treated control, while hypoxia reduced TCDD induction to 46- (± 1.0) fold. The high fold induction produced by TCDD is due in part to the very low expression normally observed in control embryos, and while levels of zfCYP1A mRNA continued to increase in the TCDD-exposed embryos, reaching a plateau at around 144 hpf, fold induction tended to drop at later time points as zfCYP1A mRNA levels steadily rose in the control fish. Importantly, hypoxic exposure continued to decrease the extent of TCDD-induced zfCYP1A mRNA levels at both 144 and 192 hpf. This long-term effect of hypoxia on TCDD-induced zfCYP1A mRNA levels is consistent with the results from the acute hypoxia exposure experiment, and provides further evidence that cross talk between hypoxia and TCDD signaling pathways can occur at the molecular level. Hypoxia alone produced a small induction of zfCYP1A mRNA, but this was so small compared to the induction by TCDD that it is not apparent in the figure.
|
Effect of Hypoxia on TCDD Dose Response Relationships
Hypoxia also decreased the sensitivity of developing zebrafish to TCDD toxicity in dose response experiments. Embryos were exposed to a range of TCDD concentrations within 4 hpf and then maintained in either normoxic or hypoxic environments. At 168 hpf embryos were removed from the system and scored for two hallmark endpoints of TCDD exposure: yolk sac edema and absence of swimbladder inflation (Henry et al., 1997
|
The exposure of developing fish embryos to TCDD also causes an inhibition of swimbladder inflation. The dose response curves for swimbladder inflation in embryos reared in normoxic and hypoxic conditions are shown in Figure 3B. In contrast to the effect on yolk sac edema, no difference was observed between the dose response curves in normoxic and hypoxic environments for this endpoint of toxicity.
Untreated wild type zebrafish show a normal pattern of development in which they show little or no edema, and properly inflate their swimbladders by 168 hpf, as shown in the representative photograph in Figure 4A. Exposure to TCDD produces a set of characteristic defects shown in Figure 4C, in which there is obvious edema in the yolk sac, pericardium, eyes and head, failure to inflate the swimbladder, as well as shortening of the lower jaw and snout. These embryos also have severely reduced peripheral blood flow.
|
Hypoxia produced a third class of embryos in which the swimbladder failed to inflate, but other signs of TCDD toxicity were either markedly reduced or totally absent. A representative photograph of this class is shown in Figure 4B. Hypoxia clearly shifted the population of TCDD treated embryos into the two categories lacking edema (Fig. 4D). As can be seen from the representative photographs, hypoxia exposure decreased not only the incidence yolk sac edema but also provided protection against other common endpoints of TCDD exposure such as edema of the pericardial sac and eyes and shortening of the lower jaw. Taken together, these results demonstrate that exposure of embryos to hypoxic conditions can alter not only molecular but also physiological endpoints of TCDD exposure.
Effect of Hypoxia on the Time Course of TCDD Effects
One possible explanation for the decreased response to TCDD produced by hypoxia is that the embryos were delayed in development, and had not been observed for sufficient time to develop edema. Exposure of zebrafish embryos to anoxic (0% oxygen) environments causes development to cease and the embryos to enter a state of suspended animation (Padilla and Roth, 2001
). The level of hypoxia exposure used in our experiments did not cause the embryos to stop growing, but a slight developmental delay was observed in which pigmentation and heart looping appeared slightly delayed in the hypoxic fish. This delay was not sufficient to appreciably alter hatching time, however. To rule out the possibility that the absence of toxic responses was due to a simple nonspecific developmental delay, we followed TCDD toxicity over time. Embryos were exposed to TCDD within 4 hpf and maintained in either normoxic or hypoxic environments. Embryos were scored for two readily observable endpoints of TCDD exposure: yolk sac edema (Fig. 5A) and lack of swimbladder inflation (Fig. 5B) every 24 h for 14 days post fertilization (dpf).
|
Yolk sac edema was observed in normoxic TCDD treated embryos beginning at 5 dpf when approximately 55% of the embryos displayed yolk sac edema. The fraction of embryos displaying yolk sac edema increased slightly by 6 dpf to 68% and did not change after this time. A slight delay in the onset of yolk sac edema was observed in the hypoxic TCDD group. The majority of embryos in the hypoxic group did not form edema until between 6 and 7 dpf, at which time approximately 32% of embryos displayed edema. Importantly, we observed only a small increase in edema incidence thereafter. These results demonstrate that the effect of hypoxic exposure on the formation of yolk sac edema cannot be attributed to a developmental delay because even at 14 dpf there was a significant difference in the number of embryos displaying edema between the normoxic and hypoxic TCDD treatment groups.
