ToxSci Advance Access originally published online on February 19, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences 79, 98-105 (2004)
Toxicological Sciences vol. 79 no. 1 © Society of Toxicology; all rights reserved.
Altered AP-1 (Activating Protein-1) Activity and c-jun Activation in T Cells Exposed to the Amide Class Herbicide 3,4-Dichloropropionanilide (DCPA)
Department of Microbiology, Immunology and Cell Biology, Robert C. Byrd Health Sciences Center, West Virginia University, Morgantown, West Virginia 265069177
Received October 15, 2003; accepted January 24, 2004
| ABSTRACT |
|---|
|
|
|---|
3,4-Dichloropropionanilide (DCPA), the active ingredient of some postemergence herbicides, has been demonstrated to inhibit several immune system functions including cytokine production by T cells. The central role of cytokines in regulating the immune response suggests a possible mechanism by which DCPA inhibits the immune system. Since interleukin (IL)-2 is critical in regulating many immune functions, we chose to investigate the effect of DCPA on this cytokine. Using the human T lymphoma line, Jurkat, stimulated with phorbol-12-myristate acetate (PMA) and the calcium ionophore A23187 (Io), we determined that DCPA exposure decreased IL-2 secretion and mRNA levels in a dose dependent manner. We hypothesized that DCPA affected one or more of the transcription factors that regulate IL-2 gene transcription. Activating protein 1(AP-1) is a transcription factor that has been demonstrated to be required for optimal IL-2 gene transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated a decreased level of AP-1 DNA binding activity in DCPA-exposed Jurkat cells compared to control cells from 30 min to 2 h after stimulation. The altered AP-1 DNA binding kinetics was associated with a decrease in c-jun protein in these cells at 1 and 2 h after exposure and a decreased level of phosphorylated c-jun at 14 h after exposure. These results suggest a possible mechanism for DCPA-induced IL-2 inhibition; alteration in the activation of the c-jun component of AP-1.
Key Words: 3,4-dichloropropionanilide; AP-1; c-jun; IL-2; T cell; propanil.
| INTRODUCTION |
|---|
|
|
|---|
3,4-Dichloropropionanilide (DCPA) is a member of the amide class of postemergent herbicides and is the active ingredient in such products as WHAM! EZTM. It is used extensively around the world in the cultivation of rice. The high level of acylamidase expression in rice plants allows them to detoxify DCPA, while common grass-type weeds lack this enzyme and are thus killed (Matsunaka, 1969
Studies using an in vivo mouse exposure model have demonstrated that DCPA effects several aspects of the immune system including inhibiting T-independent and T-dependent antibody responses and natural killer (NK) cell function (Barnett and Gandy, 1989
; Barnett et al., 1992
). Concanavalin A (ConA)-stimulated spleen cells from mice exposed to DCPA demonstrate decreased production of several important cytokines including IL-2, IL-6, granulocyte macrophage colony stimulatory factor (GM-CSF) and interferon-
(IFN-
) when compared to spleen cells from mice exposed to vehicle (peanut oil) only (Zhao et al., 1998
). Lipopolysaccharide (LPS)-stimulated, thioglycollate-elicited, peritoneal macrophages isolated from DCPA-exposed mice secrete less IL-6 and TNF-
than controls (Xie et al., 1997
). Further analysis demonstrated that a decrease in nuclear factor of
B (NF-
B) DNA binding activity was responsible for the decrease in TNF-
production by macrophages (Frost et al., 2001
).
Due to the important role of IL-2 in the immune response, we analyzed the mechanism involved in DCPA inhibition of IL-2 production by human T lymphocytes, using the human T lymphoma cell line Jurkat. The Jurkat cell line is a good model for normal human T cells because, like normal human T cells, they only produce IL-2 after receiving two signals: one through the T cell receptor (TCR) and the second through the costimulatory molecule CD28 (Gillis and Watson, 1980
; Manger et al., 1985
; Weiss et al., 1984
). This stimulation can be mimicked using the mitogen phorbol-12-myristate acetate (PMA) and the calcium ionophore A23187 (Io) (Truneh et al., 1985
). The human IL-2 promoter is a complex promoter with a minimum of ten binding sites for six different transcription factors (Serfling et al., 1995
). Due to the large number of transcription factor binding sites, transcriptional regulation of the IL-2 gene is multidimensional. In addition, it has been demonstrated that there is a strong cooperativity between transcription factors that bind to the IL-2 promoter, in particular, activating protein 1 (AP-1) and nuclear factor of activated T cells (NF-AT), in regulating IL-2 transcription (Crabtree and Clipstone, 1994
; Jain et al., 1995
). To extend our understanding of the mechanism by which DCPA exposure inhibits cytokine production, we determined the effect of DCPA on the transcription factor AP-1. Our results demonstrated that DCPA exposure altered the DNA binding activity of AP-1. In addition, DCPA exposure decreased the protein and phosphorylation level of the c-jun components of AP-1. Together these data suggest that DCPA inhibits IL-2 secretion, in part, by inhibiting the activation of one of the two proteins that make up the transcription factor AP-1. Thus, in activated human T cells, DCPA exposure prevents the cooperative interaction required for maximal IL-2 gene transcription.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell lines.
