ToxSci Advance Access originally published online on July 28, 2004
Toxicological Sciences 2004 82(1):250-258; doi:10.1093/toxsci/kfh235
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences vol. 82 no. 1 © Society of Toxicology 2004; all rights reserved.
ARNT2 Is Not Required for TCDD Developmental Toxicity in Zebrafish

,1
* Molecular and Environmental Toxicology Center, and
School of Pharmacy, University of Wisconsin, Madison, Wisconsin 53705
Received May 27, 2004; accepted July 26, 2004
| ABSTRACT |
|---|
|
|
|---|
ZfAHR2 has been identified as the receptor that is essential for mediating the developmental toxicity caused by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in zebrafish. One form of zfARNT2, zfARNT2b, forms a functional heterodimer with zfAHR2 that specifically recognizes XREs in gel shift experiments and induces XRE-driven transcription in COS-7 cells treated with TCDD. However, it has not been demonstrated that zfARNT2b acts as the physiological dimerization partner for zfAHR2 to mediate TCDD toxicity in developing zebrafish. An antisense morpholino targeted against zfARNT2 (zfarnt2-MO) along with a line of mutant zebrafish lacking expression of the zfarnt2 gene have been used to test the hypothesis that zfARNT2 mediates the developmental toxicity of TCDD. Injection of the zfarnt2-MO decreased expression of the zfARNT2 protein but did not provide any protection against the formation of pericardial edema at 72 hpf. In addition, in TCDD dose response studies the zfarnt2/ embryos showed no protection against three endpoints of TCDD toxicity observed at 96 hpf: pericardial edema, reduced trunk blood flow, and shortened lower jaw. Finally, immunostaining results at 96 hpf demonstrate that the zfarnt2/ embryos show a similar pattern of TCDD-induced zfCYP1A expression as WT embryos. These results demonstrate that zfARNT2 is not essential for mediating TCDD developmental toxicity in zebrafish and suggest that alternate dimerization partner(s) exist for zfAHR2 in vivo.
Key Words: AHR2; ARNT2; TCDD toxicity; zebrafish; development.
| INTRODUCTION |
|---|
|
|
|---|
The aryl hydrocarbon receptor nuclear translocators (ARNTs) are members of the basic helix-loop-helix (bHLH) PAS family of transcription factors. The ARNT proteins function as general dimeric partners for other PAS family members such as aryl hydrocarbon receptor (AHR), HIF1-
, and EPAS-1. These heterodimers regulate gene expression in response to changing environmental and developmental conditions (Gu et al., 2000
PCDDs are lipophilic, persistent, bioaccumulative toxicants that have adversely affected feral fish populations of the most sensitive fish species to TCDD developmental toxicity, the lake trout (Cook et al., 2003
). TCDD, the most potent PCDD, causes several toxic responses in developing teleost fish including yolk sac and pericardial edema, arrested growth, craniofacial malformations, ischemia, anemia, impaired swim bladder inflation, and mortality (Belair et al., 2001
; Dong et al., 2002
; Henry et al., 1997
; Peterson et al., 1993
; Tanguay et al., 2003
; Teraoka et al., 2002
; Walker and Peterson, 1994
). The zebrafish is an excellent model for studying the effects of TCDD on developing teleost fish due to its rapid growth, short generation time, high egg yield, and transparent embryos (Andreasen et al., 2002b
; Belair et al., 2001
; Bello et al., 2004
; Dong et al., 2002
; Henry et al., 1997
; Hill et al., 2003
, 2004
). Additionally, zebrafish developmental biology has been well characterized, the zebrafish genome is near completion, and numerous molecular and genetic techniques have been developed to study zebrafish gene function.
Components of the AHR signaling pathway have been characterized in zebrafish revealing important differences from what has been found in mammals. In contrast to the single mammalian gene for ahr, two distinct genes for the ahr, zfahr1 and zfahr2, have been identified in zebrafish (Andreasen et al., 2002a
; Tanguay et al., 1999
). Conversely, multiple genes for arnt, arnt1, and arnt2, have been identified in mammals (Drutel et al., 1996
; Hirose et al., 1996
; Hoffman et al., 1991
; Li et al., 1994
) whereas only a single arnt gene with multiple splice variants, zfarnt2, has been identified in zebrafish (Hsu et al., 2001
; Tanguay et al., 2000
; Wang et al., 2000
). The presence of a single arnt gene in zebrafish is consistent with what has been found in most other fish species studied (Powell and Hahn, 2000
), although different fish species express different forms of ARNT. In killifish (Fundulus heteroclitus), like zebrafish, ARNT2 is the only form of ARNT yet detected (Powell et al., 1999
). In contrast, in rainbow trout (Oncorhynchus mykiss) and scup (Stenotomus chrysops) a different form of ARNT, likely an ortholog of ARNT1, predominates (Pollenz et al., 1996
; Powell and Hahn, 2000
). Interestingly, however, the recently sequenced Fugu rubripes genome appears to encode two forms of arnt (Rowatt et al., 2003
) suggesting that, at least in some fish species, two arnt genes do exist.
Experiments with an antisense morpholino targeted against zfAHR2 have shown that zfAHR2 is the receptor which mediates TCDD toxicity in the developing zebrafish embryo (Dong et al., 2004
; Prasch et al., 2003
; Teraoka et al., 2003
). In vitro molecular evidence demonstrates that one form of zfARNT2, zfARNT2b, can function with zfAHR2 to induce XRE-driven transcription in COS-7 cells treated with TCDD, while other spice variants cannot. The zfAHR2/ARNT2b heterodimer also specifically recognizes XREs in gel shift assays (Tanguay et al., 2000
). In addition, zfAHR2 and zfARNT2a,b,c mRNAs have been shown to be co-localized in many of the same tissues as zfCYP1A after TCDD exposure (Andreasen et al., 2002b
). These results have suggested that zfARNT2b and zfAHR2 function to mediate TCDD developmental toxicity in the zebrafish. However, this has not been proven.