For each time point in Figure 5, the fish were removed along with the surrounding hypoxic water for a brief time for scoring. During these approximately 5-min times, the water was exposed to atmospheric air. It is likely that this exposure briefly increased oxygenation in the fish being examined. Nevertheless, this transient exposure to oxygen was not sufficient to reverse the hypoxia effects that we observed. It is possible that uninterrupted exposure to hypoxia might have produced more pronounced effects.
A time course evaluation of swimbladder inflation was also performed (Fig. 5B). In the normoxic DMSO group, nearly all embryos had inflated swimbladders by 120 hpf. In contrast, swimbladder inflation in vehicle-exposed embryos raised in hypoxic water was not complete until 168 hpf. This demonstrates the developmental delay caused by hypoxic treatment. TCDD inhibited swimbladder inflation in both the normoxic and hypoxic environments.
Loss of zfARNT2 Does Not Produce the Signs of TCDD Developmental Toxicity
Our original hypothesis predicted that activation of the AHR/ARNT pathway by TCDD would lead to reduced responses to hypoxia through a mechanism in which zfARNT2 is sequestered away from proteins such as Hif-1
. The experiment shown in Figure 1 provides evidence against this hypothesis, showing normal Heme Oxygenase mRNA induction in the presence of TCDD. As a further test of the hypothesis, zebrafish embryos that have a retroviral insertion that disrupts expression of zfarnt2 (ARNT2 hi 1715) (Golling et al., 2002
) were examined. If the hypothesis is correct, the embryos lacking zfARNT2 protein should exhibit at least some of the characteristic endpoints of TCDD developmental toxicity.
Untreated and TCDD-treated wild type embryos were compared with untreated zfarnt2 -/- mutant embryos, at 120 hpf, since at this time obvious endpoints of developmental toxicity are manifested in TCDD-treated zebrafish embryos. Groups of 12 embryos were scored for endpoints of TCDD toxicity (Fig. 6A) and representative photographs of untreated WT, TCDD-treated WT, and untreated zfarnt2 -/- mutant embryos are also shown (Fig. 6B). At 120 hpf all of the TCDD-treated embryos displayed the characteristic set of endpoints normally observed after TCDD treatment: pericardial and yolk sac edema, reduced trunk blood flow, and shortened lower jaw. The majority also displayed hemorrhages in the pericardial sac and around the eyes. In contrast, none of the zfarnt2-/- mutant embryos displayed any of these endpoints. The only common endpoint observed was a lack of swimbladder inflation. Therefore, with the possible exception of the swimbladder inflation defect, sequestration of zfARNT2 through activation of the AHR/ARNT pathway cannot be the cause of TCDD toxicity in developing zebrafish embryos.
|
To confirm that the mutant embryos actually do lack expression of zfARNT2 mRNAs, RT-PCR was performed using primer sets that amplify zfARNT2b/c and zfARNT2a. ZfAHR2 was included as a control for cDNA quality (Fig. 6C). None of the three known zfARNT2 mRNA splice forms could be amplified in mutant cDNA demonstrating that they do in fact lack expression of zfARNT2.
DISCUSSION
Competition for zfARNT2 as a Mechanism for TCDD Toxicity
Because the ARNT proteins are important components of multiple signaling pathways, it is of interest to determine if and how signaling through one ARNT dependent pathway can affect signaling through other pathways using ARNT. In particular, because many of the signs of TCDD toxicity in developing fish suggest defects in the cardiovascular system, a plausible mechanism for TCDD toxicity involves cross talk between two ARNT pathways, the AHR pathway that senses xenobiotics, and the HIF-1
and HIF-2
pathways that sense hypoxia. In this proposed mechanism activation of zfAHR2 sequesters zfARNT2, limiting the development of the cardiovascular system in response to local hypoxia signals.
