ToxSci Advance Access originally published online on March 31, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences 79, 258-265 (2004)
Toxicological Sciences vol. 79 no. 2 © Society of Toxicology; all rights reserved.
Inhibition of Insulin Synthesis by Cyproheptadine: Effects on Translation
Institute for Environmental Toxicology and Department of Pharmacology and Toxicology, Michigan State University, East Lansing, Michigan 48824
Received November 24, 2003; accepted February 6, 2004
| ABSTRACT |
|---|
|
|
|---|
The antihistaminic, antiserotonergic drug cyproheptadine (CPH) is known to inhibit insulin synthesis in vivo and in vitro. This inhibition of insulin synthesis occurs without a commensurate decrease in preproinsulin mRNA (PPImRNA) levels, suggesting a post-transcriptional mechanism of action. The goal of the present study was to investigate the direct effects of CPH on translation of PPImRNA in RINm5F cells. Results produced using a subcellular fractionation technique followed by real-time RT-PCR indicated that a 2-h 10 µM CPH treatment resulted in a decrease in the percentage of cellular PPImRNA associated with endoplasmic reticulum (ER) bound polysomes and increases in the percentages of translationally uninitiated and monoribosome-associated PPImRNA. These alterations in PPImRNA distribution were found to be concentration-dependent, chemical structure-specific, and reversible with a time course consistent with a previously reported CPH-induced inhibition of insulin synthesis. Further investigations to examine the possible effect of CPH on translation initiation were then undertaken by examining the phosphorylation state of the translation initiation factors eIF2
, eIF4E, and 4E-BP1 after CPH treatment. CPH (10 µM) treatment resulted in increased phosphorylation of eIF2
, and decreased phosphorylation of both eIF4E and 4E-BP1. These changes are all consistent with decreased initiation of translation. Taken together, these results suggest that the inhibition of insulin synthesis known to be elicited by CPH treatment of RINm5F cells and intact animals involves alterations of initiation factor phosphorylation leading to a decrease in insulin synthesis and of stored insulin in insulin-producing cells. Key Words: cyproheptadine; insulin synthesis; preproinsulin mRNA; RINm5F cells.
| INTRODUCTION |
|---|
|
|
|---|
The diabetogenic compound cyproheptadine (CPH) is known to inhibit insulin synthesis and deplete rat pancreatic insulin content in intact animals, isolated pancreatic islets, and in clonal insulin-producing cells (Chow et al., 1990
CPH is a member of a group of structurally related, heterocyclic, nitrogen-containing compounds known to produce morphologic and biochemical changes in insulin-producing cells in vivo and in vitro (Hintze et al., 1977a
,b
;Miller et al., 1993
). Certain CPH analogs are much more potent than the parent compound while other structural analogs have no effect on insulin synthesis because they lack the minimum chemical structure necessary for CPH-like toxicity (Hintze et al., 1977a
). Two well-characterized structural analogs of CPH are 4-diphenylmethylpiperidine (4-DPMP) and 2-diphenylmethylpiperidine (2-DPMP); 4-DPMP has been shown to produce CPH-like ß-cell toxicity while 2-DPMP elicits no toxicological effects (Hintze et al., 1977a
; Miller et al., 1993
). Current studies employing CPH and these analogs were undertaken to determine if the effects of CPH-like compounds on the subcellular location of PPImRNA exhibit the same requirements for chemical structure as previously reported for CPH-induced pancreatic ß-cell toxicity.
The translation of secretory proteins, including insulin (Eskridge and Shields, 1983
), begins in the cytosolic compartment and is completed after polyribosomes translocate to the endoplasmic reticulum (ER). Intracellular translocation of ribosomal PPImRNA to the ER membrane results in the insertion of the preproinsulin nascent chain into the lumen of the ER. Preproinsulin is processed into insulin as it moves through the pathway leading to secretion. In the present study, the subcellular localization of PPImRNA in response to CPH treatment was examined in order to detect an effect of CPH and its analogs on the movement of ribosomal-associated PPImRNA to the ER.
