ToxSci Advance Access originally published online on September 16, 2004
Toxicological Sciences 2004 82(2):562-569; doi:10.1093/toxsci/kfh279
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences vol. 82 no. 2 © Society of Toxicology 2004; all rights reserved.
c-fos mRNA Expression in Rat Cortical Neurons During Glutamate-Mediated Excitotoxicity

* Bayer HealthCare, Pharma Research Centre, Aprather Weg, 42096 Wuppertal, Germany; and
Department of Biochemistry, Trinity College, Dublin 2, Ireland
Received July 8, 2004; accepted September 3, 2004
| ABSTRACT |
|---|
|
|
|---|
We have previously reported that exposure of mouse cerebellar granule cells (mCGCs) to excitotoxic concentrations of glutamate (Glu) induced a delayed, elevated, and sustained expression of c-fos mRNA, which was N-methyl-D-aspartic acid (NMDA) receptor mediated. In this study, the overstimulation of Glu receptors in primary rat cortical neurons by excitotoxins was used to study the cellular events triggering excitotoxic neuronal cell death, as the rat is the preferred species in regulatory and nonregulatory toxicological investigations. Exposure of rat cortical neurons to excitotoxins at high, toxic concentrations showed a change in the c-fos mRNA expression profile from a transient expression to one of sustained elevated levels. The excitotoxins induced much higher levels of c-fos mRNA in rat cortical neurons than in the mouse CGC system. Glu-induced c-fos mRNA expression, under excitotoxic conditions, was inhibited by D-2-amino-5-phosphonopentanoate (AP5) but not 6-cyano-7-nitro-quinoxaline-2,3-dione (CNQX), indicating an event mediated by the NMDA subtype of Glu receptors. Using 12 compounds, which covered a range of nontoxic, toxic, and excitotoxic effects on rat cortical neurons, excitotoxicity was paralleled by a sustained, elevated c-fos mRNA expression. Furthermore, on account of the high expression levels of c-fos mRNA under excitotoxic conditions, it is suggested that an unambiguous elevation in c-fos mRNA expression at a single time point of 60 min can be used to predict the excitotoxic properties of a range of functionally different chemical compounds. In view of the high levels of expression of c-fos mRNA, the rat cortical cell system may also be used as a more sensitive model than mCGCs for investigations into early markers of excitotoxicity.
Key Words: excitotoxicity; c-fos; RT-PCR; IEGs; rat cortical neurons.
| INTRODUCTION |
|---|
|
|
|---|
The stimulation of neurons by neurotransmitters or neurotropic factors elicits changes in gene expression that are critical for neuronal survival, differentiation, and the adaptive responses of mature neuronal cell types (Greenberg et al., 1986
The prototypic IEG, c-fos, has been reported to be both rapidly and transiently transcribed in response to a variety of neurotransmitters that trigger Ca2+ influx in in vitro cell culture systems (Bading et al., 1993
; Curran and Morgan, 1995
; Greenberg et al., 1986
). The c-fos gene encodes the transcription factor c-Fos, which forms a heterodimer with members of the Jun family of transcription factors via a leucine zipper, forming the transcription factor complex AP-1. The function of the AP-1 complex is to activate the transcription of a variety of target genes in response to stimulation of cell surface receptors that are connected to several different signal transduction pathways (Angel and Karin, 1991
). These downstream target genes mediate a variety of responses including differentiation and neuronal transduction. Thus, rather than being a specialized executor of a unique response to exogenous stimuli, the AP-1 complex plays a general role in the transduction of signals from the membrane to the nucleus. For example, Jun and Fos transcription factors exert a potent biological role by their control of gene transcription of nerve growth factors (Hengerer et al., 1990
). Reports suggest that overexpression of the proto-oncogene c-fos may contribute to neuronal cell death in vivo (Pennypacker et al., 1994
; Shan et al., 1997
) and in vitro (Gorman et al., 1995
; Griffiths et al., 1997
; Meredith et al., 1996
). This led to the suggestion that overexpression of c-fos mRNA could be used as an indicator of excitotoxicity in in vitro neuronal cell systems. Griffiths et al. (1997
, 2000)
proposed that the measurement of c-fos mRNA expression levels could be used as a specific indicator of excitotoxicity. Using the method of real-time, reverse transcription polymerase chain reaction (RT-PCR) we reported a delayed, elevated, and sustained expression of c-fos mRNA under excitotoxic conditions in mouse cerebellar granule cells (mCGCs), which was N-methyl-D-aspartic acid (NMDA)-receptor mediated, and which was successfully used to predict the excitotoxic properties of a range of compounds (Rogers et al., in press).