Our results indicate that this model cannot explain the toxicity produced by TCDD in developing zebrafish. One prediction of the model is that TCDD should inhibit induction of hypoxia responsive genes when fish are exposed to low DO concentrations. We have demonstrated that TCDD exposure 24 h prior to hypoxic treatment does not block hypoxia induction of a well-characterized hypoxia-inducible gene, heme oxygenase.
In addition, if TCDD exposure inhibited induction of hypoxia inducible genes, concurrent hypoxia and TCDD exposures could lead to greater toxicity than that observed when either stress was used alone. We observed the opposite. Furthermore, if TCDD toxicity were mediated by a reduction in zfARNT2 availability, we would expect embryos that lack zfARNT2 to display developmental defects mimicking endpoints of TCDD toxicity. Because embryos completely lacking zfARNT2 do not display these endpoints, this mechanism of competition for zfARNT2 cannot be causing TCDD toxicity.
While it is possible that TCDD might influence responses to more severe hypoxia, we used a level of dissolved oxygen that was only just high enough to sustain life, a level that was sufficient to generate hypoxia responses.
It is worth noting that long-term exposure to TCDD decreases AHR levels in some mammalian cell types (Pollenz et al., 1996
). Therefore, it is possible that zfAHR2 levels were decreased by TCDD exposure, limiting the amount of zfAHR2 available to compete for zfARNT2. Nevertheless, sufficient AHR protein was present to produce toxic responses. Regardless of the level of zfAHR2 protein, our experiments show that the toxic responses produced by TCDD cannot be due to sequestration of zfARNT2 by zfAHR2.
Cross Talk
Cross talk between signaling pathways can occur at a variety of levels. Our experiments were focused on a specific mechanism in which AHR and other PAS family proteins compete for ARNT, however our results suggest other possible mechanisms. While we found no evidence to indicate that TCDD sequesters sufficient ARNT to inhibit hypoxia signaling, it is clear that hypoxia alters responses to TCDD. This is consistent with previous results in which either chemical or physiogical hypoxia exposure partially inhibited TCDD-induced transcription of the cyp1a gene or XRE-containing reporter constructs (Chan et al., 1999
; Gassmann et al., 1997
; Gradin et al., 1996
; Kim and Sheen, 2000a
; Pollenz et al., 1999
). While the AHR apparently cannot sequester ARNT away from hypoxia pathways, the converse may be possible, and hypoxia may reduce ARNT availability for AHR. In this model, responses to TCDD would be reduced by hypoxia, just as we observed. However, it has not been demonstrated that competition for ARNT is the mechanism for hypoxic downregulation of AHR signaling in vivo, and there is some evidence indicating that ARNT levels, at least in certain cell types, do not appear to be a limiting factor (Pollenz et al., 1996
). Thus the mechanism for this cross talk between the signal transduction systems remains unknown.
One possibility is that the effect of hypoxia on zfCYP1A mRNA expression is due to altered metabolism. Profound metabolic changes in metabolic rate, energy metabolism, and gene expression are known to occur in response to low DO concentrations (Boutilier et al., 1988
; Dunn, 1986
; Ton et al., 2003
). It is possible that hypoxia decreases the expression of nonessential genes, including zfcyp1a. It has also been hypothesized that increased nitric oxide levels caused by hypoxia may be involved in inhibiting cyp1a promoter activity (Kim and Sheen 2000b
). One interesting result from Figure 1 was that hypoxia exposure reduced zfCYP1A levels even though TCDD had been present, and presumably increasing zfCYP1A expression during the 24 h prior to hypoxia exposure. This suggests that hypoxia can down regulate zfCYP1A. However, there are several possible explanations for this result. The results in Figure 1 may simply represent a block in any further increase in zfCYP1A production. Thus, levels in the hypoxia group would be lower than in the normoxic group, where CYP1A levels continued to increase unchecked. Alternatively, hypoxia may produce an increase in the rate of destruction of CYP1A mRNA.