The purpose of the current study was to test the hypothesis that zfARNT2b functions as the dimerization partner for zfAHR2 in the zebrafish embryo to mediate the developmental toxicity caused by TCDD. Zfarnt2 morphant embryos which have transient knockdown of the zfARNT2 protein, and a line of insertional mutant zebrafish that lack expression of zfARNT2 were examined for responses to TCDD. Surprisingly, disrupting expression of zfARNT2 did not have a significant effect on endpoints of TCDD developmental toxicity suggesting that alternate dimerization partners for zfAHR2 exist in vivo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Zebrafish lines and embryos. Wild type AB line zebrafish were used for experiments with the zfarnt2 morpholino. zfarnt2/ mutants (ARNT2 hi1715) were of the TAB-14 background strain (Tubingen/AB cross no.14). This line of fish was generated in a large-scale retroviral mutagenesis screen (Amsterdam et al., 1996
Waterborne TCDD exposure of embryos. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) of >99% purity was obtained from Chemsyn, Lenexa, KS and dissolved in DMSO. Newly fertilized eggs, approximately 34 hours post-fertilization (hpf) were exposed to vehicle (0.1% DMSO) or TCDD for 1 h in glass scintillation vials with gentle rocking. Following the 1 h static exposure, embryos were rinsed with water and maintained in vehicle/TCDD-free water for the remainder of experiments. When appropriate, fish were anesthetized with tricaine (MS222; Sigma 1.67 mg/ml).
Morpholinos. The zfarnt2 morpholino (zfarnt2-MO), obtained from Gene Tools (Philomath, OR), was designed with sequence complementary to zebrafish ARNT2 cDNA (GenBank accession #AF219988). The zfarnt2-MO (5' AGCGGCTGGTGTTGCCATATTGCCT 3') overlapped the translation start site of zfARNT2 by extending from 7 bp upstream to 15 bp downstream of the AUG start codon and therefore blocked expression of all splice forms of zfARNT2. The Gene Tools standard control morpholino (5' CTCTTACCTCAGTTACAATTTATA 3') was used as a control (control-MO). Morpholinos were diluted to 0.15 mM in 1x Danieau's solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, 5 mM HEPES, pH 7.6) as described (Nasevicius and Ekker, 2000
). Embryos were injected with approximately 10 ng of either the zfarnt2-MO or control-MO at the 12 cell stage and allowed to develop for approximately 2 h, after which damaged and unfertilized embryos were discarded. As the zfarnt2-MO was fluorescein tagged at the 3' end, injection success was assessed by fluorescence microscopy. Only zfarnt2-MO injected embryos exhibiting fluorescence at 3 hpf were used.
To assess the effect of the zfarnt2-MO on edema formation embryos were either uninjected or injected with the control-MO or zfarnt2-MO and exposed individually to either vehicle or 0.4 ng/ml TCDD according to the standard 34 hpf TCDD exposure protocol. At 72 hpf embryos were assessed for pericardial edema formation as previously described (Carney et al., in press
; Prasch et al., 2003
). The extent of pericardial edema in individual zebrafish was estimated using digital photographs in which the cross sectional area of the pericardium was determined using the area measurement function of Scion Image. All pictures were taken at 10X magnification with the embryo in a lateral orientation at the same resolution. Eight embryos were assessed for each of the six treatment groups.
Western blotting. To evaluate zfARNT2 protein expression in embryos, Western blotting was performed using the polyclonal anti-ARNT2 M-20 antibody from Santa Cruz Biotechnology (Santa Cruz, CA, cat # sc-8078). Protein levels were assessed in three treatment groups: uninjected, injected with control-MO, or injected with zfarnt2-MO. At 24 and 72 hpf 35 embryos from each treatment group were manually dechorionated, manually deyolked and pooled together. Tissue was disrupted by adding 50 µl of 1X SDS (63 mM Tris-HCl pH 6.8, 10% glycerol, 5% ß-mercaptoethanol, 3.5% sodium dodecyl sulfate) and homogenizing with a pestle. After boiling for 10 min the entire sample was resolved by SDS polyacrylamide gel electrophoresis on a 6% gel and transferred to a nitrocellulose membrane. The membrane was stained with Ponceau S to ensure even amounts of protein were loaded. Detection of the zfARNT2 protein was carried out by blocking the membrane for 1 h in TBS-T (25 mM Tris pH 7.6, 150 mM NaCl, 0.1% Tween-20) containing 5% dry milk. The membrane was washed one time in TBS-T before addition of ARNT2 M-20 antibody diluted 1:1000 in TBS-T containing 1% dry milk. After 2 h incubation the antibody was removed and the membrane washed three times in TBS-T. The membrane was then incubated with a horseradish peroxidase-conjugated secondary antibody (Amersham Pharmacia Biotech) diluted 1:10,000 in TBS-T containing 1% dry milk for 1 h. The membrane was washed three times in TBS-T before chemiluminescent detection using the ECL Western blotting analysis system (Amersham). In vitro translated zfARNT2b was produced from a pBKCMV expression construct (Tanguay et al., 2000
) using the TNT Coupled Rabbit Reticulocyte Lysate System (Promega) as described by the manufacturer.
Genotyping zfarnt2 mutants. Part of the tail was removed from each euthanized larvae and two primer sets were used for genotyping. The 1715C-5 (5' CGGAAATGTCGCTGTTGTTAGTTGTG3') and 1715C-3 (5' GAACTGAGTTTGCGCGTTTGAGAC 3') set was used to distinguish zfarnt2/ mutants from wild type (WT) and from heterozygous (HET) larvae. The 1715C-5 and SFGR (5' TGCGATGCCGTCTACTTTGA 3') set was then used to distinguish WT from HET larvae. The sequences for 1715C-5 and 1715C-3 flank the knockout viral insertion and SFGR lies within the insert. DNA was extracted in buffer (0.01 M Tris, 2 mM EDTA, 0.2% Triton-X, 0.2 mg/ml Proteinase-K) at 55°C for 2.5 h, and heated at 100°C for 10 min before centrifugation. Sequences were amplified by PCR using GoTaq polymerase (Promega) and PCR products were examined by gel electrophoresis.