The first aim of this study was to investigate, using rat cortical neurons, the involvement of IEGs in excitotoxicity, in particular whether c-fos mRNA is induced by different excitatory amino acids (EAAs) in primary cultures of rat cortical neurons. The second aim was to investigate the excitotoxicity-related changes, concentration-dependencies, and receptor specificities of c-fos mRNA induction in rat cortical neurons. The third aim was to investigate the potential of c-fos mRNA in the characterization of excitotoxic effects of a number of compounds to see whether c-fos mRNA can be used as a specific biomarker of excitotoxicity for screening purposes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Materials. Rats (Wistar strain, E18) were obtained from Charles River (Sulzfeld, Germany). All cell culture plasticware was purchased from Biocoat Becton and Dickinson (Heidelberg, Germany). L-glutamic acid (Glu), L-aspartic acid (Asp), L-cysteine sulphinic acid (L-CSA), L-alanine (Ala), L-homocysteic acid (L-HCA), D-homocysteic acid (D-HCA), S-sulpho-L-cysteic acid (L-SSC), N-methyl-D-aspartic acid (NMDA), glycine, gamma-amino-butyric acid (GABA), paraquat, 1-methyl-4-phenylpyridinium iodide (MPP+ iodide), ß-mercaptoethanol, and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) were obtained from Sigma. D-2-amino-5-phosphonopentanoate (AP5) and 6-cyano-7-nitro-quinoxaline-2,3-dione (CNQX) were purchased from Biotrend Tocris (Cologne, Germany). The RNeasy® 96 kit and the RNase-Free DNase kit were purchased from Qiagen (Hilden, Germany). The RNA 6000 Labchip® Kit was purchased from Agilent Technologies GmbH (Berlin, Germany). The ATP LiteTM-M kit was purchased from Packard Bioscience B.V. (Groningen, The Netherlands). The RibogreenTMRNA Quantitation kit was obtained from Molecular Probes (Eugene, OR). The SuperscriptTM First-Strand synthesis system for RT-PCR, NeurobasalTM culture medium, B27, and penicillin-streptomycin (5000 U/ml) were purchased from Invitrogen Life Technologies (Karlsruhe, Germany). PCR primers were synthesized by Invitrogen Life Technologies (Karlsruhe, Germany). The SYBR® Green PCR and RT-PCR kit was purchased from Applied Biosystems (Weiterstadt, Germany).
Preparation of primary cultures of rat cortical neurons. Primary cultures of rat cortical neurons were prepared as described previously (Schmuck et al., 2000
). Pregnant Wistar rats were sacrificed on gestational day 1819 by asphyxiation, the fetuses immediately removed from the uterus and placed in a petri dish on ice. Under sterile conditions, the fetuses were separated from their enveloping embryonic sacs and decapitated. Whilst the head was stabilized with one pincer, another pincer was used to remove the outer layers of protective cartilage surrounding the brain matter. The cortex was dissected from the whole brain tissue under a stereomicroscope (Leica MIO) with a sterile pincer and subsequently unsheathed from the cerebral membrane. The tissues were pooled in sterile NeurobasalTM medium (Invitrogen Life Technologies, Karlsruhe, Germany), supplemented with B27 (2%) and penicillin-streptomycin (50 U/ml). The isolation of single cells from the collective cortical tissues was performed by consecutive filtration of the neuronal cells through two nylon meshes of different pore diameters (135 and 25 µm, respectively). The filtrate, consisting of a single-cell suspension of cortical neurons, was centrifuged for 5 min at 1000 rpm (200 x g). The cell pellet was suspended in the culture medium (10 ml) and the cell number determined using a Casy® 1 Model TTC Cell Counter and Analyser System (Schärfe System GmbH, Reutlingen, Germany). The cells were plated onto 24-well plates (precoated with poly-D-lysine) at a cell concentration of 1 x 106 cells per well and a final volume of 1.5 ml. The cells were cultivated for 10 to 13 days before testing. The cultures consisted of 9095% neurons and 510% glial cells. These data were determined by immunohistochemistry (Schmuck and Schlüter, 1996
) using neuronal-specific-enolase (NSE) and glial-fibrillary-acidic-protein (GFAP) antibodies.