The initiation stage of protein translation is generally regarded as rate-limiting for protein synthesis and alterations in initiation are the most common means of translational control (Dever, 2002
). There are two sets of initiation factor interactions that are generally regarded as the predominant regulators of initiation: the interaction of eIF2 with eIF2B and the interactions between eIF4E and the eIF4E-binding proteins (4E-BPs; Dever, 2002
, Gilligan et al., 1996
). These initiation factors have been implicated in the regulation of global protein synthesis but have also been shown to be specifically involved in the translation of PPImRNA (Gilligan et al., 1996
, Xu et al., 1998
). The best characterized regulator of eIF2 activity is the phosphorylation of its
-subunit at Ser51. Phosphorylation at Ser51 increases the affinity of eIF2 for its guanine-nucleotide exchange factor, eIF2B, inhibiting guanine nucleotide exchange (Hershey, 1991
), and ultimately inhibiting initiation. The initiation factor eIF4E is a member of the eIF4F complex and is involved in cap-dependent translation. The 4E-BPs inhibit translation by competitively binding to eIF4E thus preventing the formation of the eIF4F complex. The binding of 4E-BP to eIF4E is regulated by phosphorylation; hyperphosphorylation of 4E-BP blocks its binding to eIF4E (Gingras et al., 2001
) alleviating translational repression. While the general mechanisms involved in the initiation of translation are being elucidated in many laboratories, very little is known concerning the interruption of the initiation process by chemical agents known to alter insulin synthesis. Therefore, the ability of CPH to alter the phosphorylation state of selected initiation factors was explored in the present study.
A direct effect of CPH treatment on insulin gene translation was investigated by first examining the subcellular localization of PPImRNA in response to CPH or its structural analogs. Results from those studies were consistent with a CPH-induced inhibition of the initiation stage of translation. To further examine a possible effect of CPH on initiation, the phosphorylation state of the initiation factors eIF2
, eIF4E, and 4E-BP1 were determined in treated and control cells. Evidence presented in this report suggests that the inhibition of insulin synthesis induced by CPH treatment involves effects on the initiation process of PPImRNA translation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals and reagents.
Cyproheptadine (hydrochloride monohydrate) was obtained from the Merck Institute for Therapeutic Research (West Point, PA). 4-Diphenylmethylpiperidine (4-DPMP) was obtained from Pfaltz and Bauer (Flushing, NY). 2-Diphenylmethylpiperidine (2-DPMP) was synthesized by Dr. H. Aboul-Enein (Hintze et al., 1977a
Cell culture.
RINm5F cells were the generous gift of Dr. Paolo Meda (Geneva, Switzerland) and were cultured as described by Gazdar et al. (1980)
. Cells were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum, 100 µg/ml penicillin, and 100 mU/ml streptomycin under an atmosphere of 5% CO2. Stock cultures were passaged weekly and received fresh medium every two days. The cells were utilized on days 12 after plating for initiation factor phosphorylation experiments and day 5 for all other experiments. Cells did not reach confluence during the experimental period.
RNA extraction.
Total RNA was extracted from all subcellular fractions using TRI Reagent LS (Sigma Chemical Co., St. Louis, MO) following manufacturer's instructions. For all RNA extractions, BCP was utilized as the phase separatant. RNA samples were resuspended in 0.1% DEPC treated water and stored at 80°C until analysis. Immediately prior to RT-PCR analysis, samples were treated with DNase I to eliminate any potential DNA contamination.
Real-time quantitative RT-PCR procedure.
A fluorogenic probe (VIC-CCACGCTTCTGCCGGGCAA-TAMRA) and specific primers (forward 5' TCTTCAGACCTTGGCACTGGA 3' and reverse 5' AGATGCTGGTGCAGCACTGAT 3') for rat preproinsulin 1 were designed using Primer Express software (Perkin-Elmer [PE] Applied Biosystems, Foster City, CA). The primers and probe were then purchased from PE Applied Biosystems (Foster City, CA). All oligonucleotides were purified by HPLC according to the manufacturer.
RT-PCR reactions were performed using the GeneAmp 5700 Sequence Detector (PE Applied Biosystems, Foster City, CA). PPImRNA standards were generated from total RNA extracted from naïve RINm5F cells (Heid et al., 1996
). All reactions were performed in a total volume of 25 µl, containing 10 µl of standard or sample RNA (< 50 ng total RNA), 3 mM Mn(OAc)2, 300 µM each deoxyATP, deoxyCTP, and deoxyGTP, 600 µM deoxyUTP, 0.25 U AmpErase UNG, 0.5 U rTth DNA polymerase, 100 nM of each primer, 200 nM of the fluorogenic probe, and 60 nM of the passive reference dye (ROX-AGTTGG). Each RT-PCR amplification was performed in duplicate wells, using the following conditions: 2 min at 50°C, 30 min at 60°C, and 5 min at 95°C followed by a total of 40 cycles of 15 s at 94°C and 1 min at 60°C.
Validation of the ER separation procedure using calnexin.