All experiments were performed using the human T cell line, Jurkat clone E6-1, obtained from the ATCC (American Type Culture Collection, Manassas, VA). Jurkat cells were maintained in complete RPMI (BioWhittaker, Walkersville, MD) supplemented with 10% FBS (fetal bovine serum from Hyclone Inc., Logan, UT), penicillin (100 units/ml) (BioWhittaker), streptomycin (100 µg/ml) (BioWhittaker), 20 mM L-glutamine (BioWhittaker), and 2-mercaptoethanol (5 x 105 M) (Sigma Chemical Company, St. Louis, MO).
DCPA exposure of Jurkat cells and production of IL-2.
Jurkat cells were cultured in complete RPMI media at 1 x 106 cells/ml in 24-well plates (Costar, Corning, NY), 1 ml per well. Cells were treated with 5, 25, or 100 µM DCPA (ChemServices, West Chester, PA) diluted in absolute ethanol (AAPER Alcohol and Chemical Company, Shelbyville, KY). Control cells were treated with an equivalent amount of absolute ethanol only (vehicle control) at a final concentration of 0.10%. At the time of DCPA exposure, Jurkat cells were also stimulated with 10 ng/ml PMA (Sigma Chemical Company) and 1 µg/ml calcium ionophore A23187 (Io) (Sigma Chemical Company). All cultures were done in triplicate and the experiments were performed three times. From 4 to 48 h after exposure, cultures were harvested and centrifuged at 1500 rpm for 8 min at 4°C. Supernatants were transferred into microcentrifuge tubes and frozen at 20°C for later analysis. The amount of IL-2 in each sample was assayed in triplicate by sandwich ELISA following manufacturer's instruction (BD Pharmingen, San Diego, CA).
Stimulation of cells for EMSAs, Western blots, and Northern blots.
Jurkat cells were cultured in 10 ml of complete RPMI media at 1 x 106 cells/ml in 100 mm tissue culture dishes (Corning Glass Works, Corning, NY). Cells were treated with 5, 25, 50, or 100 µM DCPA diluted in absolute ethanol or an equivalent amount of absolute ethanol only (vehicle control). The amount of ethanol never exceeded 0.10% of the culture volume. At the time of DCPA exposure, cells were stimulated with 10 ng/ml PMA and 1 µg/ml Io.
RNA isolation.
Jurkat cells were stimulated as described above for Northern blots. From 15 min to 12 h after exposure and stimulation, cells were harvested and centrifuged at 1200 rpm for 8 min at 4°C. RNA was isolated from cell pellets using Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA) per manufacturer's instructions.
Probes.
The plasmid containing a human IL-2 (hIL-2) cDNA was a gift from Dr. Suresh K. Arya (National Cancer Institute, Bethesda, MD). The plasmid containing a human GAPDH (hGAPDH) cDNA was a gift from Dr. Eric Westin (National Institute on Aging, Baltimore, MD). The plasmid containing c-jun was obtained from American Type Culture Collection (Manassas, VA). The cDNAs were isolated from their respective plasmids by restriction digestion with PstI (New England Biolabs, Beverly, MA) for hIL-2, PstI-XbaI (Gibco BRL, Rockville, MD) for hGAPDH, and EcoR1 (Promega, Madison, WI) for c-jun. Digests were electrophoresed through a 1.0% SeaKem (low melt) agarose (FMC, Rockland, ME) gel, and a QiaexII gel extraction kit (Qiagen) was used to purify the cDNA insert.
cDNAs were labeled with 32P-dCTP (ICN, Costa Mesa, CA) using a Random Primed DNA Labeling Kit (Boehringer Mannheim Corporation, Indianapolis, IN) as per manufacturer's instructions. Unincorporated 32P-dCTP was removed using G50 Sephadex Quick spin columns (Boehringer Mannheim Corporation) per manufacturer's instructions.
Northern blot analysis.
10 µg of total RNA was electrophoresed through a 1.0% agarose in formaldehyde gel as previously described (Reed et al., 1985
). Gels were washed three times for 10 minutes each wash in diethyl pyrocarbinate (DEPC) (Sigma Chemical Company) treated H2O. Gels were then incubated for 45 min in 10x SSC (1.5 M sodium chloride and 0.15 M sodium citrate). Using 10x SSC as the transfer buffer, RNA was transferred overnight by capillary blotting to a Hybond-N membrane (Amersham Pharmacia, Piscataway, NJ). After transfer, the membranes were UV-crosslinked using an UV Stratalinker (Stratagene, La Jolla, CA).
Membranes were prehybridized in a hybridization oven (Bellco Glass Company, Vineland, NJ) for 4 h at 42°C in 20 ml of NorthernMax Prehyb/Hyb buffer (Ambion Inc, Austin, Texas) containing 200 µg of denatured salmon sperm DNA. After prehybridization, the buffer was removed, and 10 ml of NorthernMax Prehyb/Hyb buffer containing 5 x 106 cpm of denatured 32P-labeled hIL-2 or c-jun cDNA was added. Membranes were hybridized overnight at 42°C in a hybridization oven. Membranes were washed twice in 2x SSC (0.3 M sodium chloride and 30 mM sodium citrate) for 5 min at room temperature, then twice in 2x SSC plus 1% SDS (sodium lauryl sulfate) at 65°C for 45 min. Membranes were wrapped in plastic wrap and exposed to a Phosphor screen (Molecular Dynamics, Sunnyvale, CA) and BioMax X-ray film (Eastman Kodak Company, Rochester, NY) for analysis.