Assessment of TCDD developmental toxicity. Sexually mature adult fish, heterozygous for the zfarnt2 mutation, were pair mated and the clutch of embryos was divided into five groups with ten embryos per group. One group was exposed to vehicle and the other four groups were exposed to graded concentrations of TCDD (0.2, 0.4, 0.8, or 1.6 ng TCDD/ml) according to standard TCDD exposure protocol. All of the embryos in each group were examined at 96 hpf for three hallmark endpoints of TCDD developmental toxicity: pericardial edema, reduction in peripheral blood flow, and reduction in lower jaw length.
Pericardial edema was assessed as described above. As in index of peripheral blood flow, red blood cell (RBC) perfusion rates were measured by counting the number of RBCs passing through an intersegmental vein located in the posterior quarter of the trunk during a 7.5 s period using time lapse recording (Carney et al., 2004
; Prasch et al., 2003
). To determine the extent of reduced lower jaw growth, the distance between the anterior edge of the lower jaw and the anterior edge of the eye was measured. This lower jaw to eye gap was measured from digital photographs of embryos mounted in lateral orientation. Using Scion Image a straight vertical line was first drawn along the anterior edge of the eye. A second straight horizontal line was then drawn from the anterior edge of the lower jaw to intersect the vertical line. Length of the horizontal line was the measure of lower jaw to eye gap. If the lower jaw had grown to extend in front of the eye the measure was given a negative value. If the lower jaw remained behind the eye the measure was given a positive value.
After all endpoints were measured the embryos were genotyped as described above except that the entire embryo was collected for DNA extraction. For these experiments n = 1 is defined as embryo(s) of the same genotype which came from a single breeding pair and were in the same vehicle or TCDD exposure group. When multiple embryos from the same exposure group had the same genotype, the values obtained for those embryos were averaged to obtain a single value. Embryos were obtained from six distinct adult breeding pairs to obtain a final n value of six for each dose of TCDD.
Whole mount immunolocalization of zfCYP1A. Eggs were collected from six heterozygous breeding pairs and exposed to either vehicle or 1.6 ng/ml TCDD. At 96 hpf embryos were anesthetized, fin clipped for genotyping, and fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS). Tissue-specific expression of zfCYP1A was determined using the monoclonal antibody Mab1-12-3 (Park et al., 1986
) as previously described (Andreasen et al., 2002b
; Carney et al., 2004
; Prasch et al., 2003
).
Statistics. For the dose response experiments significance was determined between the three genotypes at each dose of TCDD using a factorial ANOVA followed by the Fisher LSD test. Levene's test for homogeneity of variances was performed before the ANOVA and all data passed. For the zfarnt2-MO experiment data could not be transformed to pass Levene's test and therefore significance was determined for appropriate comparisons using a pair wise t-test assuming unequal variances. All statistical analysis was performed using the Statistica 6.0 software package. Results are presented as mean ± SE; level of significance was p
(0.05).
| RESULTS |
|---|
|
|
|---|
TCDD Toxicity in zfarnt2 Morphants
Antisense morpholinos provide a method for transiently blocking translation of a specific protein in the early zebrafish embryo. This technique was used to decrease zfARNT2 protein levels to determine the role that zfARNT2 plays in mediating the developmental toxicity caused by TCDD. Because morpholino oligos function to knock down protein expression only transiently, one of the earliest endpoints of TCDD toxicity, pericardial edema, was assessed at 72 hpf to determine if zfarnt2 morphants had any protection against TCDD toxicity (Fig. 1). To measure pericardial edema, the area of the pericardial sac was measured in each embryo, and the average pericardial area obtained in the vehicle-treated uninjected embryos was subtracted from the pericardial area obtained in the embryos of the other treatment groups. This produced a measure of the increase in pericardial area that is due to edema. TCDD-produced significant formation of pericardial edema in uninjected and control-MO TCDD-treated embryos at 72 hpf indicating the onset of TCDD toxicity. (Fig. 1A). Surprisingly, the zfarnt2 morphants treated with TCDD also showed a significant formation of pericardial edema at 72 hpf demonstrating that they had not been protected against toxicity.
|
To ensure that the zfarnt2-MO was able to decrease zfARNT2 protein expression through 72 hpf, Western blotting was performed on protein extracted from uninjected, control morphant, and zfarnt2 morphant embryos at 24 and 72 hpf using an anti-ARNT2 antibody (Fig. 1B). This antibody is directed towards the C-terminus of the zfARNT2 protein and detects both zfARNT2b and zfARNT2c, which were not resolved on this percentage gel. A single 90 kDa protein was detected in the uninjected and control morphant extracts at 24 hpf. However, the protein extract from the zfarnt2 morphants had a clear reduction in the amount of zfARNT2 protein demonstrating the effectiveness of the morpholino. Similarly, at 72 hpf a 90 kDa band was detected in the uninjected and control morphant extracts but not in the zfarnt2 morphant extracts, indicating that the morpholino was still effective at blocking translation of the zfARNT2 protein through this time. In vitro translated zfARNT2b was included on the blot and demonstrated that the antibody could specifically detect the protein.
Representative photographs showing the lack of protection by the zfarnt2-MO are also shown (Fig. 1C). The uninjected embryo shows an increase in the size of the pericardial sac after TCDD exposure when compared to the vehicle-treated embryo because edema fluid is beginning to accumulate. This increase in pericardial area is also seen in the TCDD-treated zfarnt2 morphant. The zfarnt2 morphants were observed through 120 hpf (data not shown) and continued to develop all of the overt signs of TCDD toxicity observed in WT embryos (further increase in pericardial edema, yolk sac edema, reduction in peripheral blood flow), although at later times there was likely zfARNT2 protein being expressed because the effectiveness of the morpholino was decreasing.
TCDD Toxicity in zfarnt2/ Mutants
One limitation of morpholino oligonucleotides is that they provide only a transient knockdown of protein levels. Therefore, it was possible that the zfarnt2 morphants developed endpoints of TCDD toxicity because there was still a small amount of zfARNT2 protein present that could act as a dimerization partner for zfAHR2. To determine this, a line of insertional mutants that are null for zfARNT2 was exposed to TCDD and examined for toxicity. RT-PCR performed on mutant embryos confirmed that they lack expression of three isoforms of zfARNT2 mRNA (Prasch et al., 2004
). In order to thoroughly examine the response of zfarnt2/ embryos to TCDD, a dose response study was performed in which embryos were exposed to graded doses of TCDD and examined at 96 hpf, a time when three endpoints of TCDD toxicity are clearly manifested in WT embryos: pericardial edema, reduced peripheral blood flow, and reduced growth of the lower jaw.