Treatment of cell cultures. Experiments were undertaken on rat cortical neurons at 10 and 13 days in vitro (DIV). For pharmacological investigations, the neurons were preincubated with a fixed concentration of D-2-amino-5-phosphonopentanoate (AP5, 500 µM) or 6-cyano-7-nitro-quinoxaline-2,3-dione (CNQX, 10 µM) for 15 min before exposure to the test compounds. All test compounds were dissolved appropriately and adjusted to pH 7.4 before addition to the culture medium. For experiments involving cell viability, the cells were exposed to various concentrations of the test compounds for 4 or 24 h. For experiments involving RT-PCR analysis, cell treatment over a period of 6 h was terminated by aspiration of the medium and addition of lysis buffer (RLT-Buffer; Qiagen, Hilden, Germany) containing 1% ß-mercaptoethanol, and samples were stored at 80°C until isolation of total RNA.
Assessment of cytotoxicity using the MTT assay. Cytotoxicity was assessed by a spectrophotometric method (Balázs et al., 1988
), which measures the viability of cells on the basis of their ability to bioreduce 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT).
MTT solution (100 µl; final concentration 0.5 mg/ml in PBS) was added to each well, and the plate was incubated in the dark for 2 h at 37°C in a humidified atmosphere. Following incubation, the total solution of medium and MTT was carefully removed by aspiration. HCl (500 µl; 0.04 M) in anhydrous isopropanol was added to each well, followed by 100 µl SDS (3% w/v). The plate was shaken for 15 min, to ensure solubilization of the blue/purple formazan crystals, and then allowed to stand at room temperature for 15 min. Absorbance was measured at 570 nm, using 630 nm as the reference wavelength, in a spectrophotometer (Tecan Ultra). Results were expressed as the percentage of blue formazan absorbance compared with untreated control neurons, which were assumed as having 100% viability.
ATP determination. The intracellular ATP concentration was determined according to a chemiluminescence reaction in a luciferin/luciferase system using an ATP Lite-M kit, according to manufacturer's instructions (Packard Bioscience BV, Groningen, The Netherlands).
RNA isolation. Total RNA was isolated from primary rat cortical neurons with the use of an RNeasy 96 Kit (Qiagen, Hilden, Germany), including a DNase digestion step, according to the manufacturer's instructions. The concentration of eluted total RNA was quantitated using the fluorescent nucleic acid stain, Ribogreen, according to manufacturer's instructions. The integrity of the RNA was quality controlled by capillary electrophoresis using an RNA 6000 Nano Chip Kit on the Agilent 2100 Bio-analyser system (Agilent Technologies GmbH, Berlin, Germany). Only samples with a peak area ratio >2.0 of 28S to 18S rRNA were used.
Real-time reverse transcription polymerase chain reaction (real-time RT-PCR). RNA was reverse transcribed into cDNA, following manufacturer's instructions, using the Superscript First-Strand Synthesis for RT-PCR kit, (Invitrogen Life Technologies, Karlsruhe, Germany) and a mixture of oligo-dT primers and random hexamers as primers.
Real-time RT-PCR was performed using an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Weiterstadt, Germany) using template cDNA corresponding to 5 ng/µl of RNA and SYBR® Green PCR Core Reagents (Applied Biosystems), as recommended by the manufacturer. Each measurement was carried out in triplicate and repeated.
Primers were designed for c-fos and the housekeeping gene, 18S, with Primer 3 software (Rozen and Skaletsky, 2000
), available at http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi, following general guidelines for optimal primer design (Applied Biosystems User Bulletin #2, www.docs.appliedbiosystems.com/pebiodocs/04303859.pdf). All chosen primers were checked for specificity by BLAST searches. The primers sequences for c-fos and 18S were based on Genbank sequences X06769 and X00686, respectively. Primer sequences were as follows, c-fos: Left CCGACTCCTTCTCCAGCAT, Right TCACCGTGGGGATAAAGTTG and 18S: Left CCCAGTAAGTGCGGGTCATA, Right GGCCTCACTAAACCATCCAA. Specificity of the PCR amplification for each primer pair was analyzed on an agarose gel and confirmed to give single amplicons of the correct size (93 and 96 base pairs, respectively). In addition, primers were only used when they produced a single amplicon as revealed by dissociation curve analysis after PCR.