After analysis, the probe was removed from the membranes by incubating membranes in 1% SDS at 80°C for 1 h. To ensure that the labeled probe was completely removed from the membranes, membranes were wrapped in plastic wrap and exposed to a Phosphor Screen overnight then analyzed on a Molecular Dynamics PhosphoImager. To normalize for any gel loading variability, membranes were probed with the housekeeping gene, GAPDH, as described above for IL-2. The values for IL-2 and c-jun mRNA were normalized to GAPDH mRNA levels.
Nuclear extracts for electrophoretic mobility shift assays (EMSAs).
Jurkat cells were cultured as described above for EMSAs. From 30 min to 4 h after exposure, cells were harvested and centrifuged at 1200 rpm for 8 min at 4°C. Nuclear extracts were prepared as previously described (Schreiber et al., 1989
). Briefly, cells were transferred to microcentrifuge tubes, resuspended in cold buffer A (10 mM Hepes pH 7.9, 10 mM KCL [potassium chloride], 0.1 mM EDTA [disodium ethylenediamine tetraacetate], 0.1 mM EGTA [ethylene glycol-bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid], 1 mM DTT [dithiothreitol], and 0.5 mM PMSF [phenylmethanesulfonyl fluoride]), and incubated on ice for 15 min. Next, 25 µl of a 10% solution of Nonidet NP-40 was added, and the samples were vortexed. Samples were centrifuged for 30 sec at 14,000 rpm. Supernatants, which contain the cytoplasmic fraction of the cells, were transferred to fresh tubes and frozen at 70°C. The nuclear pellet was resuspended in cold buffer C (20 mM Hepes pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF) and incubated on ice for 15 min with vortexing every 5 min. Samples were centrifuged for 5 min at 14,000 rpm, and the supernatants containing the nuclear fraction of the cells were transferred to microfuge tubes and stored at 70°C. The protein concentrations of each nuclear extract were determined using Coomassie plus protein assay reagent kit (Pierce, Rockford, IL) per manufacturer's instructions.
EMSAs.
EMSAs were performed using 2 µg of nuclear extract. The experiment was performed using four different sets of nuclear extracts. The sequence of the consensus AP-1 oligonucleotide used, purchased from Santa Cruz Biotechnology Incorporated (Santa Cruz, CA), is as follows.
5' CGCTTGATGACTCAGCCGGAA 3'
The oligonucleotide was end labeled with 32P-
ATP (NEN Life Science Products, Boston, MA) using a Ready-To-Go T4 polynucleotide kinase kit (Amersham Pharmacia Biotech Incorporated). Unincorporated 32P-
ATP was removed using a MicroSpin G-25 column (Amersham Pharmacia Biotech Incorporated) as per manufacturer's instructions. Binding reactions were performed in a 25-µl volume. Each reaction contained 2 µg nuclear extract, 2 µg dI:dC (polydeoxinosinic-deoxycytidylic acid) (Sigma Chemical Company), 25 mM NaCl, 50 mM Tris-base, 50% (v/v) glycerol, 5 mM DTT, 2.5 mM EDTA and 1 x 105 cpm of 32P-labeled oligonucleotide. Reactions were incubated for 30 min at room temperature, then electrophoresed through a 5% polyacrylamide gel with 1x TGE (250 mM Tris-base, 1.89 M glycine, and 100 mM EDTA) running buffer. Gels were dried onto Whatmann 3MM paper, wrapped in plastic wrap and exposed to a Phosphor screen (Molecular Dynamics) and BioMax X-ray film (Eastman Kodak Company) for analysis.
For cold oligonucleotide competition, binding reactions were set up as described, above except 100x unlabeled oligonucleotide was added to the reaction at the same time as the 32P-labeled oligonucleotide.
Supershifts were performed using a rabbit polyclonal IgG c-jun antibody (New England Biolabs) and a rabbit polyclonal IgG c-fos antibody (Santa Cruz Biotechnology Incorporated). For supershifts, binding reactions were set up as described above. After the 30-min incubation at room temperature, the appropriate antibodies were added to each reaction, and the reactions were incubated for an additional 30 min at room temperature, after which they were analyzed as described above.
Whole cell extracts for Western blots.
Jurkat cells were stimulated with PMA/Io and exposed to DCPA as described above. From 30 min to 4 h after exposure and stimulation, cells were harvested into 15-ml tubes, and a 10-µl aliquot of cells was taken for counting. The remaining cells were centrifuged at 1200 rpm for 8 min at 4°C. Warmed SDS Sample buffer (62.5 mM Tris-HCL pH6.8, 2% SDS, 10% glycerol, 50 mM DTT, and 0.1% bromophenol blue) was added to the cell pellets (20 µl per 1 x 106 cells). Samples were heated at 95°C for 10 min, then aliquoted and stored at 20°C until assayed. Each aliquot of extract was thawed only once.
Western blots.
20 µl of each whole cell extract (equivalent to 1 x 106 cells) was boiled for 5 min to denature the proteins. Samples were electrophoresed through 12% tris polyacrylamide gels with 4% stacking gels at 90 volts for 2 h. Proteins were transferred to Hybond-P (Amersham Pharmacia) membranes at 45 volts for 90 min. Blots were washed in TBS for 5 min at room temperature, blocked 1 h in TBS + 0.1% Tween 20 (TBS/T) plus 5% dry milk at room temperature, and washed three times in TBS/T. Blots were incubated overnight at 4°C with primary antibodies specific for total c-jun (catalog #9162), phospho c-jun ser 63 (catalog #9261), or phospho c-jun ser 73 (catalog #9164, Cell Signaling Technology, Inc., Beverly, MA) diluted 1:1000 in TBS/T plus 5% dry milk. The next day, blots were washed three times in TBS/T, 5 min per wash, incubated for 1 h at room temperature with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (H+L) secondary antibody (catalog #7074, Cell Signaling Technology, Inc.), and washed three times in TBS/T. Blots were developed using Phototope-HRP detection kit for Western blots (Cell Signaling Technology, Inc). Bands were visualized by exposing to X-Ray film (BioMax MR, Eastman Kodak Company) for 10 s to 3 min.
