Skip Navigation


ToxSci Advance Access originally published online on November 10, 2004
Toxicological Sciences 2005 83(2):340-348; doi:10.1093/toxsci/kfi031
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
83/2/340    most recent
kfi031v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Williamson, M. A.
Right arrow Articles by Opanashuk, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williamson, M. A.
Right arrow Articles by Opanashuk, L. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Toxicological Sciences vol. 83 no. 2 © Society of Toxicology 2005; all rights reserved.

Aryl Hydrocarbon Receptor Expression and Activity in Cerebellar Granule Neuroblasts: Implications for Development and Dioxin Neurotoxicity

Mary A. Williamson, Thomas A. Gasiewicz and Lisa A. Opanashuk1

Department of Environmental Medicine, University of Rochester School of Medicine and Dentistry; Rochester, New York 14642

Received August 13, 2004; accepted November 3, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is a potent teratogen that produces neurobehavioral abnormalities associated with both cognitive and locomotor systems, yet the precise regional and cellular targets of developmental neurotoxicity remain largely unknown. Most, if not all, TCDD-induced pathology is mediated via binding to the aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that belongs to the basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) superfamily. Upon ligand binding, AhR translocates to the nucleus, dimerizes with the AhR nuclear translocator protein (Arnt), and regulates transcription by interaction with dioxin-response elements (DREs) in target genes, most notably specific cytochrome P450 (CYP) family members. To assess whether developing cerebellar granule neuroblasts are potential direct targets for TCDD toxicity, AhR expression and transcriptional activity were examined. AhR and Arnt proteins were present in mouse cerebellum from birth throughout postnatal development. AhR protein levels peaked between postnatal day (PND) 3–10, a critical period for granule neuroblast growth and maturation. Transcriptionally active AhR was detected in immature cerebellar granule cells in a transgenic dioxin-responsive lacZ mouse model after acute TCDD exposure. AhR and Arnt were also expressed in cerebellar granule neuroblast cultures. AhR localized to the nucleus in granule cells 15 min after TCDD treatment. TCCD elicited time-dependent and concentration-dependent increases in CYP1A1 and 1B1 mRNA and protein levels. Moreover, TCDD treatment reduced both thymidine incorporation and granule neuroblast survival in a concentration-dependent manner. These data suggest that (1) granule neuroblasts are direct targets for developmental AhR-mediated TCDD neurotoxicity and (2) TCDD exposure may disrupt granule cell neurogenesis.

Key Words: neurogenesis; bHLH/PAS; Arnt; CYP 1A1/1B1; dioxin.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is a widely distributed, persistent, and exceptionally toxic environmental contaminant that belongs to a class of chemicals known as the polyhalogenated aromatic hydrocarbons (PAH) (Safe, 1990Go). Because TCDD is associated with teratogenic effects in the nervous, immune, and reproductive systems (Birnbaum and Tuomisto, 2000Go), exposure to this extremely potent toxicant raises important public health concerns. While the precise anatomical regions and cell types targeted by TCDD during brain development are largely undefined, both human and animal studies report functional abnormalities consistent with improper cerebellar maturation. Epidemiological studies have suggested that children accidentally exposed to PCB/dioxin mixtures exhibited delayed motor development, higher incidences of hypotonia, and increased activity levels (Neuberger et al., 1999Go; Rogan and Gladen, 1992Go). Furthermore, perinatal TCDD exposure was associated with delayed development of the righting reflex and impaired rotorod performance in rats (Thiel et al., 1994Go), behaviors that normally depend on proper cerebellar development and function (Ferguson, 1996Go). However, molecular mechanisms that mediate developmental TCDD neurotoxicity are unresolved.