| RESULTS |
|---|
|
|
|---|
Excitotoxin-Mediated NMDA Receptor-Specific Toxicity to Rat Cortical Neurons
Exposure of rat cortical neurons to glutamate (Glu) for 4 and 24 h induced a concentration-dependent decrease in cell viability, as judged by MTT assays (Fig. 1a, Table 1). Pretreatment of the neurons with the NMDA receptor antagonist, AP5, completely protected against cytotoxicity, while pretreatment of the neurons with CNQX offered no protection (Fig. 1b). With aspartate (Asp), a similar pattern of NMDA receptor-mediated cytotoxicity occurred (data not shown). In addition, decreases in intracellular ATP levels were observed following exposure of the neurons to various concentrations of Glu and Asp for 24 h (Table 1).
|
|
Paraquat caused a concentration-dependent decrease in cell viability and ATP concentration (Table 1), which is in accordance with previous reports (Schmuck et al., 2000
Time- and Concentration-Dependent, Glutamate-Induced c-fos mRNA Expression
Exposure of cultured rat cortical neurons (13 DIV) to various concentrations of Glu induced different time profiles of c-fos mRNA expression (Fig. 2a). At low nontoxic concentrations (2.5 µM), a transient expression profile was observed with an increase in c-fos mRNA expression levels over control of approximately 6-fold. At higher concentrations of Glu, this transient profile of c-fos mRNA expression changed to a sustained expression profile, with a large increase (100-fold) in c-fos mRNA levels. At intermediate concentrations of Glu, although the c-fos mRNA levels were high, these levels returned to lower background levels over the 360-min time course.
|
A similar change in expression profile was found for c-fos mRNA expression following Asp treatment with levels reaching approximately 125 times the control level under excitotoxic conditions (Fig. 2b). It was observed that the nontoxic profiles for Glu and Asp induction of c-fos mRNA showed one difference in that the time for maximal expression levels were 45 and 120 min for Glu and Asp, respectively.
NMDA Receptor Specificity of Glutamate-Induced c-fos mRNA Expression
The NMDA receptor antagonist, AP5, but not the non-NMDA receptor antagonist, CNQX, prevented the delayed, elevated, and sustained expression of c-fos mRNA induced by toxic concentrations of Glu (100 µM, Fig. 3a) and Asp (100 µM, Fig. 4a) showing this toxicity-specific expression profile to be NMDA receptor mediated.
|
|
At lower nontoxic concentrations of Glu (25 µM, Fig. 3b) and Asp (35 µM, Fig. 4b) the transient profiles of c-fos mRNA expression were strongly inhibited by AP5, but not by CNQX, as previously reported for the physiological action of Glu agonists (Griffiths et al., 1997
Effects of a Wide Range of Compounds on c-fos mRNA Expression
In order to study further whether sustained, elevated c-fos mRNA expression is predictive for excitotoxicity, rat cortical neurons were treated with high (toxic) and low (nontoxic) concentrations of 12 different compounds.
The compounds were chosen to represent four categories of compounds. The first group (1) the excitotoxins were composed of the following seven compounds: Glu, Asp, S-sulpho-L-cysteate (L-SSC), N-methyl-D-aspartate (NMDA), L-homocysteate (L-HCA), D-homocysteate (D-HCA), and L-cysteine sulphinate (L-CSA); (2) the second group contained a neurotoxic but nonexcitotoxic compound, 1-methyl-4-phenylpyridinium iodide (MPP+ iodide); (3) the third group contained the neuroactive but nontoxic compounds alanine (Ala), gamma-amino-butyric acid (GABA), and glycine; and (4) the fourth group contained paraquat, a compound classified as being toxic to other target cells.