For quantification, blots were stripped of antibodies by washing once in H2O for 5 min at room temperature, then incubated in 0.2 M NaOH for 5 min at room temperature and washed twice in H2O for 5 min at room temperature. Blots were blocked in TBS/T plus 5% dry milk, washed three times in TBS/T, and incubated for 2 h at room temperature with an anti-actin antibody (catalog #sc-1615 or sc-1616, Santa Cruz Biotechnology). Blots were washed three times with TBS/T for 5 min at room temperature, incubated for 1 h room temperature with HRP-conjugated donkey anti-goat IgG (catalog #sc-2056 Santa Cruz Biotechnology), and developed as described above. Densitometric analysis was performed using Optimus software (Media Cybernetics, Silver Spring, MD). Total and phosphorylated c-jun protein levels were normalized to actin protein levels for each sample.
Statistics.
For statistical analysis of the data, a one-way ANOVA analysis (p < 0.05) was performed using SigmaStat version 2.0 (SPSS Inc., Chicago IL).
| RESULTS |
|---|
|
|
|---|
DCPA Exposure Decreases IL-2 Production by Jurkat Cells
To determine if DCPA exposure decreased IL-2 transcription and protein secretion in Jurkat cells, IL-2 message and protein levels were measured in cells stimulated with PMA/Io in the presence of DCPA or vehicle (ethanol). Ethanol exposure had no affect on the ability of Jurkat cells to respond to PMA/Io when compared to cells stimulated in the absence of ethanol (data not shown). However, DCPA exposure inhibited the secretion of IL-2 by Jurkat cells in a dose-dependent manner (Fig. 1). Jurkat cells exposed to 100 µM DCPA secreted a maximum of 482 ± 173 pg/ml of IL-2, a decrease of 92.0% when compared to the ethanol control (maximum of 6026 ± 248 pg/ml). IL-2 was not detected in any of the cultures until 8 h after exposure (data not shown). Under all conditions tested, viability of Jurkat cells was greater than 90%, and peak IL-2 production was at 48 h after stimulation and DCPA exposure. Although in many respects Jurkat cells behave like normal human T cells, they do not require, nor do they use, the IL-2 they produce (Weiss et al., 1984
|
Northern blot analysis was performed to determine if the reduced levels of IL-2 secreted by Jurkat cells exposed to DCPA was the result of decreased IL-2 mRNA levels. Consistent with what other laboratories have observed (Weiss et al., 1987
AP-1 Binding Is Decreased in DCPA Exposed Jurkat Cells
To determine if DCPA exposure inhibits IL-2 gene mRNA levels by altering the DNA binding activity of the transcription factor, AP-1, EMSA analysis was performed. Nuclear extracts were made from Jurkat cells exposed to DCPA or ethanol and stimulated with PMA/Io as described in Materials and Methods. Prior to stimulation and DCPA exposure, Jurkat cells had barely detectable levels of AP-1 binding (Fig. 2A, lane 2). Upon stimulation, an increase in AP-1 binding was observed over time in all cells regardless of whether they were exposed to DCPA or ethanol (Figs. 2A and 2C). However, level of AP-1 binding at the 1- and 2-h time points was decreased in the DCPA-treated cells compared to ethanol-treated cells (Fig. 2C). At 1 h postexposure, the nuclear extracts from Jurkat cells exposed to 50 µM DCPA consistently demonstrated a slightly lower level of AP-1 binding than the extracts from Jurkat cells exposed to 100 µM DCPA (Figs. 2A and 2C). When higher DCPA doses (167 µM) were used, a similar decrease in AP-1 DNA binding was observed (48% of control) (data not shown). However, at the 1 h time point, when lower doses (17 µ DCPA) were used, an increase (157% of control) in AP-1 DNA binding was observed compared to ethanol controls (data not shown). At 4 h postexposure to DCPA, the level of AP-1 binding increased in cells exposed to 50 and 100 µM DCPA to an average of 171.6% and 114.3% of controls, respectively (Fig. 2C). This increase in the percent of AP-1 binding in the nuclear extracts 4 h after DCPA exposure is due to a plateau of the level of AP-1 binding in the ethanol-exposed cells and a sharp increase in the level of AP-1 binding in the DCPA exposed cells (Fig. 2A).
|
The specificity and components of the AP-1 complexes in the EMSA is demonstrated in Figure 2B. A supershifted band is observed when extracts were incubated with antibodies to c-jun (Fig. 2B, lanes 46) or c-fos (Fig. 2B, lanes 79). The AP-1 band could be competed away with 100-fold excess of unlabeled AP-1 oligonucleotide (Fig. 2B, lanes 1012) but not with an unlabeled NF-
B oligonucleotide (Fig. 2B, lanes 1314).