It was necessary to determine the ER separation efficiency of the centrifugation procedure for RINm5F cells because it was originally used by Welsh et al. (1986)
to produce subcellular fractions from isolated rat pancreatic islets (Welsh et al., 1986
). Calnexin, an ER-specific protein (Ahluwalia et al., 1992
), was utilized as a marker to examine the subcellular fractions generated during the fractionation procedure for the presence of the ER membranes. Protein from the PNS and all subcellular fractions was precipitated using the method of Wessel and Flugge (1984)
. Protein samples were then separated via SDS-PAGE on 7.5% gels followed by transfer to Immobilon-P membranes. Calnexin was determined via immunoblotting using a synthetic immunogen (Calbiochem-Novabiochem Corp., La Jolla, CA). Blots were developed using SuperSignal West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL).
Determination of CPH effects on the subcellular distribution of PPImRNA.
RINm5F cells were plated at 2 x 105 cells per dish in 100 mm culture dishes (Corning Inc., Corning, NY). Two culture dishes were combined for each homogenization. Initial experiments were conducted using a 10 µM CPH treatment for 2 h, which has previously been shown to cause an inhibition of insulin synthesis in this cell line (Miller et al., 1993
). After appropriate incubation as described in figure legends, treated and control cells were washed 2x with Ca++/Mg++ free PBS and then homogenized in 4 ml homogenization buffer (250 mM sucrose, 250 mM KCl, 10 mM MgCl2, 10 mM Tris-HCl [pH 7.5], 2 mM DTT, 12 units RNasin/ml, 5 µg/ml leupeptin, 2 µg/ml aprotinin, and 2 µg/ml antipain) with 10 strokes in a dounce homogenizer followed by four passes through a 25 gauge needle. The centrifugation-based subcellular fractionation procedure of Welsh et al. (1986)
was then utilized for the determination of RINm5F cell PPImRNA in four subcellular fractions as shown in Figure 1A: a free polyribosome fraction, an ER-bound polyribosome fraction, an uninitiated fraction, and a monoribosome fraction. Briefly, cell homogenates were centrifuged at 1500 x g for 5 min to pellet nuclei and cell debris. The post-nuclear supernatant was centrifuged for 1 h at 100,000 x g. The 100,000 x g pellet was then resuspended and centrifuged at 750 x g for 2 min then 130,000 x g for 12 min; the subsequent pellet contains PPImRNA associated with ER-bound polyribosomes while the supernatant contains PPImRNA associated with free polyribosomes. The 100,000 x g supernatant was then centrifuged at 255,000 x g for 2 h; the subsequent pellet contains monoribosome-associated PPImRNA and the supernatant contains uninitiated PPImRNA. Throughout the entire homogenization and fractionation procedure, precautions were taken to prevent ribonuclease contamination and the temperature was maintained at 4°C.
|
Presentation and statistical analyses of mRNA subcellular distribution data.
RNA was extracted from all fractions using TRI REAGENT LS and PPImRNA was quantitated using real-time RT-PCR as described above. As these experiments were conducted to examine the effect of CPH on the subcellular distribution of PPImRNA only, PPImRNA values in the individual fractions are reported as a percentage of the sum total of PPImRNA recovered from all four fractions. Statistical analyses were conducted by Student's t-test. All percentile data was transformed via arcsin square root transformation prior to statistical analysis.
Western analysis.
For determination of initiation factor phosphorylation, RINm5F cells were plated at 5 x 105 (eIF2
) or 1 x 106 (eIF4E and 4E-BP1) cells per dish in 60 mm culture dishes (Corning Inc., Corning, NY). Following experimental treatment as described in the figure legends, treated and control cells were washed 2x with Ca++/Mg++ free PBS, lysed in 300 µl sample buffer (62.5 mM Tris-HCl, pH 6.8, 50 mM DTT, 2% SDS, 10% glycerol, and 0.01% bromophenol blue), heated at 100°C for 5 min and centrifuged at 10,000 x g for 15 min. Following centrifugation, 15 µl of supernatant was separated via SDS-PAGE on 10% gels (eIF2
) and 15% gels (eIF4E and 4E-BP1) followed by transfer to Immobilon-P membranes. The phosphorylation states of eIF2
(Ser51), eIF4E (Ser209), and 4E-BP1 (Ser65/101, Wang et al., 2003
) were assessed using polyclonal antibodies specific for the phosphorylated forms of these proteins or polyclonal antibodies specific for the proteins independent of phosphorylation (Cell Signaling, Beverly, MA). Immunoreactive bands were detected by enhanced chemiluminescence (ECL, Amersham, Piscataway, NJ). After initial detection of both phosphorylated and total initiation factors, the membranes were washed and ß-actin protein levels were measured using a monoclonal antibody (Novus Biologicals, Littleton, CO). ß-Actin immunoreactive bands were detected as described above. To quantify the change in initiation factor phosphorylation, all blots were subjected to densitometric scanning using NIH Image (NIH, Bethesda, MD) and initiation factor protein levels were normalized to ß-actin protein levels.