The toxicity of each of the compounds was assessed by MTT cytotoxicity experiments, over a range of concentrations of the compound, and EC50 values were determined (Table 2). For compounds showing toxicity, high and low concentrations were chosen, with low being equivalent to one-tenth the EC50 value and high being equivalent to 10 times the EC50 value, where the EC50 value was the concentration found to reduce cell viability by 50% in MTT assays. For compounds showing no toxicity, the low concentration was chosen as 1/100 the highest soluble concentration.
|
Assessment of the Potential of c-fos mRNA Expression as a Screen for Excitotoxicity in Rat Cortical Neurons
All of the Group 1 compounds, the excitotoxins, but none of the compounds belonging to Groups 2 to 4, induced very high expression of c-fos mRNA with the high concentrations (Table 2). In some cases, for example, L-HCA, D-HCA, and L-SSC, a weak induction of c-fos mRNA was also observed with the low concentrations. The highest levels of induction reached in the case of Groups 2 to 4 were for GABA (7.6-fold) and Paraquat (5.2-fold), but these were low in relation to the levels reached by the Group 1 compounds (50- to 80-fold).
The effect of a cocktail of AP5 (NMDA receptor antagonist) and CNQX (non-NMDA receptor antagonist) antagonists was also tested. With all Group 1 compounds, the highest levels of expression were reduced, but with varied effects. The antagonism was less effective for those compounds (D-HCA and L-SSC) which induced some induction of c-fos mRNA at the low concentrations. Presumably this less effective antagonism was due to the high effective competition from the agonist.
| DISCUSSION |
|---|
|
|
|---|
We have previously established that sustained, elevated c-fos mRNA expression occurs in mouse cerebellar granule cells (mCGCs) in culture when cells are exposed to excitotoxins (Rogers et al., in press) and that this early gene expression correlates with excitotoxic cell death. This correlation allowed us and others (Gorman et al., 1995
Further to this model system, we considered to transfer the model to neuronal cells of the rat, primarily for two reasons. First, the rat is the rodent species of choice in regulatory and nonregulatory toxicological and pharmacological investigations. Second, the culture of mCGCs requires serum in the medium, which, because of batch variability and endogenous glutamate, leads to difficulties in intra- and inter-laboratory standardization.
The first aim of this study was to investigate whether rat cells, like the murine cells, exhibit sustained, elevated c-fos mRNA expression after excitatory amino acid (EAA) treatment. Indeed, both Glu and Asp showed toxicity to rat cortical neurons in a time- and concentration-dependent manner, as in the mCGC system (Rogers et al., in press). This toxicity developed with the maturation of the cells in culture, reaching an optimum at 13 DIV, as previously shown by Schubert and Piasecki (2001)
for Glu. It appeared that the rat cortical neurons were less susceptible to EAA-induced cellular toxicity than mCGCs.
However, when c-fos mRNA expression after Glu and/or Asp treatment was measured using RT-PCR, the expression profiles changed from the normal, physiological transient expression of c-fos mRNA to an overexpression which was characterized by being sustained over several hours. This sustained, elevated expression of c-fos mRNA in the rat is similar to that found previously by Griffiths et al. (1997
, 1998
, 2000
) and Rogers et al. (in press) for mCGCs, except that in the rat the levels of induction are considerably higher (100-fold) than in the mouse (5- to 10-fold).
The toxicity induced by Glu and Asp in the rat and the related c-fos mRNA expression was shown to be NMDA receptor mediated, since it was blocked by the NMDA receptor antagonist, AP5, but not by the non-NMDA receptor antagonist CNQX. This result is consistent with our results for mCGCs (Rogers et al., in press).
The study was extended to show the effects on c-fos mRNA expression of 12 compounds representing nontoxic, toxic, and excitotoxic compounds.
Excitotoxin treatment led to a switch from a transient c-fos mRNA expression to an elevated expression for all seven excitotoxins, with 50- to 80-fold increases in expression at 60 min, which was chosen as an early time point for subsequent screening type experiments.
Nontoxic compounds, or compounds showing toxicity but not excitotoxicity, did not induce the very high levels of expression of c-fos mRNA shown by the excitotoxins. For these compounds, the highest levels of expression did not reach a value greater than 7.7-fold (for glycine), and so it appeared that discrimination could be made between excitotoxins and other compounds based on this difference in expression.
The experiment on the receptor pharmacology of the c-fos mRNA overexpression showed that in all cases the overexpression could be blocked or reduced by an antagonist cocktail. The antagonism appeared variable, however, but this can be explained by the choice of concentrations of "agonist" used. In the cases where the low concentration of compound induced increased levels of c-fos mRNA expression, there was less antagonism by the cocktail, presumably due to the greater level of competition between agonist and antagonist.