Decrease in c-jun Phosphorylation and Protein Levels in DCPA-Treated Cells
The transcription factor AP-1 is a heterodimer composed of c-jun and c-fos family members. For the human IL-2 promoter, it is the c-jun and c-fos AP-1 heterodimer form that binds (Jain et al., 1995
; Serfling et al., 1995
). Previous studies in our laboratory have demonstrated that c-fos mRNA levels in the mouse T cell line EL-4 are not affected by DCPA exposure (unpublished results). Thus, we examined the protein and phosphorylation levels of c-jun by Western blot analysis. Compared to ethanol-treated cells, exposure to 100 or 25 µM DCPA decreased the amount of total c-jun protein in Jurkat cells at 30 m, 1 h, and 2 h after exposure (Figs. 3A and 3B). When compared to the total c-jun protein levels at 2 h postexposure, cells exposed to ethanol or 5 µM DCPA for 4 h had a decrease in total c-jun protein. In contrast, the amount of total c-jun protein in cells treated with 25 or 100 µM DCPA remained the same in the 4 h and 2 h samples (Figs. 3A and 3B).
|
Western blot analysis was performed to determine the level of c-jun phosphorylation on serine 63 (ser63) and serine 73 (ser73) in DCPA- and ethanol-treated cells. Due to the differences in total c-jun protein in each sample, we analyzed the level of c-jun phosphorylation as a ratio of phosphorylated c-jun on ser63 or ser73 to the amount of total c-jun protein in the cell (Figs. 3D and 3F). By doing this calculation, the level of phosphorylation in each sample could be analyzed independent of the amount of total c-jun protein in the cell. Due to the relatively small and variable amount of phosphorylated c-jun at the 30-min time point, we chose to examine c-jun phosphorylation at only the 1-, 2-, and 4-h time points when consistent levels of phosphorylated protein were observed (Figs. 3D and 3F). For c-jun phosphorylated on ser63, a decrease in the level of phosphorylation was observed in extracts from cells treated with 25 or 100 µM DCPA for 1 and 2 h (Figs. 3C and 3D). At the 4-h time point, a decrease in c-jun phosphorylation on ser63 was still observed in the extracts from cells exposed to 100 µM but not 25 µM DCPA (Figs. 3C and 3D). Examination of the phosphorylation level on ser73 demonstrated a similar decrease in phosphorylation at 1 and 4 h of exposure to 25 or 100 µM DCPA (Figs. 3E and 3F). However, at 2 h postexposure, the level of c-jun phosphorylation at ser73 in extracts from cells exposed to 25 or 100 µM DCPA was not that different from ethanol-treated cells (Figs. 3E and 3F). The effect of 5 µM DCPA on c-jun phosphorylation at ser73 was more variable, with an increase at 2 and 4 h after exposure and a decrease at 1 h postexposure when compared to extracts exposed to ethanol (Figs. 3E and 3F). Together, the Western blot and EMSA data would indicate that DCPA inhibits c-jun activation and AP-1 DNA binding activity.
DCPA Inhibits c-jun mRNA Levels
An interesting characteristic of c-jun is its ability to activate the transcription of its own gene when complexed with another protein ATF2 (Angel et al., 1988
). Since c-jun protein levels were decreased in cells exposed to DCPA, we next examined c-jun mRNA levels in Jurkat cells stimulated with PMA/Io and exposed to DCPA or ethanol. At 30 min postexposure, cells treated with 100 µM DCPA had less c-jun mRNA than controls, while the 25 µM DCPA-treated cells had more c-jun mRNA (Fig. 4). At 1 hour postexposure, the level of c-jun mRNA in the DCPA treated cells was similar (100 µM) or modestly elevated (5 and 25 µM) compared to the level in control cells (Fig. 4). Unexpectedly, the mRNA levels in the DCPA treated cells were increased at the 2-h (5, 25, and 100 µM) and 4-h (100 µM only) time points compared to control cells exposed to ethanol alone (Fig. 4). These results suggest that the degradation of c-jun mRNA is being delayed in the DCPA treated cells.
|
| DISCUSSION |
|---|
|
|
|---|
The experiments presented here demonstrate that exposure to DCPA decreases the level of IL-2 secreted by stimulated human Jurkat cells in a dose-dependent manner. We chose the well-characterized human T lymphoma cell line Jurkat for these studies because it has been used for many years as a model human T cell to delineate the signaling pathways that lead to activation and IL-2 secretion (Abraham, 2000
As previously noted in murine cells by Zhao et al. (1999)
, the decrease in IL-2 protein secretion corresponds to decreased IL-2 mRNA levels. Our experiments were designed to begin to elucidate the mechanism involved in DCPA-induced inhibition of IL-2 secretion. We chose to investigate the effect DCPA has on the transcription factor AP-1 which is known to be important in IL-2 gene regulation.
The transcriptional regulation of the human IL-2 gene is complex and multidimensional due to the multiple transcription factors that bind to the promoter region (Serfling et al., 1995
). Several studies, using inhibitors specific for individual transcription factors, as well as in vivo foot printing analysis, demonstrated a requirement for cooperative binding of three transcription factors, AP-1, NF-AT, and NF-
B for maximum IL-2 production (Chen and Rothenberg, 1994
; Garrity et al., 1994
; Novak et al., 1990
). This cooperativity can be observed within 1 h of stimulation, with maximal occupancy of the IL-2 promoter reached at 2 h poststimulation, and occupancy persisting up to 9 h poststimulation (Garrity et al., 1994
). The use of compounds such as cyclosporin A and forskolin, which inhibit individual transcription factors (NF-AT and NF-
B), provided further evidence of the need for cooperative binding of the transcription factors to the IL-2 promoter to attain maximum IL-2 production (Chen and Rothenberg, 1994
; Garrity et al., 1994
; Novak et al., 1990
). The data from these studies suggest that, in order to get maximum IL-2 production, simultaneous binding of AP-1, NF-AT, and NF-
B is required, and an inhibition or shift in kinetics of just one of the transcription factors can result in a dramatic decrease in IL-2 transcription.