First, zfarnt2+/+ (WT), zfarnt2+/ (HET), and zfarnt2/ embryos were examined for the formation of pericardial edema after exposure to graded doses of TCDD (Fig. 2A). At the lowest dose (0.2 ng TCDD/ml) there was only a small increase in pericardial edema in the WT and HET embryos. As the concentration of TCDD increased, both the frequency and magnitude of the edema increased so that at the highest concentration of TCDD (1.6 ng/ml) the pericardial area in WT and HET embryos was increased to approximately twice that observed in vehicle-treated embryos. As was seen with the zfarnt2-MO, the zfarnt2/ embryos had no protection against the formation of pericardial edema and showed the same response to TCDD as the WT and HET embryos. Representative photographs illustrating similar levels of pericardial edema formation in TCDD-treated WT and zfarnt2/ embryos are shown (Fig.2B).
|
A second endpoint of TCDD toxicity examined at 96 hpf was reduction in peripheral blood flow (Fig. 3). Because this reduced flow occurs earliest in the trunk, the number of RBCs passing through an intersegmental vein (isv) in the posterior quarter of the trunk were counted to determine RBC perfusion rates as an index of blood flow. At the 0.2 ng/ml dose of TCDD, perfusion rates in the WT and HET embryos were decreased to approximately 40% of what was seen in vehicle-treated embryos. As the dose of TCDD increased, the effect on blood flow became more severe so that at the highest doses many WT and HET embryos lacked movement of blood completely. The zfarnt2/ animals showed the same reduction in peripheral RBC perfusion after TCDD treatment as WT and HET embryos with blood flow almost completely ceasing in the zfarnt2/ embryos at the highest doses of TCDD.
|
Finally, the effect of TCDD on the growth of the lower jaw was examined at 96 hpf (Fig. 4). In the lateral view of the 96 hpf vehicle-treated embryo, the lower jaw can be seen extending near to the anterior edge of the eye (Fig. 4B). The lower jaw to eye gap in vehicle-treated embryos is therefore quite small, about 10 micrometers (Fig. 4A). However, in TCDD-treated embryos the growth of the lower jaw is reduced so that the lower jaw is shorter and extends to varying distances behind the anterior edge of the eye. Because the shorter jaw is farther behind the eye, a greater jaw to eye gap is obtained upon TCDD treatment. This larger lower jaw to eye gap was quantitated as a measure of TCDD's effect on lower jaw growth (Fig. 4A).
|
In WT and HET embryos a significant increase in the lower jaw to eye gap was observed at the 0.2 ng TCDD/ml dose indicating a significant reduction in lower jaw growth. The lower jaw growth was reduced more extensively at the higher doses of TCDD, and the average lower jaw to eye gap observed at the 1.6 ng/ml dose was almost nine times greater than that observed in vehicle-treated WT embryos. As was seen with the other two endpoints of TCDD toxicity, zfarnt2/ embryos were not protected against reduced lower jaw growth caused by TCDD. The lower jaw to eye gap in zfarnt2/ embryos was significantly increased above that observed in vehicle-treated embryos at all doses of TCDD. Although at the highest dose of TCDD a significant difference was obtained between WT and zfarnt2/ embryos, clearly lower jaw growth was inhibited in embryos lacking zfARNT2. Representative photographs illustrating how the 1.6 ng/ml dose of TCDD reduces growth of the lower jaw in WT and zfarnt2/ embryos are included (Fig. 4B).
Although no obvious effects on TCDD toxicity were observed in the zfarnt2/ mutants, it remained a possibility that zfAHR2-mediated alterations in gene expression would be prevented in the zfarnt2/ mutants. To determine this, a marker of zfAHR2 pathway activation, zfCYP1A induction, was examined in whole mount embryos using the Mab1-12-3 antibody. In Figure 5 representative photographs of staining are shown for vehicle-treated WT (top panels), TCDD-treated WT (middle panels), and TCDD-treated zfarnt2/ embryos (bottom panels). Panels in column A show zfCYP1A staining in the trunk and panels in column B show staining in lateral views of the head. In WT vehicle-treated embryos little staining was observed in any of the tissues (Fig. 5, top panels). As previously reported (Andreasen et al., 2002b
) WT TCDD-treated embryos show zfCYP1A immunofluorescence in the vasculature throughout the body, including the intersegmental arteries and veins (isa, isv) in the trunk, caudal vasculature (cv), and various brain vessels (bv). Staining was also observed in the anal and urinary pores (ap,up), heart (h), the branchial arches (ba), and structures of the lower jaw (lj). TCDD exposure induced a similar pattern of zfCYP1A protein induction in zfarnt2/ embryos (Fig. 5, bottom panels). The TCDD-treated zfarnt2/ embryos showed zfCYP1A induction in the vasculature throughout the body, the anal and urinary pores, the heart, the branchial arches, and the structures of the lower jaw indicating that the zfAHR2 signaling pathway was still functional in embryos lacking zfARNT2.