Overall, it has been shown that c-fos mRNA overexpression with fold inductions greater than 10-fold correlates with a compound being excitotoxic. The contingency table (Table 3) shows that c-fos mRNA overexpression in rat cortical neurons in culture can be used as a screen for predicting the excitotoxic potential of unknown compounds. The proportion of observations in the different categories which define the contingency table (Table 2) is significantly different than is expected from random occurrence (p = 0.0013, Fisher's exact test).
|
The use of Glu receptor antagonism as a second criterion should, however, be used with caution, particularly in the case of novel or previously untested compounds. Compounds with unknown potency as Glu receptor agonists may lead to the use of excessive concentrations in this assay, concentrations which may be too high for complete antagonism of the c-fos mRNA induction induced by an excitotoxin. Therefore, we suggest to use a simple tiered approach (see below).
The applications of this novel screen, based on c-fos mRNA expression, include the ability to potentially investigate newly synthesized excitotoxins and EAA receptor antagonists, in the search for new pharmaceuticals to treat neurodegenerative disorders in which Glu receptor overactivation is implicated. In a future screen for excitotoxicity, based on c-fos early response gene measurements in rat cortical neurons, a single concentration, single time point should be used initially to screen for positive compounds. The initial screen should then be followed by an investigation into the concentration dependencies and pharmacology of the positive compounds, in order to obtain a proper definition of the toxicities of the various compounds.
These studies lead us to question the role of this overexpression of c-fos mRNA. The mode of cell death following injury induced by excitotoxins remains controversial, with evidence to suggest that cell death occurs by one of two general pathways: necrosis (Dessi et al., 1993
; Didier et al., 1996
; Gasull et al. 2000
) or apoptosis (Filipkowski et al., 1994
; Pollard et al., 1994
; Portera-Cailliau et al., 1995
). The shut-off of c-fos mRNA transcription requires new protein synthesis; a typical feature of apoptosis, which requires that energy must be expended by the neurons. Therefore, it can be speculated that the transient expression of c-fos mRNA under nonexcitotoxic conditions could act as an initial event in the apoptotic suicide program.
Cheung et al. (1998)
reported that at concentrations of Glu <20 µM neuronal cell death was exclusively by apoptosis and was not accompanied by acute rapid swelling of neurons. However, necrosis began to occur in the presence of apoptosis at intermediate concentrations of Glu, and was eventually the sole death process at the higher insult (>50 µM). Thus, the change in c-fos mRNA induction, from a transient expression to that of a more delayed, elevated, and sustained expression may indicate a more important role for the c-Fos protein in mediating necrotic cell death under excitotoxic conditions (Griffiths et al., 1997
, 1998
, 2000
; Malcolm et al., 1997
).
The elevated and sustained nature of the excitotoxic c-fos mRNA response may reflect the dimerization of the c-fos product, Fos, with other members of the Jun family of IEG products, thereby leading to a concomitant accumulation of AP-1 binding proteins which (a) maintain the continued expression of c-fos mRNA and (b) activate the expression of late response target genes whose products are then thought to serve more specific effector functions in the excitotoxic neuronal response. It can also be speculated that the overexpression of c-fos mRNA may have a protective role, as the cells' mRNA levels are still high, and also the cells have sufficient concentrations of intracellular ATP to maintain the integral homeostasis and mitochondrial function.
Lidwell and Griffiths (2000)
recently reported the FosB/JunD AP-1 transcription factor complex as being selectively expressed in mature cultures of mCGCs undergoing Glu-mediated excitotoxicity, while c-Fos and c-Jun were detected under both excitotoxic and nonexcitotoxic conditions. Further work is therefore required to investigate the amount of c-Fos protein produced and its dimerization partners in rat cortical neurons undergoing excitotoxicity.
| ACKNOWLEDGMENTS |
|---|
We would like to thank Wibke Lofink for excellent technical assistance and Udo Krella and Wolfgang Hain for insightful discussions. A.R. had a grant from Bayer Healthcare to perform the research described in the paper.
| NOTES |
|---|
2 Current address: Nestlé Research Center Lausanne, Vers-chez-les-Blanc, 1000 Lausanne 26, Switzerland.
1 To whom correspondence should be addressed at Department of Biochemistry, Trinity College, Dublin 2, Ireland. Fax: + 353-16772400. E-mail: Annamarie.Rogers{at}gmx.de.
| REFERENCES |
|---|
|
|
|---|
Angel, P., and Karin, M. (1991). The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim. Biophys. Acta 1072, 129157.[Medline]
Bading, H., Ginty, D. D., and Greenberg, M. E. (1993). Regulation of gene expression in hippocampal neurons by distinct calcium signaling pathways. Science 260, 181186.