In our studies, EMSA analysis demonstrated that, in Jurkat cells exposed to 50 or 100 µM DCPA, the level of AP-1 DNA binding was decreased within 1 h of exposure and remained so until 4 h after exposure, at which time the level of AP-1 DNA binding actually increased to a level greater than the ethanol control. It is interesting to note that the DNA binding activity of the two other transcription factors required for maximal IL-2 gene transcription, NF-
B and NF-AT, are also affected by DCPA exposure (data not shown). In the case of NF-
B p50:p65, DNA binding activity was decreased in cells treated with 50 or 100 µM DCPA at 1 h, 2 h, and 4 h postexposure (data not shown). NF-AT DNA binding activity was only found to be decreased at 4 h postexposure (data not shown). Therefore, DCPA reduced the DNA binding activity of these three transcription factors, and affects the timing of peak DNA binding of these factors. As indicated above, previous work (Chen and Rothenberg, 1994
; Garrity et al., 1994
; Novak et al., 1990
) clearly indicates that all transcription factors must be present at the same time for optimal transcription to occur. Thus, it is possible that, instead of the 7-h window of optimal transcription that the control cells enjoy, the DCPA-treated cells not only have less than optimal transcription factor concentrations, but also may not have total coordinated DNA binding of the factors for the entire 7-h window.
In order to understand the mechanism by which DCPA exposure affects AP-1 DNA binding activity, the effect of DCPA exposure on the c-jun component of the AP-1 complex was examined. Since we had evidence from our studies on mouse cell lines that c-fos, the other component of AP-1, was not affected by DCPA exposure, we focused our attention on c-jun and its activation pathway. In cells exposed to 25 or 100 µM DCPA, both total c-jun protein and phosphorylation was inhibited at the early time points (30 min, 1 h, and 2 h [total c-jun protein and c-jun phosphorylated on ser63 only] after exposure) when peak c-jun activation occurs. The inhibition of c-jun activation could account for the decrease in AP-1 DNA binding activity observed at these time points in our EMSA analysis. The decrease in c-jun phosphorylation could be due to an inhibition of the kinase activity of the two kinases responsible for phosphorylating c-jun on ser63 and ser73, JNK1/2 (Derijard et al., 1994
; Hibi et al., 1993
; Kallunki et al., 1994
). Alternatively, the DCPA-induced decreased c-jun phosphorylation could be the result of increase in the phosphatase activity of protein phosphatase 2A, which is responsible for dephosphorylating c-jun on ser63 and ser73 (Al-Murani et al., 1999
). Protein phosphatase 2A has also been postulated to be responsible for dephosphorylating the three negative regulatory sites on c-jun that are phosphorylated by GSK-3ß (glycogen synthase kinase 3) (Alberts et al., 1993
; Boyle et al., 1991
; Goode et al., 1992
). Thus, further studies are needed to determine which (if any) of these proteins are altered in Jurkat cells as the result of exposure to DCPA.
The level of c-jun ser73 phosphorylation in extracts from cells exposed to 5 µM DCPA demonstrated more variability from experiment to experiment. In some experiments, the level was no different than ethanol controls. In others, some increases and decreases were observed at the time points tested. The reason for this variability remains unclear, but it is possible that the 5 µM DCPA dose is borderline for the no effect dose on phosphorylation of c-jun on ser73.
We also demonstrated a decrease in c-jun mRNA levels, but only at 30 min postexposure in cells exposed to 100µM DCPA. These data suggest that the decrease in c-jun mRNA levels results in a decrease in c-jun protein levels at later time points at the 100 µM DCPA dose. An interesting finding from our studies was that the DCPA-treated cells took longer to return to baseline c-jun mRNA levels than the ethanol-control cells. This increase in the c-jun mRNA levels could explain the increase in AP-1 binding activity at the 4-h time point in cells treated with 100 µM DCPA compared to control cells. In addition, the increased c-jun mRNA levels could be responsible for the plateauing of c-jun protein levels at the 2- and 4-h time points in the cells treated with 100 µM DCPA, which is not observed in the ethanol-control cells. At this time, we are not sure if this is due to an increase in mRNA stability or transcription rate of c-jun in these cells. Further studies are planned to address this issue.
This study provides another example of a xenobiotic affecting transcription factors necessary for normal cell function. Studies in other laboratories have demonstrated that xenobiotic compounds exert their effect by altering the binding of transcription factors. Faubert and Kaminski (2000) observed a decrease in IL-2 secretion by stimulated splenocytes exposed to cannabinol. Their studies determined that cannabinol exposure resulted in decreased AP-1 binding due, in part, to decreased levels of c-jun and c-fos as well as inhibition of ERK MAP kinases (Faubert and Kaminski, 2000
). In studies investigating the effect of thiol-reactive metal compounds on RAW264.7 cells, an inhibition of NF-
B activation was observed (Jeon et al., 2000
). The activation of I
B kinases was inhibited in LPS-stimulated macrophages exposed to thiol-reactive metal compounds (Jeon et al., 2000
). Kopp and Ghosh (1994)
have demonstrated a decrease in NF-
B activation as the result of exposure to sodium salicylate and aspirin. As with the thiol-reactive metal compounds, the decrease in NF-
B activation was due to an inhibition of I
B degradation, an important step in the activation of NF-
B (Kopp and Ghosh, 1994
). Thus, different classes of chemicals can affect transcription factor binding by different means.