|
| DISCUSSION |
|---|
|
|
|---|
In order to use the zebrafish as a model to understand how TCDD exposure in fish embryos leads to developmental toxicity, it is necessary to understand which proteins are involved in mediating responses to TCDD. Using the antisense morpholino knockdown technique, the zfAHR2 has been shown to be necessary for initiating TCDD's downstream effects (Dong et al., 2004
Several mechanisms can be proposed to explain how activation of zfAHR2 by TCDD leads to developmental toxicity in zebrafish. One hypothesis is that toxicity is dependent on XRE binding and alterations in gene expression caused by the zfAHR2-ARNT heterodimer. The results of the current study demonstrate that, although zfARNT2b can function as a dimerization partner for zfAHR2 in vitro, there must be other protein(s) present in the developing embryo which can also function as a dimerization partner for zfAHR2 to cause XRE-dependent transcriptional activation and presumably toxicity upon TCDD exposure. In mammals two distinct arnt genes, arnt1 and arnt2, have been identified and characterized (Drutel et al., 1996
; Hirose et al., 1996
; Hoffman et al., 1991
; Li et al., 1994
). Because of sequence similarity in the PAS domains, the ARNT1 and ARNT2 proteins have common dimerization partners and have been shown to have some functional redundancy. ARNT1 and ARNT2 have both been shown to dimerize with Hif1-
and function to regulate hypoxia responsive genes (Keith et al., 2001
; Maltepe et al., 2000
). Similarly, both ARNT1 and ARNT2 have been shown to dimerize with AHR to promote transactivation on XRE containing reporter constructs (Hirose et al., 1996
). Because neither the arnt1 nor arnt2 knockout mouse is viable (Hosoya et al., 2001
; Maltepe et al., 1997
) it has not been possible to thoroughly examine the role that each form of ARNT plays in mediating endpoints of TCDD exposure in mice. However, conditional disruption of ARNT1 in mice causes loss of TCDD dependent gene induction in the liver (Tomita et al., 2000
). It has also been demonstrated that TCDD's effect on lymphocyte development in the mouse is independent of ARNT2 (Laiosa et al., 2002
). This data, along with the expression patterns of ARNT1 and ARNT2 cDNA (Hirose et al., 1996
; Jain et al., 1998
) suggests that ARNT1 may be the physiological dimerization partner for AHR mediating many endpoints of TCDD toxicity in mice.
In addition to what has been found in mammals, evidence from other species also supports the idea that an additional ARNT-like protein is expressed in zebrafish. ARNT1 and ARNT2 homologs have been characterized in xenopus (Bollerot et al., 2001
; Rowatt et al., 2003
), partial ARNT1 and ARNT2 sequences have been identified in the recently sequenced Fugu rubripes genome (Rowatt et al., 2003
), and genes encoding ARNT1 have been identified in rainbow trout (Pollenz et al., 1996
) and scup (Stenotomus chrysops) (Powell and Hahn, 2000
). Therefore, it seems likely that similar to what is observed in mammals, amphibians, and other fish species, zebrafish likely express an additional ARNT or ARNT-like protein which can form a functional heterodimer with zfAHR2 to mediate alterations in gene expression upon TCDD exposure. However, if and how this altered gene expression causes toxicity is still unclear. Recently it has been shown that blocking induction of the CYP1A protein in zebrafish provides no protection against TCDD developmental toxicity suggesting that altered regulation of other, currently unknown, genes may be important (Carney et al., 2004
).
An alternate hypothesis for the mechanism of TCDD toxicity is that the effects of zfAHR2 activation are independent of XRE-binding and transcriptional activation. The mammalian AHR has been shown to interact with a variety of cellular factors such as NF-
B (Tian et al., 1999
), steroid receptors (Porterfield, 2000
; Safe et al., 1998
), and the retinoblastoma (Rb) protein (Ge and Elferink, 1998
; Puga et al., 2000
). If toxic responses to activated zfAHR2 were due to interactions with other proteins, embryos lacking zfARNT2 would be sensitive to TCDD even if alterations in gene expression through zfAHR2 were prevented. However, the pattern of zfCYP1A induction demonstrates that zfAHR2 pathway activation is intact in all tissues in the zfarnt2/ mutant embryos. Therefore, although interactions of the activated zfAHR2 with other proteins may play a role in causing TCDD developmental toxicity in zebrafish, this cannot be determined from the current study. In mice it has been demonstrated that nuclear localization of the AHR is required to generate TCDD-induced toxic responses suggesting that interactions with cytosolic proteins cannot be involved in causing at least some endpoints of toxicity in mice (Bunger et al., 2003
).
Clearly there is a gap in our present understanding of the AHR signaling pathway in fish. Although only a single form of ARNT has been identified in most fish species (Powell and Hahn, 2000
), in zebrafish there must be other ARNT proteins expressed during early development that are functional with zfAHR2. Because differences in the proteins that make up the AHR signaling pathway may be an important factor contributing to differences in species sensitivity to TCDD, future efforts will be aimed at identifying additional zebrafish ARNT proteins to obtain a more complete understanding of how AHR signaling occurs in fish. In addition, the phenotype of the zfarnt2/ mutant fish will be more closely studied to determine what other roles this protein may be playing in the developing zebrafish embryo.
| ACKNOWLEDGMENTS |
|---|
We thank Dorothy Nesbit for her excellent technical assistance, Dr. Nancy Hopkins for providing the zfarnt2/ mutant zebrafish, and Dr. John Stegeman from the Woods Hole Oceanographic Institute for the generous supply of the Mab 1-12-3 antibody. This work was supported by the University of Wisconsin Sea Grant College Program, National Oceanic and Atmospheric Administration, U.S. Department of commerce, Sea Grant Project Numbers R/BT-16 and R/BT-17 (W.H. and R.E.P.). This research was also supported by NIH grant T32 ES07015 from the National Institute of Environmental Health Sciences (NIEHS, W.H. and R.E.P.). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIEHS, NIH. Contribution number 359, Molecular and Environmental Toxicology Center, University of Wisconsin, Madison, WI 53726-4087.
| NOTES |
|---|
1 To whom correspondence should be addressed at School of Pharmacy, University of Wisconsin, 777 Highland Ave., Madison, WI 53705-2222. Fax: (608) 265-3316. E-mail: repeterson{at}pharmacy.wisc.edu.
| REFERENCES |
|---|
|
|
|---|
Amsterdam, A., Burgess, S., Golling, G., Chen, W., Sun, Z., Townsend, K., Farrington, S., Haldi, M., and Hopkins, N. (1999). A large-scale insertional mutagenesis screen in zebrafish. Genes Dev. 13, 27132724.