Another possible mechanism for cross talk is suggested by our finding that hypoxia treatment alone caused induction of the TCDD regulated gene cyp1a, and TCDD treatment increased abundance of Heme Oxygenase mRNA. Perhaps activated HIF-1
can weakly recognize XRE sequences, and activated AHR can weakly recognize HRE sequences. In support of this idea Gassmann et al. (1997)
observed that hypoxia slightly induced a XRE reporter construct and that HIF-1
appeared to have weak binding to the XRE in gel shift assays. It is also possible that HRE sequences regulate the zfcyp1a gene and XRE sequences lie upstream of the heme oxygenase gene. Chan et al. (1999)
observed that TCDD caused up regulation of the hypoxia responsive erythropoietin gene via a XRE sequence. One model that resolves the apparent paradox in which hypoxia activates zfcyp1a in the absence of TCDD, and inhibits zfcyp1a expression in the presence of TCDD, is that the HIF-1
/ARNT dimer is a weak activator at XREs. In this model, HIF-1
/ARNT would produce a small increase in zfcyp1a transcription in the absence of AHR/ARNT dimers, but would interfere with full activation of zfcyp1a by AHR/ARNT in the presence of TCDD.
TCDD and Hypoxia as Environmental Stressors
Contrary to what we initially expected, our results suggest that fish embryos developing in waters with decreased dissolved oxygen will not be more sensitive to TCDD developmental toxicity. These findings suggest a mechanism by which DO levels may modulate responsiveness of fish embryos to TCDD. Thus, when assessing risk of feral fish populations exposed to TCDD and related compounds we cannot consider the animals in isolation but must consider the system as a whole.
In summary, we have shown that cross talk can occur between hypoxia and TCDD signaling in the zebrafish embryo. While such cross talk does occur, competition for zfARNT2 cannot be the cause of TCDD developmental toxicity in zebrafish embryos.
ACKNOWLEDGMENTS
We thank Nancy Hopkins for providing the zfarnt2-/- mutant zebrafish strain, and D. Nesbit and S. Denny for technical support. This work was supported by the University of Wisconsin Sea Grant Institute under grants from the National Sea Grant College Program, National Oceanic and Atmospheric Administration, US Department of Commerce, Sea Grant Project Numbers R/BT-16 and R/BT-17 (W.H. and R.E.P.). This research also was supported by NIH grant T32 ES07015 from the National Institute of Environmental Health Sciences (NIEHS, W.H. and R.E.P). Contribution 353, Molecular and Environmental Toxicology Center, University of Wisconsin, Madison, WI 53726-4087.
REFERENCES
Abnet, C. C., Tanguay, R. L., Heideman, W., and Peterson, R. E. (1999). Transactivation activity of human, zebrafish, and rainbow trout aryl hydrocarbon receptors expressed in COS-7 cells: Greater insight into species differences in toxic potency of polychlorinated dibenzo-p-dioxin, dibenzofuran, and biphenyl congeners. Toxicol. Appl. Pharmacol. 159, 4151.[CrossRef][ISI][Medline]
Amsterdam, A., Burgess, S., Golling, G., Chen, W., Sun, Z., Townsend, K., Farrington, S., Haldi, M., and Hopkins, N. (1999). A large-scale insertional mutagenesis screen in zebrafish. Genes & Dev. 13, 27132724.
Amsterdam, A., Lin, S., Moss, L. G., and Hopkins, N. (1996). Requirements for green fluorescent protein detection in transgenic zebrafish embryos. Gene 173, 99103.[CrossRef][ISI][Medline]
Andreasen, E. A., Hahn, M. E., Heideman, W., Peterson, R. E., and Tanguay, R. L. (2002a). The zebrafish (Danio rerio) aryl hydrocarbon receptor type 1 is a novel vertebrate receptor. Mol. Pharmacol. 62, 234249.
Andreasen, E. A., Spitsbergen, J. M., Tanguay, R. L., Stegeman, J. J., Heideman, W., and Peterson, R. E. (2002b). Tissue-specific expression of AHR2, ARNT2, and CYP1A in zebrafish embryos and larvae: Effects of developmental stage and 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure. Toxicol. Sci. 68, 403419.
Belair, C. D., Peterson, R. E., and Heideman, W. (2001). Disruption of erythropoiesis by dioxin in the zebrafish. Dev. Dyn. 222, 581594.[CrossRef][ISI][Medline]
Boutilier, R. G., Dobson, G., Hoeger, U., and Randall, D. J. (1988). Acute exposure to graded levels of hypoxia in rainbow trout (Salmo gairdneri): Metabolic and respiratory adaptations. Respir. Physiol. 71, 6982.[CrossRef][ISI][Medline]
Carver, L. A., and Bradfield, C. A. (1997). Ligand-dependent interaction of the aryl hydrocarbon receptor with a novel immunophilin homolog in vivo. J. Biol. Chem. 272, 1145211456.