Experiments presented in this paper demonstrate that DCPA inhibits IL-2 secretion in human Jurkat cells. Our data demonstrate that DCPA exerts its effect, in part, by inhibiting the DNA-binding activity of the transcription factor AP-1. It appears the effect on AP-1 DNA binding activity is due to a decrease in c-jun protein levels as well as a decrease in c-jun phosphorylation on ser63 and ser73. In addition, DCPA alters c-jun mRNA levels. The exact mechanism by which DCPA alters c-jun activation remains to be elucidated.
| ACKNOWLEDGMENTS |
|---|
We thank Cheryl Walton and Nancy Jensen for their technical assistance. This work was supported by a grant from the National Institute of Environmental Health Sciences (ES11311) and the National Center for Research Resources (RR16440).
| NOTES |
|---|
1 To whom correspondence should be addressed at Department of Microbiology, Immunology and Cell Biology, West Virginia University School of Medicine, Morgantown, WV 26506-9177. Fax: (304) 293 7823. E-mail: jbarnett{at}hsc.wvu.edu.
| REFERENCES |
|---|
|
|
|---|
Abraham, R. T. (2000). Mutant T cell lines as model systems for the dissection of T cell antigen receptor signaling pathways. Immunol. Res. 22(23), 95117.[CrossRef][ISI][Medline]
Al-Murani, S. W. K., Woodgett, J. R., and Damuni, Z. (1999). Expression of I2PP2A, an inhibitor of protein phosphatase 2A, induces c-jun and AP-1 activity. Biochem. J. 341, 293298.
Alberts, A. S., Deng, T., Lin, A., Meinkoth, J. L., Schonthal, A., Mumby, M. C., Karin, M., and Feramisco, J. R. (1993). Protein phosphatase 2A potentiates activity of promoters containing AP-1 binding elements. Mol. Cell Biol. 13, 21042112.
Angel, P., Hattori, K., Smeal, T., and Karin, M. (1988). The jun proto-oncogene is positively autoregulated by its product, Jun/AP-1. Cell 55, 875885.[CrossRef][ISI][Medline]
Barnett, J. B., and Gandy, J. (1989). Effect of acute propanil exposure on the immune response of C57Bl/6 mice. Fundam. Appl. Toxicol. 12, 757764.[CrossRef][ISI][Medline]
Barnett, J. B., Gandy, J., Wilbourn D., and Theus S. A. (1992). Comparison of the immunotoxicity of propanil and its metabolite, 3,4-dichloroaniline, in C57Bl/6 mice. Fundam. Appl. Toxicol. 18, 628631.[CrossRef][ISI][Medline]
Boyle, W. J., Smeal, T., Defize, L. H., Angel, P., Woodgett, J. R., Karin, M., and Hunter, T. (1991). Activation of protein kinase C decreases phosphorylation of c-Jun at sites that negatively regulate its DNA-binding activity. Cell 64, 573584.[CrossRef][ISI][Medline]
Casida, J. E., and Lykken, L. (1969). Metabolism of organic pesticide chemicals in higher plants. Annu. Rev. Plant Physiol. 20, 607636.
Chen, D., and Rothenberg, E. V. (1994). Interleukin 2 transcription factors as molecular targets of cAMP inhibition: Delayed inhibition kinetics and combinatorial transcription roles. J. Exp. Med. 179, 931942.
Crabtree, G., and Clipstone, N. A. (1994). Signal transmission between the plasma membrane and nucleus of T lymphocytes. Annu. Rev. Biochem. 63, 10451083.[CrossRef][ISI][Medline]
Derijard, B., Hibi, M., Wu, I.-H., Barrett, T., Su, B., Deng, T., Karin, M., and Davis, R. J. (1994). JNK1: A protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-jun activation domain. Cell 76, 10251037.[CrossRef][ISI][Medline]
Dong, C., Davis, R. J., and Flavell, R. A. (2001). Signaling by the JNK group of MAP kinases. J Clin Immunol 21(4), 253257.[CrossRef][ISI][Medline]
EPA. 19881999. Pesticide market. Estimates: usage. www.epa.gov/oppbead1/pestsales/99pestsales/usage1999_2.html#table3_6.
Faubert, B., and Kaminski, N. E. (2000). AP-1 activity is negatively regulated by cannabinol through inhibition of its protein components, c-fos and c-jun. J. Leukoc. Biol. 67, 259266.[Abstract]
Frost, L. L., Neeley, Y. X., Schafer, R., Gibson, L. F., and Barnett, J. B. (2001). Propanil inhibits tumor necrosis factor-
production by reducing nuclear levels of the transcription factor nuclear factor-
B in the macrophage cell line IC-21. Toxicol. Appl. Pharmacol. 172, 186193.[CrossRef][ISI][Medline]
Garrity, P. A., Chen, D., Rothenberg, E. V., and Wold, B. J. (1994). Interleukin-2 transcription is regulated in vivo at the level of coordinated binding of both constitutive and regulated factors. Mol. Cell Biol. 14, 21592169.