Most, if not all TCDD-induced pathology is mediated via binding to the aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that is a member of the basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) superfamily (Gu et al., 2000Go). The AhR resides in the cytosol bound to 90 kD heat shock protein (hsp90) and several other chaperone proteins (Gu et al., 2000Go). Upon ligand binding, hsp90 dissociates from AhR and the receptor translocates to the nucleus. After dimerizing with the aryl hydrocarbon receptor translocator protein (Arnt), also a member of the bHLH/PAS family, the complex binds dioxin-response elements (DREs), located in the 5' region upstream of responsive target genes (Gu et al., 2000Go), most notably a group of proteins termed the "AhR gene battery" (Nebert et al., 2000Go). The mechanisms involved in AhR-mediated transcription have been elucidated primarily by the investigation of cytochrome P450 (CYP) gene regulation (Whitlock 1999Go). Exposure to TCDD induces CYP1A1 and 1B1 gene transcription coordinately with dose-dependent and time-dependent increases in protein levels (Filbrandt et al., 2004Go; Hakkola et al., 1997Go; Whitlock, 1999Go). TCDD, through interaction with the AhR, is also known to regulate the expression of a wide array of additional drug-metabolizing enzymes, genes that participate in cell cycle regulation, and inflammatory mediators (Lai et al., 1996Go; Nebert et al., 2000Go; Puga and Elferink, 2002Go). Despite the understanding of the molecular mechanisms by which TCDD modulates gene regulation, specific roles for AhR during brain development and in neurotoxicity are poorly understood.

Evidence at the cellular and molecular levels supports the contention that inappropriate AhR activation by xenobiotics during development could lead to neurotoxicity in the cerebellum. For example, prenatal exposure to 7,12-dimethylbenz[a]anthracene, an Ah-R ligand and a known carcinogen, was shown to profoundly disrupt cerebellar cytoarchitecture (Kellen et al., 1976Go). At the molecular level, a recent study revealed that the cerebellum contained the highest levels of DRE binding in the adult rat brain and that indigo, a putative endogenous AhR ligand, stimulated DRE binding in cerebellar granule neurons (Kuramoto et al., 2003Go). Furthermore, gestational TCDD exposure was shown to modulate the developmental expression profile of Sp1, a transcription factor involved in growth and differentiation, in rat cerebellum and cerebral cortices (Nayyar et al., 2002Go), but the biological significance requires clarification. Although the developing cerebellum is potentially vulnerable to AhR-mediated neurotoxicity, the precise cellular localization and transcriptional activity of AhR in this brain region requires additional study.

Considering that AhR is present during critical phases of histogenesis in several organs (Abbott et al., 1995Go; Abbott and Probst, 1995Go) and is widely expressed throughout the adult central nervous system (CNS) (Petersen et al., 2000Go), it is conceivable that AhR might normally regulate neurogenesis and differentiation during brain development. It is hypothesized that perinatal exposure to TCDD disrupts endogenous AhR signaling events during brain development. This study determined that AhR is expressed and transcriptionally active in cerebellar granule neuroblasts throughout a critical period of postnatal neurogenesis. Several processes, which include proliferation, migration, differentiation, synaptogenesis, and programmed cell death (apoptosis), occur during this time (Altman and Bayer, 1997Go; Goldowitz and Hamre, 1998Go; White and Barone, 2001Go). Furthermore, TCDD was shown to reduce DNA synthesis and cell survival in a granule precursor cell model system that maintains the ability to proliferate in vitro. These observations suggest potential roles for AhR in cerebellar granule neuron maturation and raise the possibility that TCDD might interfere with these actions by displacing an endogenous ligand from its normal developmental functions.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents. 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) was obtained from Cambridge Isotopes (Cambridge, MA) and solubilized in dimethyl sulfoxide (DMSO). Triton X-100, Bovine Serum Albumin (BSA), and DMSO were purchased from Sigma (St. Louis, MO). Dulbecco's phosphate buffered saline (DPBS), minimal essential medium (MEM), B27, and N2 supplements were purchased from Gibco (Grand Island, NY). Supplies for RNA isolation and DNA synthesis were obtained from Invitrogen (Carlsbad, CA). Trypsin and DNAse were purchased from Worthington (Lakewood, NJ).