| RESULTS |
|---|
|
|
|---|
The aim of these studies was accomplished in part by using the subcellular fractionation procedure (Fig 1A) to separate PPImRNA associated with various ribosomal populations in RINm5F cells. As shown in Figure 1B, calnexin, an ER-specific protein, was found only in the fraction reported to contain ER-bound polyribosomes (Welsh et al., 1986
The fractionation procedure was then utilized to examine the effects of CPH treatment on the subcellular distribution of PPImRNA. The total amount of PPImRNA recovered from all subcellular fractions during a 2 h treatment of RINm5F cells with 10 µM CPH was 110.7 ± 15.4% (n = 6) of control values, indicating no treatment related alteration in PPImRNA levels. However, CPH exhibited the ability to alter the subcellular localization of PPImRNA as shown in Figure 2. A 2 h incubation with increasing concentrations of CPH resulted in no detectable effect using 1 µM but significant alterations in the percentages of recovered PPImRNA associated with various ribosomal populations were observed with 5 and 10 µM CPH. The alterations in PPImRNA subcellular localization were concentration dependent with the 10 µM treatment group showing a 33% decrease in the percentage of PPImRNA found at the ER and 56 and 52% increases in the percentages of uninitiated PPImRNA and monoribosome-associated PPImRNA, respectively (Fig. 2). A 30 min incubation with 10 µM CPH was sufficient to induce these alterations in PPImRNA localization whereas no treatment-related change occurred at 15 min (Fig. 3).
|
|
Experiments were conducted to determine whether the alterations in PPImRNA subcellular distribution induced by CPH treatment were reversible. As shown in Figure 4, a 24 h recovery period following a 2 h 10 µM CPH treatment was sufficient to return the PPImRNA distribution to control values indicating the reversibility of the effect.
|
Results of experiments conducted to examine structure-specificity for the CPH-induced PPImRNA subcellular dislocation are shown in Figure 5. A 2 h incubation with 10 µM 4-DPMP induced PPImRNA subcellular dislocation nearly identical to that seen with CPH treatment while a 2 h incubation with 10 µM 2-DPMP showed no effect.
|
The phosphorylation states of the initiation factors eIF2
, eIF4E, and 4E-BP1 were then investigated to determine if alterations in the phosphorylation status of these initiation factors were induced by CPH treatment of RINm5F cells. As shown in Figure 6, a 24 h incubation with 10 µM CPH induced a 267% increase in eIF2
Ser51 phosphorylation while the level of total eIF2
protein was unchanged. Hypophosphorylation of both eIF4E (Fig. 7) and 4E-BP1 (Fig. 8) was induced by a 2 h incubation with 10 µM CPH. As with eIF2
, there were no alterations in the levels of total eIF4E or 4E-BP1 seen in response to CPH treatment.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Chemical-induced changes in gene transcription are often involved in alterations in protein synthesis that lead to toxicity. However, it is relatively rare that chemicals are reported to directly alter the translation process of protein synthesis to inhibit the production of a polypeptide hormone such as insulin. The results reported here document that a post-transcriptional mechanism is involved in the inhibition of insulin synthesis, a major component involved in CPH-induced depletion of insulin in RINm5F cells and presumably ß-cells of the endocrine pancreas. This is consistent with a previous report that a decline of PPImRNA did not occur at a time when a CPH-related inhibition of insulin synthesis could be observed (Miller et al., 1993
Results from a subcellular fractionation technique followed by RT-PCR indicated that CPH elicited a shift in the percentage of PPImRNA localized at the ER relative to the fraction found in the monoribosome-associated and uninitiated PPImRNA pools. Because the translation of the insulin message is dependent upon the translocation of the ribosome-associated nascent chain from the cytosolic compartment to the ER, a CPH related decrease in the percentage of PPImRNA localized at the ER is consistent with a treatment-related inhibition of translation. In addition, the increases in the monoribosome and uninitiated PPImRNA pools are suggestive of an inhibition of the initiation stage of translation.