Amsterdam, A., Kawakami, K., Allende, M., Becker, T., Hopkins, N., and Gaiano, N. (1996). Highly efficient germ-line transmission of proviral insertions in zebrafish. Nature 383, 829832.[CrossRef][Medline]
Andreasen, E. A., Hahn, M. E., Heideman, W., Peterson, R. E., and Tanguay, R. L. (2002a). The zebrafish (Danio rerio) aryl hydrocarbon receptor type 1 is a novel vertebrate receptor. Mol. Pharmacol. 62, 234249.
Andreasen, E. A., Spitsbergen, J. M., Tanguay, R. L., Stegeman, J. J., Heideman, W., and Peterson, R. E. (2002b). Tissue-specific expression of AHR2, ARNT2, and CYP1A in zebrafish embryos and larvae: Effects of developmental stage and 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure. Toxicol. Sci. 68, 403419.
Belair, C. D., Peterson, R. E., and Heideman, W. (2001). Disruption of erythropoiesis by dioxin in the zebrafish. Dev. Dyn. 222, 581594.[CrossRef][Web of Science][Medline]
Bello, S. M., Heideman W., and Peterson R. E. (2004). 2,3,7,8-Tetrachlorodibenzo-p-dioxin inhibits regression of the common cardinal vein in developing zebrafish. Toxicol. Sci. 78, 258266.
Bollerot, K., Angelier, N., and Coumailleau, P. (2001). Molecular cloning and embryonic expression of the Xenopus Arnt gene. Mech. Dev. 108, 227231.[CrossRef][Web of Science][Medline]
Bunger, M. K., Moran, S. M., Glover, E., Thomae, T. L., Lahvis, G. P., Lin, B. C., and Bradfield, C. A. (2003). Resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity and abnormal liver development in mice carrying a mutation in the nuclear localization sequence of the aryl hydrocarbon receptor. J. Biol. Chem. 278, 1776717774.
Carney, S. A., Peterson, R. E., and Heideman, W. (2004). TCDD activation of the AHR/ARNT pathway causes developmental toxicity through CYP1A-independent mechanism in zebrafish. Mol. Pharmacol. (in press)
Carver, L. A., and Bradfield, C. A. (1997). Ligand-dependent interaction of the aryl hydrocarbon receptor with a novel immunophilin homolog in vivo. J. Biol. Chem. 272, 1145211456.
Cook, P. M., Robbins, J. A., Endicott, D. D., Lodge, K. B., Guiney, P. D., Walker, M. K., Zabel, E. W., and Peterson, R. E. (2003). Effects of aryl hydrocarbon receptor-mediated early life stage toxicity on lake trout populations in Lake Ontario during the 20th century. Environ. Sci. Technol. 37, 38643877.[Medline]
Dong, W., Teraoka, H., Tsujimoto, Y., Stegeman, J. J., and Hiraga, T. (2004). Role of aryl hydrocarbon receptor in mesencephalic circulation failure and apoptosis in zebrafish embryos exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol. Sci. 77, 10916.
Dong, W., Teraoka, H., Yamazaki, K., Tsukiyama, S., Imani, S., Imagawa, T., Stegeman, J. J., Peterson, R. E., and Hiraga, T. (2002). 2,3,7,8-Tetrachlorodibenzo-p-dioxin toxicity in the zebrafish embryo: Local circulation failure in the dorsal midbrain is associated with increased apoptosis. Toxicol. Sci. 69, 191201.
Drutel, G., Kathmann, M., Heron, A., Schwartz, J. C., and Arrang, J. M. (1996). Cloning and selective expression in brain and kidney of ARNT2 homologous to the Ah receptor nuclear translocator (ARNT). Biochem. Biophys. Res. Commun. 225, 333339.[CrossRef][Web of Science][Medline]
Ge, N. L., and Elferink, C. J. (1998). A direct interaction between the aryl hydrocarbon receptor and retinoblastoma protein. Linking dioxin signaling to the cell cycle. J. Biol. Chem. 273, 2270822713.
Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado, E., Chen, W., Burgess, S., Haldi, M., Artzt, K., Farrington, S., Lin, S. Y., Nissen, R. M., and Hopkins, N. (2002). Insertional mutagenesis in zebrafish rapidly identifies genes essential for early vertebrate development. Nat. Genet. 31, 135140.[CrossRef][Web of Science][Medline]
Gu, Y. Z., Hogenesch, J. B., and Bradfield, C. A. (2000). The PAS superfamily: Sensors of environmental and developmental signals. Annu. Rev. Pharmacol. Toxicol. 40, 519561.[CrossRef][Web of Science][Medline]
Henry, T. R., Spitsbergen, J. M., Hornung, M. W., Abnet, C. C., and Peterson, R. E. (1997). Early life stage toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in zebrafish (Danio rerio). Toxicol. Appl. Pharmacol. 142, 5668.[CrossRef][Web of Science][Medline]
Hill, A., Howard, V., Strahle, U., Cossins, A. (2003). Neurodevelopmental defects in zebrafish (Danio rerio) at environmentally relevant dioxin (TCDD) concentrations. Toxicol. Sci. 76, 392399.
Hill, A. J., Bello, S. M., Prasch, A. L., Peterson, R. E., and Heideman, W. (2004). Water permeability and TCDD-induced edema in zebrafish early-life stages. Toxicol. Sci. 78, 7887.
Hirose, K., Morita, M., Ema, M., Mimura, J., Hamada, H., Fujii, H., Saijo, Y., Gotoh, O., Sogawa, K., and Fujii-Kuriyama, Y. (1996). cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt). Mol. Cell. Biol. 16, 17061713.[Abstract]
Hoffman, E. C., Reyes, H., Chu, F. F., Sander, F., Conley, L. H., Brooks, B. A., and Hankinson, O. (1991). Cloning of a factor required for activity of the Ah (dioxin) receptor. Science 252, 954958.