Chan, W. K., Yao, G., Gu, Y. Z., and Bradfield, C. A. (1999). Cross-talk between the aryl hydrocarbon receptor and hypoxia inducible factor signaling pathways. Demonstration of competition and compensation. J. Biol. Chem. 274, 1211512123.
Denison, M. S., Fisher, J. M., and Whitlock, J. P., Jr. (1988). Inducible, receptor-dependent protein-DNA interactions at a dioxin-responsive transcriptional enhancer. Proc. Natl. Acad. Sci. U.S.A. 85, 25282532.
Dunn, J. F, Hochachlea P. W. (1986). Metabolic responses of trout (Salmo gairdneri) to acute environmental hypoxia. J. Exp. Biol. 123, 229242.
Gassmann, M., Kvietikova, I., Rolfs, A., and Wenger, R. H. (1997). Oxygen- and dioxin-regulated gene expression in mouse hepatoma cells. Kidney Int. 51, 567574.[ISI][Medline]
Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado, E., Chen, W., Burgess, S., Haldi, M., Artzt, K., Farrington, S., Lin, S. Y., Nissen, R. M., and Hopkins, N. (2002). Insertional mutagenesis in zebrafish rapidly identifies genes essential for early vertebrate development. Nat. Genet. 31, 135140.[CrossRef][ISI][Medline]
Gradin, K., McGuire, J., Wenger, R. H., Kvietikova, I., Whitelaw, M. L., Toftgard, R., Tora, L., Gassmann, M., and Poellinger, L. (1996). Functional interference between hypoxia and dioxin signal transduction pathways: Competition for recruitment of the Arnt transcription factor. Mol. Cell. Biol. 16, 52215231.[Abstract]
Gradin, K., Toftgard, R., Poellinger, L., and Berghard, A. (1999). Repression of dioxin signal transduction in fibroblasts. Identification Of a putative repressor associated with Arnt. J. Biol. Chem. 274, 1351113518.
Gu, Y. Z., Hogenesch, J. B., and Bradfield, C. A. (2000). The PAS superfamily: Sensors of environmental and developmental signals. Annu. Rev. Pharmacol. Toxicol. 40, 519561.[CrossRef][ISI][Medline]
Guiney, P. D., Walker, M. K., Spitsbergen, J. M., and Peterson, R. E. (2000). Hemodynamic dysfunction and cytochrome P4501A mRNA expression induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin during embryonic stages of lake trout development. Toxicol. Appl. Pharmacol. 168, 114.[CrossRef][ISI][Medline]
Hahn, M. E., Poland, A., Glover, E., and Stegeman, J. J. (1994). Photoaffinity labeling of the Ah receptor: Phylogenetic survey of diverse vertebrate and invertebrate species. Arch. Biochem. Biophys. 310, 218228.[CrossRef][ISI][Medline]
Henry, T. R., Spitsbergen, J. M., Hornung, M. W., Abnet, C. C., and Peterson, R. E. (1997). Early life stage toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in zebrafish (Danio rerio). Toxicol. Appl. Pharmacol. 142, 5668.[CrossRef][ISI][Medline]
Hornung, M. W., Spitsbergen, J. M., and Peterson, R. E. (1999). 2,3,7,8-Tetracholorodibenzo-p-dioxin alters cardiovascular and craniofacial development and function in sac fry of rainbow trout (Oncorhynchus mykiss). Toxicol. Sci. 47, 4051.
Hsu, H. J., Wang, W. D., and Hu, C. H. (2001). Ectopic expression of negative arnt2 factor disrupts fish development. Biochem. Biophys. Res. Commun. 282, 487492.[CrossRef][ISI][Medline]
Huang, Z. J., Edery, I., and Rosbash, M. (1993). PAS is a dimerization domain common to Drosophila period and several transcription factors. Nature 364, 259262.[CrossRef][Medline]
Iyer, N. V., Kotch, L. E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H., Gassmann, M., Gearhart, J. D., Lawler, A. M., Yu, A. Y., and Semenza, G. L. (1998). Cellular and developmental control of O2 homeostasis by hypoxia- inducible factor 1 alpha. Genes Dev. 12, 149162.