The effects of CPH on the translation of PPImRNA were found to be consistent with previous reports characterizing the toxicity of the compound in the endocrine pancreas. Alterations in PPImRNA subcellular localization were evident at a concentration of 5 µM CPH but not at 1 µM, demonstrating a concentration dependence consistent with the concentration dependence of CPH ß-cell toxicity seen in vitro (Miller and Fischer, 1990
; Miller et al., 1993
). The effect of CPH on PPImRNA subcellular localization was apparent after 30 min of treatment. This is consistent with the relatively rapid inhibition of insulin synthesis seen in isolated rat pancreatic islets and in RINm5F cells treated with CPH (Miller et al., 1991
, 1993
). The CPH analog 4-DPMP elicited a dislocation of PPImRNA nearly identical to that of CPH while 2-DPMP produced no effect. The specificity of this translational effect is consistent with the specificity of chemical structure demonstrated for 4-DPMP and CPH-like toxicity in primary insulin-producing cells (Hintze et al., 1977a
) and in RINm5F cells (Miller et al., 1993
). In addition, the CPH-induced PPImRNA subcellular dislocation was found to be completely reversible upon removal of the compound, with reversibility being a prominent characteristic of CPH ß-cell toxicity (Miller and Fischer, 1990
; Rickert et al., 1975
). The consistency of the characteristics of the CPH effects found in the present study with previous reports on the effects of the compound on insulin synthesis and cellular insulin content observed in vivo and in vitro supports the contention that the observed alterations in cellular localization of PPImRNA reported here are associated with the toxicity of CPH in the insulin producing ß-cells of intact animals.
In addition to the alterations in PPImRNA subcellular localization, we have demonstrated CPH-induced alterations in the phosphorylation state of the initiation factors eIF2
, eIF4E, and 4E-BP1, members of the general translation machinery. Though alterations in initiation factor phosphorylation have been shown to affect global rates of protein synthesis (Dever, 2002
), there are several reports indicating that changes in the activity of eIFs induce gene-specific translational control. Studies such as these have led to the proposal that certain mRNAs are more sensitive to small changes in initiation efficiency and are therefore susceptible to gene-specific regulation when the general translation machinery is perturbed (Dever, 2002
). This mechanism of regulation may underlie the insulin-specific regulation elicited by alterations in eIF2
and 4E-BP1 phosphorylation as both of these eIFs are known to be involved in both general and gene-specific translational regulation (Dever, 2002
). Whether the insulin message ranks among those mRNAs susceptible to this type of translational regulation remains unknown and further investigation into this question is warranted.
Electron micrographs of pancreatic islets isolated from CPH-treated rats show marked ultrastructural changes (Longnecker et al., 1972
; Richardson et al., 1975
; Wold et al., 1971
). There is a loss of insulin secretion granules, dilation and vesiculation of the ER, and the formation of large cytoplasmic vacuoles. These vesicles and cytoplasmic vacuoles contain an electron-dense material that has not been identified but has been speculated to be secretory protein precursors (Rickert et al., 1976
). Some of the morphologic features of CPH toxicity in the ß-cell are shared by ER-stress conditions which activate a multifaceted signaling pathway known as the unfolded protein response (UPR). The accumulation of malfolded proteins in the ER has been shown to trigger the UPR to elicit a decrease in translation (Harding et al., 2000
; Kaufman, 1999
). The translational inhibition induced by the UPR is due to the activation of an ER kinase known as PERK (PKR-Like ER Kinase) which phosphorylates eIF2
at Ser51 (Harding et al., 1999
; Shi et al., 1998
). PERK is abundant in the pancreas and has a very high level of basal activity (Harding et al., 2001
; Zhang et al., 2002
). Interestingly, PERK null mice exhibit ultrastructural changes in the insulin-secreting ß-cell, including the vesiculation of the ER and loss of insulin secretory granules (Harding et al., 2001
; Zhang et al., 2002
), similar to that seen in CPH-treated rats (Longnecker et al., 1972
; Richardson et al., 1975
). However, there are some ultrastructural and biochemical differences between the -/-PERK phenotype and CPH toxicity in the endocrine pancreas indicating the action of CPH may not be completely identical to that associated with the UPR.
In this study, increased phosphorylation of the initiation factor eIF2
was induced by CPH treatment. While the CPH-induced increased eIF2
phosphorylation may contribute to the overall inhibition of insulin synthesis induced by CPH, further experimentation is necessary to determine the significance of this effect in CPH-induced insulin synthesis inhibition. In particular, studies of the potential involvement of the UPR in CPH-induced inhibition of insulin synthesis may provide valuable information on the role of PERK in the insulin biosynthetic pathway and may provide additional insight into the Wolcott-Rallison syndrome, a rare genetic disease typified by severe diabetes mellitus, mapped to a mutation in the human PERK gene (Delepine et al., 2000
).