Hosoya, T., Oda, Y., Takahashi, S., Morita, M., Kawauchi, S., Ema, M., Yamamoto, M., and Fujii-Kuriyama, Y. (2001). Defective development of secretory neurones in the hypothalamus of Arnt2-knockout mice. Genes Cells 6, 361374.[Abstract]
Hsu, H. J., Wang, W. D., and Hu, C. H. (2001). Ectopic expression of negative arnt2 factor disrupts fish development. Biochem. Biophys. Res. Commun. 282, 487492.[CrossRef][Web of Science][Medline]
Jain, S., Maltepe, E., Lu, M. M., Simon, C., and Bradfield, C. A. (1998). Expression of ARNT, ARNT2, HIF1 alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse. Mech. Dev. 73, 117123.[CrossRef][Web of Science][Medline]
Keith, B., Adelman, D. M., and Simon, M. C. (2001). Targeted mutation of the murine aryl hydrocarbon receptor nuclear translocator 2 (Arnt2) gene reveals partial redundancy with Arnt. Proc. Natl. Acad. Sci. U.S.A. 98, 66926697.
Laiosa, M. D., Lai, Z. W., Thurmond, T. S., Fiore, N. C., DeRossi, C., Holdener, B. C., Gasiewicz, T. A., and Silverstone, A. E. (2002). 2,3,7,8-Tetrachlorodibenzo-p-dioxin causes alterations in lymphocyte development and thymic atrophy in hemopoietic chimeras generated from mice deficient in ARNT2. Toxicol. Sci. 69, 117124.
Li, H., Dong, L., and Whitlock, J. P., Jr. (1994). Transcriptional activation function of the mouse Ah receptor nuclear translocator. J. Biol. Chem. 269, 2809828105.
Ma, Q., and Whitlock, J. P., Jr. (1997). A novel cytoplasmic protein that interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. J. Biol. Chem. 272, 88788884.
Maltepe, E., Keith, B., Arsham, A. M., Brorson, J. R., and Simon, M. C. (2000). The role of ARNT2 in tumor angiogenesis and the neural response to hypoxia. Biochem. Biophys. Res. Commun. 273, 231238.[CrossRef][Web of Science][Medline]
Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A., and Simon, M. C. (1997). Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature 386, 403407.[CrossRef][Medline]
Meyer, B. K., Pray-Grant, M. G., Vanden Heuvel, J. P., and Perdew, G. H. (1998). Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl hydrocarbon receptor core complex and exhibits transcriptional enhancer activity. Mol. Cell. Biol. 18, 978988.
Nasevicius, A., and Ekker, S. C. (2000). Effective targeted gene knockdown in zebrafish. Nat. Genet. 26, 216220.[CrossRef][Web of Science][Medline]
Park, S. S., Miller, H., Klotz, A. V., Kloepper-Sams, P. J., Stegeman, J. J., and Gelboin, H. V. (1986). Monoclonal antibodies to liver microsomal cytochrome P-450E of the marine fish Stenotomus chrysops (scup): Cross reactivity with 3-methylcholanthrene induced rat cytochrome P-450. Arch. Biochem. Biophys. 249, 339350.[CrossRef][Web of Science][Medline]
Perdew, G. H. (1988). Association of the Ah receptor with the 90-kDa heat shock protein. J. Biol. Chem. 263, 1380213805.
Peterson, R. E., Theobald, H. M., and Kimmel, G. L. (1993). Developmental and reproductive toxicity of dioxins and related compounds: cross-species comparisons. Crit. Rev. Toxicol. 23, 283335.[Web of Science][Medline]
Pollenz, R. S., Sullivan, H. R., Holmes, J., Necela, B., and Peterson, R. E. (1996). Isolation and expression of cDNAs from rainbow trout (Oncorhynchus mykiss) that encode two novel basic helix-loop-Helix/PER-ARNT-SIM (bHLH/PAS) proteins with distinct functions in the presence of the aryl hydrocarbon receptor. Evidence for alternative mRNA splicing and dominant negative activity in the bHLH/PAS family. J. Biol. Chem. 271, 3088630896.
Porterfield, S. P. (2000). Thyroidal dysfunction and environmental chemicalspotential impact on brain development. Environ. Health Perspect. 108(Suppl. 3), 433438.
Powell, W. H., and Hahn, M. E. (2000). The evolution of aryl hydrocarbon signaling proteins: Diversity of ARNT isoforms among fish species. Mar. Environ. Res. 50, 3944.[CrossRef][Web of Science][Medline]
Powell, W. H., Karchner, S. I., Bright, R., and Hahn, M. E. (1999). Functional diversity of vertebrate ARNT proteins: identification of ARNT2 as the predominant form of ARNT in the marine teleost, Fundulus heteroclitus. Arch. Biochem. Biophys. 361, 156163.[CrossRef][Web of Science][Medline]
Prasch, A. L., Andreasen, E. A., Peterson, R. E., and Heideman, W. (2004). Interactions between 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and hypoxia signaling pathways in zebrafish: Hypoxia decreases responses to TCDD in zebrafish embryos. Toxicol. Sci. 78, 6877.
Prasch, A. L., Teraoka, H., Carney, S. A., Dong, W., Hiraga, W., Stegeman, J. J., Heideman, W., and Peterson, R. E. (2003). Aryl hydrocarbon receptor 2 mediates 2,3,7,8-tetrachlorodibenzo-p-dioxin developmental toxicity in zebrafish. Toxicol. Sci. 76, 138150.
Puga, A., Barnes, S. J., Dalton, T. P., Chang, C., Knudsen, E. S., and Maier, M. A. (2000). Aromatic hydrocarbon receptor interaction with the retinoblastoma protein potentiates repression of E2F-dependent transcription and cell cycle arrest. J. Biol. Chem. 275, 29432950.
Rowatt, A. J., Depowell, J. J., and Powell, W. H. (2003). ARNT gene multiplicity in amphibians: characterization of ARNT2 from the frog Xenopus laevis. J. Exp. Zoolog. Part B Mol. Dev. Evol. 300, 4857.[Medline]
Safe, S., Wang, F., Porter, W., Duan, R., and McDougal, A. (1998). Ah receptor agonists as endocrine disruptors: Antiestrogenic activity and mechanisms. Toxicol. Lett. 102103, 343347.