Experimental animals. All animals were maintained on a 12-h light/dark cycle with food and water provided ad libitum and kept in accordance with the guidelines set by the University of Rochester University Committee on Animal Resources and the American Association for Laboratory Animal Science. Five- to six-day-old C57Bl/6 J mice were purchased from Jackson Laboratories (Bar Harbor, ME). AhR –/– mice modified at exon 2 (Schmidt et al., 1996Go) were also obtained from Jackson Laboratories and backcrossed onto the wild-type C57Bl/6 J background for at least 10 generations. C57Bl/6 J mice were purchased from Jackson Laboratory, and DRE-lacZ animals were generated as previously described (Willey et al., 1998Go). Animals were generated using the p21lac plasmid construct, which consists of 2 DRE-Ds, a TATA box, lacZ reporter, and the SV40 intron and polyadenylation signal. Mice were maintained as a heterozygous colony backcrossed onto wild-type C57Bl/6 J background for greater than 10 generations. Polymerase chain reaction (PCR) analysis of tail DNA was performed to determine transgene status of animals.

In vivo TCDD treatment. DRE-lacZ mice were injected with 30µg TCDD/kg dissolved in olive oil or vehicle alone when AhR protein is at peak levels on postnatal day 10 in the developing cerebellum. This dose has been previously shown to produce maximal induction of aryl hydrocarbon hydroxylase activity in C57Bl/6 J mice (Poland and Glover, 1975Go). Animals were perfused 18–24 h later with saline, followed by 4% paraformaldehyde. This time period after TCDD exposure was previously reported to be sufficient for detection of ß-galactosidase activity in tissue sections obtained from transgenic animals (Nazarenko et al., 2001Go).

ß-galactosidase staining. In situ localization of ß-galactosidase (ß-gal) activity was determined on a histochemical substrate, 5-bromo-4-chloro-3-indoyl-ß-D-galactoside (X-gal). After perfusion, whole brains were fixed in 4% paraformaldehyde overnight. Brains were transferred to 30% sucrose for 24 h. Cerebella were cut into 30-µm sagittal sections with a freezing sliding microtome. Sections were incubated with X-gal for 16 h at 37°C in a humidified chamber and then rinsed with DPBS before mounting. Wild-type animals were injected with olive oil to evaluate endogenous ß-galactosidase activity.

Cell culture. Primary granule cell cultures were prepared as previously described (Gao et al., 1991Go; Opanashuk and Hauser, 1998Go; Opanashuk et al., 2001Go). Briefly, cerebella were quickly dissected from postnatal day 5–6 C57/Bl6 mice and the meninges were removed prior to the addition of trypsin and DNAse. Dissociated cells were then passed through a 30-µm nylon mesh (Spectrum Laboratories) and centrifuged through a 35%:60% Percoll gradient (Amersham Biosciences, Piscataway, NJ). Cells were then rinsed and preplated for 90 min in poly-D-lysine (0.1 mg/ml; Sigma, St. Louis, MO) coated flasks. Cells were then resuspended in MEM containing 10% horse serum, 5% fetal bovine serum, glucose (9 mg/ml), glutamine (292 mg/ml), and penicillin (0.1%). Cells were plated in 96-well plates at a density of 3 x 105 cells/well and maintained in a humidified atmosphere of 5% CO2/95% air at 37°C to facilitate reaggregate formation. After 24 h, reaggregates were then transferred to serum-free MEM (SFM) containing B27 and N2 supplements, glucose (9 mg/ml), glutamine (292 mg/ml), and penicillin (0.1%), and plated on high molecular weight poly-D-lysine–coated plates (0.1 mg/ml). This time point is designated day in vitro 1 (DIV 1).The characterization of these cultures, as previously described (Gao et al., 1991Go) by morphological and immunocytochemical criteria, indicated that >98% of these cells were of the granule neuron lineage.