The best characterized translational regulator of insulin synthesis is glucose. Glucose has been shown to elicit three translational effects on proinsulin synthesis: an effect on the general translation machinery, including increases in eIFB activity and 4E-BP1 phosphorylation (Campbell et al., 1999
; Gilligan et al., 1996
; Patel et al., 2001
; Xu et al., 1998
); an effect on the signal peptide/SRP interaction (Guest et al., 1991
; Welsh et al., 1986
, 1991
); and an effect involving the untranslated regions (UTRs) of PPImRNA (Wicksteed et al., 2001
). It has been proposed that the predominant mechanism of glucose-regulated PPImRNA translation and proinsulin synthesis is due to the latter mechanism and involves the cooperativity of both the 5' and 3' UTRs of PPImRNA (Wicksteed et al., 2001
). The findings that both the 5' and 3' UTRs are involved in insulin translation supports the involvement of both the eIF4F complex and the poly(A)-binding protein (PABP) in this process (Sachs, 1999
) and supports the possibility of an effect of CPH on insulin translation via hypophosphorylation of eIF4E and 4E-BP1.
The role of eIF4E phosphorylation in cellular translational control is not fully understood. This initiation factor has been shown to be phosphorylated as a result of a number of stimuli, including mitogens, hormones, growth factors, etc. (reviewed in Proud, 1992
; Morley, 1996
) though the physiologic significance of eIF4E phosphorylation has not been fully elucidated. The regulation of eIF4E phosphorylation is dependent upon both kinase and phosphatase activity and it has been suggested that it is not the direct phosphorylation of eIF4E but rather the phosphate turnover during successive rounds of initiation that is important for its function (Morley, 1996
). The hypophosphorylation of eIF4E and/or 4E-BP1 seen with CPH treatment could lead to decreased eIF4F complex formation and therefore inhibit the interaction between the 5' and 3' ends of PPImRNA leading to decreased insulin synthesis; however, such a mechanism is speculative.
While the exact mechanism of CPH-induced PPImRNA subcellular dislocation remains to be elucidated, our results support inhibitory effects of the compound on the phosphorylation of eIF2
, eIF4E, and 4E-BP1 leading to decreased initiation of PPImRNA translation. As PPImRNA is translocated to the ER after translation has been initiated, we suggest that the inhibition of PPImRNA initiation elicited by CPH treatment results in a decrease in the percentage of PPImRNA localized at the ER and increases in the monoribosome-associated and uninitiated PPImRNA pools.
Further investigation into the mechanism of CPH initiation inhibition is warranted as this compound is unusual in its ability to selectively inhibit insulin synthesis and reversibly deplete pancreatic insulin content via, at least in part, an action at the level of translation. The information provided by further investigation into CPH-induced inhibition of translation may improve our understanding of the regulatory control of insulin synthesis and its susceptibility to alteration by chemical agents.
| NOTES |
|---|
1 Present address: U.S. Environmental Protection Agency, Ariel Rios Building2842T, 1200 Pennsylvania Ave., N.W., Washington, DC 20460.
2 To whom correspondence should be addressed at Institute for Environmental Toxicology, C-231 Holden Hall, Michigan State University, East Lansing, MI 48824. Fax: (517) 355-4603. E-mail: lfischer{at}msu.edu
| REFERENCES |
|---|
|
|
|---|
Ahluwalia, N., Bergeron, J. J., Wada, I., Degen, E., and Williams, D. B. (1992). The p88 molecular chaperone is identical to the endoplasmic reticulum membrane protein, calnexin. J. Biol. Chem. 267, 1091410918.
Blackshear, P. J., Stumpo, D. J., Carballo, E., and Lawrence, J. C., Jr. (1997). Disruption of the gene encoding the mitogen-regulated translational modulator PHAS-I in mice. J. Biol. Chem. 272, 3151031514.