Schmidt, J. V., and Bradfield, C. A. (1996). Ah receptor signaling pathways. Annu. Rev. Cell Dev. Biol. 12, 5589.[CrossRef][Web of Science][Medline]
Tanguay, R. L., Abnet, C. C., Heideman, W., and Peterson, R. E. (1999). Cloning and characterization of the zebrafish (Danio rerio) aryl hydrocarbon receptor. Biochim. Biophys. Acta 1444, 3548.[Medline]
Tanguay, R. L., Andreasen, E., Heideman, W., and Peterson, R. E. (2000). Identification and expression of alternatively spliced aryl hydrocarbon nuclear translocator 2 (ARNT2) cDNAs from zebrafish with distinct functions. Biochim. Biophys. Acta 1494, 117128.[Medline]
Tanguay, R. L., Andreasen, E. A., Walker, M. K., and Peterson R. E. (2003). Dioxin toxicity and aryl hydrocarbon receptor signaling in fish. In Dioxins and Health, 2nd ed. (A. Schecter and T. A. Gasiewicz, Eds.), chap. 15, pp. 603628. John Wiley & Sons, New York.
Teraoka, H., Dong, W., Ogawa, S., Tsukiyama, S., Okuhara, Y., Niiyama, M., Ueno, N., Peterson, R. E., and Hiraga, T. (2002). 2,3,7,8-Tetrachlorodibenzo-p-dioxin toxicity in the zebrafish embryo: Altered regional blood flow and impaired lower jaw development. Toxicol. Sci. 65, 192199.
Teraoka, H., Dong, W., Tsujimoto, Y., Iwasa, H., Endoh, D., Ueno, N., Stegeman, J. J., Peterson, R. E., and Hiraga, T. (2003). Induction of cytochrome P450 1A is required for circulation failure and edema by 2,3,7,8-tetrachlorodibenzo-p-dioxin in zebrafish. Biochem. Biophys. Res. Commun. 304, 223228.[CrossRef][Web of Science][Medline]
Tian, Y., Ke, S., Denison, M. S., Rabson, A. B., and Gallo, M. A. (1999). Ah receptor and NF-kappa B interactions, a potential mechanism for dioxin toxicity. J. Biol. Chem. 274, 510515.
Tomita, S., Sinal, C. J., Yim, S. H., and Gonzalez, F. J. (2000). Conditional disruption of the aryl hydrocarbon receptor nuclear translocator (Arnt) gene leads to loss of target gene induction by the aryl hydrocarbon receptor and hypoxia-inducible factor 1 alpha. Mol. Endocrinol. 14, 16741681.
Walker, M. K., and Peterson, R. E. (1994). Aquatic toxicity of dioxins and related chemicals. In Dioxins and Health (A. Schecter Ed.), pp. 347387. Plenum Press, New York.
Wang, W. D., Wu, J. C., Hsu, H. J., Kon, Z. L., and Hu, C. H. (2000). Overexpression of a zebrafish ARNT2-like factor represses CYP1A transcription in ZLE cells. Marine Biotech. 2, 376386.
Westerfield, M. (1995). The Zebrafish Book. University of Oregon Press, Eugene, OR.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. J. Jenny, S. I. Karchner, D. G. Franks, B. R. Woodin, J. J. Stegeman, and M. E. Hahn Distinct Roles of Two Zebrafish AHR Repressors (AHRRa and AHRRb) in Embryonic Development and Regulating the Response to 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicol. Sci., August 1, 2009; 110(2): 426 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Xiong, R. E. Peterson, and W. Heideman Aryl Hydrocarbon Receptor-Mediated Down-Regulation of Sox9b Causes Jaw Malformation in Zebrafish Embryos Mol. Pharmacol., December 1, 2008; 74(6): 1544 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Dougherty and R. S. Pollenz Analysis of Ah Receptor-ARNT and Ah Receptor-ARNT2 Complexes In Vitro and in Cell Culture Toxicol. Sci., May 1, 2008; 103(1): 191 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Evans, S. I. Karchner, L. L. Allan, R. S. Pollenz, R. L. Tanguay, M. J. Jenny, D. H. Sherr, and M. E. Hahn Repression of Aryl Hydrocarbon Receptor (AHR) Signaling by AHR Repressor: Role of DNA Binding and Competition for AHR Nuclear Translocator Mol. Pharmacol., February 1, 2008; 73(2): 387 - 398. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Cheshenko, F. Brion, Y. Le Page, N. Hinfray, F. Pakdel, O. Kah, H. Segner, and R. I.L. Eggen Expression of Zebra Fish Aromatase cyp19a and cyp19b Genes in Response to the Ligands of Estrogen Receptor and Aryl Hydrocarbon Receptor Toxicol. Sci., April 1, 2007; 96(2): 255 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Andreasen, L. K. Mathew, C. V. Lohr, R. Hasson, and R. L. Tanguay Aryl Hydrocarbon Receptor Activation Impairs Extracellular Matrix Remodeling during Zebra Fish fin Regeneration Toxicol. Sci., January 1, 2007; 95(1): 215 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sekine, J. Mimura, M. Yamamoto, and Y. Fujii-Kuriyama Unique and Overlapping Transcriptional Roles of Arylhydrocarbon Receptor Nuclear Translocator (Arnt) and Arnt2 in Xenobiotic and Hypoxic Responses J. Biol. Chem., December 8, 2006; 281(49): 37507 - 37516. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Antkiewicz, R. E. Peterson, and W. Heideman Blocking Expression of AHR2 and ARNT1 in Zebrafish Larvae Protects Against Cardiac Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicol. Sci., November 1, 2006; 94(1): 175 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Andreasen, L. K. Mathew, and R. L. Tanguay Regenerative Growth Is Impacted by TCDD: Gene Expression Analysis Reveals Extracellular Matrix Modulation Toxicol. Sci., July 1, 2006; 92(1): 254 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Prasch, R. L. Tanguay, V. Mehta, W. Heideman, and R. E. Peterson Identification of Zebrafish ARNT1 Homologs: 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicity in the Developing Zebrafish Requires ARNT1 Mol. Pharmacol., March 1, 2006; 69(3): 776 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Mathew, E. A. Andreasen, and R. L. Tanguay Aryl Hydrocarbon Receptor Activation Inhibits Regenerative Growth Mol. Pharmacol., January 1, 2006; 69(1): 257 - 265. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