Jones, P. B., Durrin, L. K., Fisher, J. M., and Whitlock, J. P., Jr. (1986). Control of gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Multiple dioxin-responsive domains 5'-ward of the cytochrome P1-450 gene. J. Biol. Chem. 261, 66476650.
Kim, J. E., and Sheen, Y. Y. (2000a). Inhibition of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-stimulated Cyp1a1 promoter activity by hypoxic agents. Biochem. Pharmacol. 59, 15491556.[CrossRef][ISI][Medline]
Kim, J. E., and Sheen, Y. Y. (2000b). Nitric oxide inhibits dioxin action for the stimulation of Cyp1a1 promoter activity. Biol. Pharm. Bull. 23, 575580.[ISI][Medline]
Kozak, K. R., Abbott, B., and Hankinson, O. (1997). ARNT-deficient mice and placental differentiation. Dev. Biol. 191, 297305.[CrossRef][ISI][Medline]
Lee, P. J., Jiang, B. H., Chin, B. Y., Iyer, N. V., Alam, J., Semenza, G. L., and Choi, A. M. (1997). Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase-1 gene in response to hypoxia. J. Biol. Chem. 272, 53755381.
Ma, Q., and Whitlock, J. P., Jr. (1997). A novel cytoplasmic protein that interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. J. Biol. Chem. 272, 88788884.
Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A., and Simon, M. C. (1997). Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature 386, 403407.[CrossRef][Medline]
Meyer, B. K., Pray-Grant, M. G., Vanden Heuvel, J. P., and Perdew, G. H. (1998). Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl hydrocarbon receptor core complex and exhibits transcriptional enhancer activity. Mol. Cell Biol. 18, 978988.
Morita, T., Perrella, M. A., Lee, M. E., and Kourembanas, S. (1995). Smooth muscle cell-derived carbon monoxide is a regulator of vascular cGMP. Proc. Natl. Acad. Sci. U.S.A. 92, 14751479.
NOAA (1998). Oxygen depletion in coastal waters, by Nancy N. Rabalais. NOAA's State of the Coast Report. NOAA, Silver Spring, MD, http://state_d_coast.noaa.gov/bulletins/html/hyp_09.html.
Padilla, P. A., and Roth, M. B. (2001). Oxygen deprivation causes suspended animation in the zebrafish embryo. Proc. Natl. Acad. Sci. U.S.A. 98, 73317335.
Pelster, B. (2002). Developmental plasticity in the cardiovascular system of fish, with special reference to the zebrafish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 133, 547553.[CrossRef][Medline]
Perdew, G. H. (1988). Association of the Ah receptor with the 90-kDa heat shock protein. J. Biol. Chem. 263, 1380213805.
Pollenz, R. S., Davarinos, N. A., and Shearer, T. P. (1999). Analysis of aryl hydrocarbon receptor-mediated signaling during physiological hypoxia reveals lack of competition for the aryl hydrocarbon nuclear translocator transcription factor. Mol. Pharmacol. 56, 11271137.
Pollenz, R. S., Sullivan, H. R., Holmes, J., Necela, B., and Peterson, R. E. (1996). Isolation and expression of cDNAs from rainbow trout (Oncorhynchus mykiss) that encode two novel basic helix-loop-Helix/PER-ARNT-SIM (bHLH/PAS) proteins with distinct functions in the presence of the aryl hydrocarbon receptor. Evidence for alternative mRNA splicing and dominant negative activity in the bHLH/PAS family. J. Biol. Chem. 271, 3088630896.
Powell, W. H., and Hahn, M. E. (2000). The evolution of aryl hydrocarbon signaling proteins: Diversity of ARNT isoforms among fish species. Mar. Environ. Res. 50, 3944.[CrossRef][ISI][Medline]
Prasch, A. L., Teraoka, H., Carney, S. A., Dong, W., Hiraga, T., Stegeman, J. J., Heideman, W., and Peterson, R. E. (2003). Aryl hydrocarbon receptor 2 mediates 2,3,7,8-tetrachlorodibenzo-p-dioxin developmental toxicity in zebrafish. Toxicol. Sci. 76, 138150.