Campbell, L. E., Wang, X., and Proud, C. G. (1999). Nutrients differentially regulate multiple translation factors and their control by insulin. Biochem. J. 344(Pt. 2), 433441.[Medline]
Chow, S. A., Falany, J. H., and Fischer, L. J. (1990). Cyproheptadine metabolites inhibit proinsulin and insulin biosynthesis and insulin release in isolated pancreatic islets. Cell Biol. Toxicol. 5, 129143.[CrossRef]
Delepine, M., Nicolino, M. M., Barrett, T., Golamaully, M., Lathrop, G. M., and Julier, C. (2000). EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in patients with Wolcott-Rallison syndrome. Nat. Genet. 25, 406409.[CrossRef][ISI][Medline]
Dever, T. E. (2002). Gene-specific regulation by general translation factors. Cell 108, 545556.[CrossRef][ISI][Medline]
Eskridge, E. M., and Shields, D. (1983). Cell-free processing and segregation of insulin precursors. J. Biol. Chem. 258, 1148711491.
Gazdar, A. F., Chick, W. L., Oie, H. K., Sims, H. L., King, D. L., Weir, G. C., and Lauris, V. (1980). Continuous, clonal, insulin- and somatostatin-secreting cell lines established from a transplantable rat islet cell tumor. Proc. Nat. Acad. Sci. U.S.A. 77, 35193523.
Gilligan, M., Welsh, G. I., Flynn, A., Bujalska, I., Diggle, T. A., Denton, R. M., Proud, C. G., and Docherty, K. (1996). Glucose stimulates the activity of the guanine nucleotide-exchange factor eIF-2B in isolated rat islets of Langerhans. J. Biol. Chem. 271, 21212125.
Gingras, A. C., Raught, B., Gygi, S. P., Niedzwiecka, A., Miron, M., Burley, S. K., Polakiewicz, R. D., Wyslouch-Cieszynska, A., Aebersold, R., and Sonenberg, N. (2001). Hierarchical phosphorylation of the translation inhibitor 4E-BP1. Genes Dev. 15, 28522864.
Guest, P. C., Bailyes, E. M., Rutherford, N. G., and Hutton, J. C. (1991). Insulin secretory granule biogenesis. Co-ordinate regulation of the biosynthesis of the majority of constituent proteins. Biochem. J. 274, 7378.[Medline]
Halban, P. A., Wollheim, C. B., Blondel, B., Niesor, E., and Renold, A. E. (1979). Perturbation of hormone storage and release induced by cyproheptadine in rat pancreatic islets in vitro. Endocrinology 104, 10961106.[Abstract]
Harding, H. P., Zeng, H., Zhang, Y., Jungries, R., Chung, P., Plesken, H., Sabatini, D. D., and Ron, D. (2001). Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in secretory cell survival. Mol. Cell 7, 11531163.[CrossRef][ISI][Medline]
Harding, H. P., Zhang, Y., Bertolotti, A., Zeng, H., and Ron, D. (2000). Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol. Cell 5, 897904.[CrossRef][ISI][Medline]
Harding, H. P., Zhang, Y., and Ron, D. (1999). Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271274.[CrossRef][Medline]
Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. (1996). Real time quantitative PCR. Genome Res. 6, 986994.
Hershey, J. W. (1991). Translational control in mammalian cells. Annu. Rev. Biochem. 60, 717755.[CrossRef][ISI][Medline]
Hintze, K. L., Aboul-Enein, H. Y., and Fischer, L. J. (1977a). Isomeric specificity of diphenylmethylpiperidine in the production of rat pancreatic islet cell toxicity. Toxicology 7, 133140.[CrossRef][ISI][Medline]
Hintze, K. L., Grow, A. B., and Fischer, L. J. (1977b). Cyproheptadine-induced alterations in rat insulin synthesis. Biochem. Pharmacol. 26, 20212027.[CrossRef][ISI][Medline]
Kaufman, R. J. (1999). Stress signaling from the lumen of the endoplasmic reticulum: Coordination of gene transcriptional and translational controls. Genes Dev. 13, 12111233.
Longnecker, D. S., Wold, J. S., and Fischer, L. J. (1972). Ultrastructural study of alterations in beta cells of pancreatic islets from cyproheptadine-treated rats. Diabetes 21, 7179.[ISI][Medline]
Miller, C. P., and Fischer, L. J. (1990). Cyproheptadine-induced alterations in clonal insulin-producing cell lines. Biochem. Pharmacol. 39, 19831990.[CrossRef][ISI][Medline]
Miller, C. P., Giddings, S. J., Chatterjee, A. K., and Fischer, L. J. (1991). Rapid alteration of pancreatic proinsulin and preproinsulin messenger ribonucleic acid in rats treated with cyproheptadine. Endocrinology 128, 30403046.[Abstract]
Miller, C. P., Reape, T. J., and Fischer, L. J. (1993). Inhibition of insulin production by cyproheptadine in RINm5F rat insulinoma cells. J. Biochem. Toxicol. 8, 127134.[CrossRef][ISI][Medline]
Morley, S. J. (1996). Regulation of components of the translational machinery by protein phosphorylation. In Protein Phosphorylation in Cell Growth Regulation (M. J. Clemens, Ed.), pp. 197224. Harwood Academic Press, Amsterdam.