Gillis, S., and Watson, J. (1980). Biochemical and biological characterization of lymphocytes regulatory molecules V. Identification of an Interleukin 2-producing human leukemia T cell line. J. Exp. Med. 152, 17091719.
Goode, N., Hughes, K., Woodgett, J. R., and Parker, P. J. (1992). Differential regulation of glycogen synthase kinase-3B by protein kinase C isotypes. J. Biol. Chem. 267, 1687816882.
Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin M. (1993). Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-jun activation domain. Genes Dev. 7, 21352148.
Jain, J., Loh, C., and Rao, A. (1995). Transcriptional regulation of the IL-2 gene. Cur. Opin. Immunol. 7, 333342.[CrossRef][ISI][Medline]
Jeon, K.-I., Jeong, J.-Y., and Jue, D.-M. (2000). Thiol-reactive metal compounds inhibit NF-kB activation by blocking IkB kinase. J. Immunol. 164, 59815989.
Kallunki, T., Su, B., Tsigelny, I., Sluss, H. K., Derijard, B., Moore, G., Davis Roger, and Karin, M. (1994). JNK2 contains a specificity-determining region responsible for efficient c-jun binding and phosphorylation. Genes Dev. 8, 29963007.
Kopp, E., and Ghosh, S. (1994). Inhibition of NF-kB by sodium salicylate and aspirin. Science 265, 956958.
Lewis, R. S. (2001). Calcium signaling mechanisms in T lymphocytes. Annu. Rev. Immunol. 19, 497521.[CrossRef][ISI][Medline]
Manger, B., Weiss, A., Weyand, C., Goronzy, J., and Stobo, J. D. (1985). T cell activation: Differences in the signals required for IL-2 production by nonactivated and activated T cells. J. Immunol. 135, 36693673.[Abstract]
Matsunaka, S. (1969). Activation and inactivation of herbicides by higher plants. Residue Rev. 25, 4558.
Mullison, W. R., Bovey, R. W., Burkjalter, A. P., Burkhalter, T. D., Hull H. M., and Swanson, K. (1979). Herbicide Handbook of the Weed Science Society of America. Weed Society of America, Champaign, IL.
Novak, T. J., Chen, D., and Rothenberg, E. V. (1990). Interleukin-1 synergy with phosphoinositide pathway agonists for induction of interleukin-2 gene expression: Molecular basis of costimulation. Mol. Cell Biol. 10, 63256334.
Reed, J. C., Sabath, D. E., Hoover, R. G., and Prystowsky, M. B. (1985). Recombinant interleukin 2 regulates levels of c-myc mRNA in a cloned murine T lymphocyte. Mol. Cell Biol. 5, 33613368.
Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989). Rapid detection of octamer binding proteins with mini-extracts, prepared from a small number of cells. Nucleic Acids Res. 17, 6419.
Serfling, E., Avots, A., and Neumann, M. (1995). The architecture of the interleukin-2 promoter: A reflection of T lymphocyte activation. Biochim. Biophys. Acta 1263, 181200.[Medline]
Smith, R. J. (1961). 3,4-Dichloropropionanilide for control of barnyard grass in rice. Weeds 9, 318322.
Truneh, A., Albert, F., Golstein, P., and Schmitt-Verhulst, A. M. (1985). Early steps of lymphocyte activation bypassed by synergy between calcium ionophores and phorbol ester. Nature 313, 318320.[CrossRef][Medline]
Weiss, A., Wiskocil, R. L., and Stobo, J. D. (1984). The role of T3 surface molecules in the activation of human T cells: A two-stimulus requirement for IL-2 production reflects events occurring at a pre-translational level. J. Immunol. 133, 123128.[Abstract]
Weiss, A., Shields, R., Newton, M., Manger, B., and Imboden, J. (1987). Ligand- receptor interactions required for commitment to the activation of the interleukin 2 gene. J. Immunol. 138, 21692176.[Abstract]
Wiskocil, R., Weiss, A., Imboden, J., Kamin-Lewis, R., and Stobo, J. D. (1985). Activation of a human T cell line: A two-stimulus requirement in the pretranslational events involved in the coordinate expression of interleukin 2 and
-interferon genes. J. Immunol. 134, 15991603.[Abstract]
www.epa.gov/oppbead1/pestsales/99pestsales/usage1999_2.html#table3_6
Xie, Y. C., Schafer, R., and Barnett, J. B. (1997). Inhibitory effect of 3,4-dichloropropionaniline on cytokine production by macrophages is associated with LPS-mediated signal transduction. J. Leukoc. Biol. 61, 745752.[Abstract]
Zhao, W., Schafer, R., and Barnett, J. B. (1998). Cytokine production by C57BL/6 mouse spleen cells is selectively reduced by exposure to propanil. J. Toxicol. Environ. Health A 55, 107120.[CrossRef][ISI][Medline]
Zhao, W., Schafer, R., and Barnett, J. B. (1999). Propanil affects transcriptional and posttranscriptional regulation of IL-2 expression in activated EL-4 cells. Toxicol. Appl. Pharmacol. 154, 153159.[CrossRef][ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
T. L. Lewis, K. M. Brundage, R. A. Brundage, and J. B. Barnett 3,4-Dichloropropionanilide (DCPA) Inhibits T-Cell Activation by Altering the Intracellular Calcium Concentration following Store Depletion Toxicol. Sci., May 1, 2008; 103(1): 97 - 107. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