Ryan, H. E., Lo, J., and Johnson, R.S. (1998). HIF-1a is required for solid tumor formation and embryonic vascularization. EMBO J. 17, 30053015.[CrossRef][ISI][Medline]
Salceda, S., Beck, I., and Caro, J. (1996). Absolute requirement of aryl hydrocarbon receptor nuclear translocator protein for gene activation by hypoxia. Arch. Biochem. Biophys. 334, 389394.[CrossRef][ISI][Medline]
Schmidt, J. V., Su, G. H., Reddy, J. K., Simon, M. C., and Bradfield, C. A. (1996). Characterization of a murine Ahr null allele: Involvement of the Ah receptor in hepatic growth and development. Proc. Natl. Acad. Sci. U.S.A. 93, 67316736.
Tanguay, R. L., Abnet, C. C., Heideman, W., and Peterson, R. E. (1999). Cloning and characterization of the zebrafish (Danio rerio) aryl hydrocarbon receptor. Biochim. Biophys. Acta 1444, 3548.[Medline]
Tanguay, R. L., Andreasen, E., Heideman, W., and Peterson, R. E. (2000). Identification and expression of alternatively spliced aryl hydrocarbon nuclear translocator 2 (ARNT2) cDNAs from zebrafish with distinct functions. Biochim. Biophys. Acta 1494, 117128.[Medline]
Tanguay, R. L., Andreasen, E.A., Walker M. K., and Peterson R. E. (2003). Dioxin toxicity and aryl hydrocarbon receptor signaling in fish. In Dioxins and Health, 2nd ed. (A. Schecter and T. A. Gasiewicz, Eds.), pp. 603628. John Wiley & Sons, New York.
Teraoka, H., Dong, W., Tsujimoto, Y., Iwasa, H., Endoh, D., Ueno, N., Stegeman, J. J., Peterson, R. E., and Hiraga, T. (2003). Induction of cytochrome P450 1A is required for circulation failure and edema by 2,3,7,8-tetrachlorodibenzo-p-dioxin in zebrafish. Biochem. Biophys. Res. Commun. 304, 223228.[CrossRef][ISI][Medline]
Tian, H., McKnight, S. L., and Russell, D. W. (1997). Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes Dev. 11, 7282.
Ton, C., Stamatiou, D., and Liew, C. C. (2003). Gene expression profile of zebrafish exposed to hypoxia during development. Physiol. Genomics 13, 97106.
Walker, M. K., and Peterson, R. E. (1994). Aquatic toxicity of dioxins and related chemicals. In Dioxins and Health (A. Schecter, Ed.), pp. 347387. Plenum, New York..
Wang, G. L., and Semenza, G. L. (1995). Purification and characterization of hypoxia-inducible factor 1. J. Biol. Chem. 270, 12301237.
Wang, W., Hsu, H., Kon, Z., and Hu, C. (2000). Overexpression of a zebrafish ARNT2-like factor represses CYP1A transcription in ZLE cells. Marine Biotechnol. 2, 376386.
Westerfield, M. (1995). The Zebrafish Book. University of Oregon Press, Eugene, OR.
Whitelaw, M., Pongratz, I., Wilhelmsson, A., Gustafsson, J. A., and Poellinger, L. (1993). Ligand-dependent recruitment of the Arnt coregulator determines DNA recognition by the dioxin receptor. Mol. Cell Biol. 13, 25042514.
Wood, S. M., Gleadle, J. M., Pugh, C. W., Hankinson, O., and Ratcliffe, P. J. (1996). The role of the aryl hydrocarbon receptor nuclear translocator (ARNT) in hypoxic induction of gene expression. Studies in ARNT-deficient cells. J. Biol. Chem. 271, 1511715123.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. L. Prasch, R. L. Tanguay, V. Mehta, W. Heideman, and R. E. Peterson Identification of Zebrafish ARNT1 Homologs: 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicity in the Developing Zebrafish Requires ARNT1 Mol. Pharmacol., March 1, 2006; 69(3): 776 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Prasch, W. Heideman, and R. E. Peterson ARNT2 Is Not Required for TCDD Developmental Toxicity in Zebrafish Toxicol. Sci., November 1, 2004; 82(1): 250 - 258. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||