Balázs, R., Jorgensen, O. S., and Hack, N. (1988). N-methyl-D-aspartate promotes the survival of cerebellar cells in culture. Neuroscience 27(2), 437451.[CrossRef][Web of Science][Medline]
Cheung, N. S., Pascoe, C. J., Giardina, S. F., John, C. A., and Beart, P. M. (1998). Micromolar L-glutamate induces extensive apoptosis in an apoptotic-necrotic continuum of insult-dependent, excitotoxic injury in cultured cortical neurones. Neuropharmacol. 37, 14191429.[CrossRef][Web of Science][Medline]
Curran, T., and Morgan, J. I. (1995). Fos: An immediate-early transcription factor in neurons. J. Neurobiol. 26, 403412.[CrossRef][Web of Science][Medline]
Dessi, F., Charriaut-Marlangue, C., Khrestchatisky, M., and Ben-Ari, Y. (1993). Glutamate induced neuronal death is not a programmed cell death in cerebellar culture. J. Neurochem. 60, 19531955.[Web of Science][Medline]
Didier, M., Bursztajn, S., Adamec, E., Passani, L., Nixon, R. A., Coyle, J. T., Wei, J. Y., and Berman, S. A. (1996). DNA strand breaks induced by sustained glutamate excitotoxicity in primary neuronal cultures. J. Neurosci. 16, 22382250.
Filipkowski, R. K., Hetman, M., Kaminska, B., and Kaczmarek, L., (1994). DNA fragmentation in rat brain after intraperitoneal administration of Kainate. Neuroreport 5, 15381540.[Web of Science][Medline]
Gasull, T., DeGregorio-Rocasolano, N., Zapata, A., and Trullas, R. (2000). Choline release and inhibition of phosphatidylcholine synthesis precede excitotoxic neuronal death but not neurotoxicity induced by serum deprivation. J. Biol. Chem. 275, 1835018357.
Gorman, A. M., Scott, M. P., Rumbsy, P. C., Meredith, C., and Griffiths, R. (1995). Excitatory amino-acid induced cytotoxicity in primary cultures of mouse cerebellar granule cells correlates with elevated, sustained c-fos proto-oncogene expression. Neurosci. Lett. 191, 116120.[CrossRef][Web of Science][Medline]
Greenberg, M. E., Ziff, E. B., and Greene, L. A. (1986). Stimulation of neuronal acetylcholine receptors induces rapid gene transcription. Science 234, 8083.
Griffiths, R., Malcolm, C., Ritchie, L., Frandsen, A., Schousboe, A., Scott, M., Rumbsy, P., and Meredith, C. (1997). Association of c-fos mRNA expression and excitotoxicity in primary cultures of mouse neocortical and cerebellar neurons. J. Neurosci. Res. 48, 533542.[CrossRef][Web of Science][Medline]
Griffiths, R., Ritchie, L., Lidwell, K., Grieve, A., Malcolm, C. S., Scott, M., and Meredith, C. (1998). Calcium influx via L-type voltage-gated channels mediates the delayed, elevated increases in steady-state c-fos mRNA levels in cerebellar granule cells exposed to excitotoxic levels of glutamate. J. Neurosci. Res. 52, 641652.[CrossRef][Web of Science][Medline]
Griffiths, R., Grieve, A., Scollon J., Scott, M., Williams, C., and Meredith, C. (2000). Preliminary evaluation of an in vitro test for assessment of excitotoxicity by measurement of early gene (c-fos mRNA) levels. Toxicol. In Vitro 14, 447458.[CrossRef][Web of Science][Medline]
Hengerer, B., Lindholm, D., Heumann, R., Ruther, U., Wagner, E. F., and Thoenen, H. (1990). Lesion-induced increase in nerve growth factor mRNA is mediated by c-fos. Proc. Natl. Acad. Sci. U.S.A. 87, 38993903.