Patel, J., Wang, X., and Proud, C. G. (2001). Glucose exerts a permissive effect on the regulation of the initiation factor 4E binding protein 4E-BP1. Biochem. J. 358, 497503.[CrossRef][ISI][Medline]
Proud, C. G. (1992). Protein phosphorylation in translational control. Curr. Top. Cell. Regul. 32, 243369.[ISI][Medline]
Richardson, B. P., Turcot-Lemay, L., McDaniel, M. L., and Lacy, P. E. (1975). Pancreatic beta cell changes induced by cyproheptadine in vitro. Lab. Invest. 33, 509513.[ISI][Medline]
Rickert, D. E., Burke, J., and Fischer, L. J. (1975). Cyproheptadine-induced depletion of insulin in the rat. J. Pharmacol. Exp. Ther. 193, 585593.
Rickert, D. E., Fischer, L. J., Burke, J. P., Redick, J. A., Erlandsen, S. L., Parsons, J. A., and Van Orden, L. S. d. (1976). Cyproheptadine-induced insulin depletion in rat pancreatic beta cells: Demonstration by light and electron microscopic immunocytochemistry. Horm. Metab. Res. 8, 430434.[ISI][Medline]
Sachs, A. B. (1999). Physical and functional interactions between the mRNA cap structure and the poly(A) tail. In Translational Control of Gene Expression (N. Sonenberg, J. W. Hershey, and M. B. Mathews, Eds.), pp. 447465. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Shi, Y., Vattem, K. M., Sood, R., An, J., Liang, J., Stramm, L., and Wek, R. C. (1998). Identification and characterization of pancreatic eukaryotic initiation factor 2 alpha-subunit kinase, PEK, involved in translational control. Mol. Cell. Biol. 18, 74997509.
Wang, X, Wei, L., Parra, J., Beugnet, A., and Proud, C. G. (2003). The C terminus of initiation factor 4E-binding protein 1 contains multiple regulatory features that influence its function and phosphorylation. Mol. Cell. Biol. 23, 15461557.
Welsh, M., Scherberg, N., Gilmore, R., and Steiner, D. F. (1986). Translational control of insulin biosynthesis. Evidence for regulation of elongation, initiation and signal-recognition-particle-mediated translational arrest by glucose. Biochem. J. 235, 459467.[ISI][Medline]
Welsh, N., Oberg, C., and Welsh, M. (1991). GTP-binding proteins may stimulate insulin biosynthesis in rat pancreatic islets by enhancing the signal-recognition-particle-dependent translocation of the insulin mRNA poly-/mono-some complex to the endoplasmic reticulum. Biochem. J. 275, 2328.[Medline]
Wessel, D., and Flugge, U. I. (1984). A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem. 138, 141143.[CrossRef][ISI][Medline]
Wicksteed, B., Herbert, T. P., Alarcon, C., Lingohr, M. K., Moss, L. G., and Rhodes, C. J. (2001). Cooperativity between the preproinsulin mRNA untranslated regions is necessary for glucose-stimulated translation. J. Biol. Chem. 276, 2255322558.
Wold, J. S., Longnecker, D. S., and Fischer, L. J. (1971). Species dependent pancreatic islet toxicity produced by cyproheptadine: Alterations in beta cell structure and function. Toxicol. Appl. Pharmacol. 19, 188201.[CrossRef][ISI][Medline]
Xu, G., Marshall, C. A., Lin, T. A., Kwon, G., Munivenkatappa, R. B., Hill, J. R., Lawrence, J. C., Jr., and McDaniel, M. L. (1998). Insulin mediates glucose-stimulated phosphorylation of PHAS-I by pancreatic beta cells. An insulin-receptor mechanism for autoregulation of protein synthesis by translation. J. Biol. Chem. 273, 44854491.
Zhang, P., McGrath, B., Li, S., Frank, A., Zambito, F., Reinert, J., Gannon, M., Ma, K., McNaughton, K., and Cavener, D. R. (2002). The PERK eukaryotic initiation factor 2 alpha kinase is required for the development of the skeletal system, postnatal growth, and the function and viability of the pancreas. Mol. Cell. Biol. 22, 38643874.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