Lidwell, K., and Griffiths, R. (2000). Possible role for the FosB/JunD AP-1 transcription factor complex in glutamate-mediated excitotoxicity in cultured cerebellar granule cells. J. Neurosci. Res. 62, 427439.[CrossRef][Web of Science][Medline]
Malcolm, C., Griffiths, R., Rumbsy, P., and Meredith, C. (1997). Differential profiles of c-fos expression within primary cultures of mouse cerebellar granule cells stimulated with the excitatory amino acid L-glutamate: Correlation with excitotoxic outcome and derivation of a predictive index. Toxicol. in Vitro 11, 505507.
Meredith, C., Scott, M., Rumbsy, P., Frandsen, A., Schousboe, A., Gorman, A., and Griffiths, R. (1996). Sustained c-fos expression is associated with excitotoxicity during the development of neuronal cells in vitro. Biochem. Soc. Trans. 24, 6S.[Medline]
Morgan, J. I., and Curran, T. (1986). Role of ion flux in the control of c-fos expression. Nature 322, 552555.[CrossRef][Medline]
Pennypacker, K. R., Thai, L., Hong, J.-S., and Mc Millian, M. K. (1994). Prolonged expression of AP-1 transcription factors in the rat hippocampus after systemic kainate treatment. J. Neurosci. 14, 39984006.[Abstract]
Pollard, H., Charriaut-Marlangue, C., Cantagrel, S., Represa, A., Robain, O., Moreau, J., and Ben-Ari, Y. (1994). Kainate-induced apoptotic cell death in hippocampal neurons. Neuroscience 63, 718.[CrossRef][Web of Science][Medline]
Portera-Cailliau, C., Hedreen, J. C., Price, D. L., and Koliatsos, V. E. (1995). Evidence for apoptotic cell death in Huntington's disease and excitotoxic animal models. J. Neurosci. 15, 37753787.[Abstract]
Rogers, A., Schmuck, G., Scholz, G., Griffiths, R., Meredith, C., Schousboe, A., Campiani, G., and Williams, D. C. (2004). Improvements in an in vitro assay for excitotoxicity by measurement of early gene (c-fos mRNA) levels. Arch. Toxicol. (in press).
Rozen, S., and Skaletsky, H. (2000). Primer 3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365386.[Medline]
Primer 3. program available at: http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
Schmuck, G., and Schlüter, G. (1996). An in vitro model for toxicological investigations of environmental neurotoxins in primary neuronal cell cultures. Toxicol. Ind. Health 12, 683696.[Web of Science][Medline]
Schmuck, G., Ahr, H. J., and Schlüter, G. (2000). Rat cortical neuron cultures: An in vitro model for differentiating mechanisms of chemically induced neurotoxicity. In Vitro Mol. Toxicol. 13, 3749.[Web of Science][Medline]
Shan, Y., Carlock, L. R., and Walker, P. D. (1997). NMDA receptor overstimulation triggers a prolonged wave of immediate early gene expression: Relationship to excitotoxicity. Exp. Neurol. 144, 406415.[CrossRef][Web of Science][Medline]
Schubert, D., and Piasecki, D. (2001). Oxidative glutamate toxicity can be a component of the excitotoxicity cascade. J. Neurosci. 21(19), 74557462.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. M. Giles, J. Chen, L. Li, and L.-S. Chin Dystonia-associated mutations cause premature degradation of torsinA protein and cell-type-specific mislocalization to the nuclear envelope Hum. Mol. Genet., September 1, 2008; 17(17): 2712 - 2722. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Lee, T. C. Wheeler, L. Li, and L.-S. Chin Ubiquitination of {alpha}-synuclein by Siah-1 promotes {alpha}-synuclein aggregation and apoptotic cell death Hum. Mol. Genet., March 15, 2008; 17(6): 906 - 917. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

) or 24 h () to various concentrations of Glu (added directly to the incubation medium) prior to assessment of cell viability by the MTT assay. The absorbance at 570 nm, with 630 nm as a reference wavelength, was expressed as a percentage of control (untreated) cells. (b) For pharmacology, cells were preincubated for 15 min with either AP5 (500 µM, (
)), CNQX (10 µM, (
)), or no antagonists () prior to co-exposure for 24 h with a range of concentrations of glutamate. Data represent mean ± SD values of triplicate MTT reactions derived from three separate experiments (n = 3).
), 25 µM (), 100 µM (
) or 250 µM (
)), or no antagonists (