Western blot analysis. Cerebellar tissue or cells were homogenized in phosphate buffered saline (PBS) containing 0.1% Triton X-100 and antiprotease cocktail (Roche Molecular Biochemical, Manheim, Germany). Total protein concentrations were determined by the microBCA assay (Pierce, Rockford, IL). Proteins (20–75 µg) were fractionated on 7% acrylamide gels and transferred to Immun-Blot PVDF membranes (BioRad, Hercules, CA). Membranes were blocked with 5% powdered milk containing 0.2% Tween-20 and probed with antibodies specific for AhR (1:5000; Biomol, Plymouth Meeting, PA), ARNT (1:2000; Novus, Littleton, CO), CYP1A1 (1:2000; Xenotech LLC, Kansas City, KS), or CYP1B1 (1:5,000; a generous gift from Dr. Colin Jefcoate, University of Wisconsin, Madison, WI), overnight at 4°C. Membranes were then probed with the appropriate horseradish peroxidase conjugated secondary antibodies (1:5000; Jackson Immunoresearch, Westgrove, PA) for 2 h at room temperature. Proteins were visualized by chemiluminescence (ECL Amersham Biosciences, Piscataway, NJ). All immunoblots were stripped and reprobed with anti-ß-actin (1:5000; Sigma, St Louis, MO) to confirm equal protein loading. Because the expression of actin and several other housekeeping proteins are developmentally regulated in the brain, the membranes were stained with Ponceau S to verify even transfer of proteins in individual samples during postnatal cerebellar development. AhR, Arnt, or CYP proteins were not detected on blots that were incubated with either secondary antibodies alone or with nonspecific IgG.

Real-time PCR. RNA was isolated using TRIZOL reagent following instructions provided by the manufacturer (Invitrogen). RNA was quantified by spectroscopy then concentrated with 5 M ammonium acetate and ethanol precipitation. Samples were resuspended in DEPC (0.1% diethylpyrocarbonate)-treated water. First strand cDNA was synthesized from 4 µg RNA using the SuperScript II First Strand cDNA Synthesis Kit (Invitrogen). Prior to real-time PCR analysis, samples were phenol/chloroform extracted and ethanol precipitated. Real-time quantitative PCR was accomplished with Taqman PCR primers and Universal MasterMix (PE Applied Biosystems, Foster City, CA) according to the TaqMan EZ RT-PCR (reverse-transcriptase-polymerase chain reaction) User Bulletin #2 Protocol (PerkinElmer). Intron spanning primers with the following sequences were designed using Primer Express Software to reduce genomic amplification. AhR: (F) CGGCTTCTTGCAAAACACAGT (R) GTAA ATGCTCTCGTCCTTCTTCATC (Probe) FAM-AGTCCAATGCACGCTT; CYP1A1: (F) GACCTTCCGGCATTCATCCT (R) TCAGACTTGTATCTCTTGTGGTGCT (Probe) FAM-CGTCCCCTTCACCATCCCCCA-BHQ-1; CYP1B1: (F) TGGCTGCTC ATCCTCTTCACC (R) CCCACAACCTGGTCCAACTC (Probe) FAM-TTCAGGCCCG CGTG-BHQ-1; ß-Actin: (F) GCTTCTTTGCAGCTCCTTCGT (R) CCAGCGCAGCGA TATCG (Probe) HEX-CGCCACCAGTTCGCCATGGA-BHQ-1. Amplified products were fluorometrically detected by the BioRad iCycler analyzer. Plasmid DNA containing CYP1A1, CYP1B1, or ß-actin was used to generate standard curves. All standards and samples were run in duplicate. CYP1A1 and CYP1B1 levels were normalized to relative ß-actin levels. Data are expressed as fold induction compared to vehicle control (DMSO), which was arbitrarily set at one.

Immunocytochemistry. After a 24-h reaggregation period, granule neurons were plated into 8-well culture chamber slides (Lab-Tek, VWR, Bridgeport, NJ) coated with 0.1 mg/ml poly-D-lysine. After 24 h, cells were treated with DMSO or 10 nM TCDD for 15–60 min. After the incubation period, the medium was removed and cells were rinsed with DPBS then fixed with 4% paraformaldehyde for 30 min at room temperature. After rinsing, neurons were incubated in PBS containing 10% BSA and 0.3% Triton X-100 (PBST) for 30 min at room temperature. Reaggregates were then incubated overnight at 4°C in PBST containing AhR antibody (1:800; Biomol, Plymouth Meeting, PA). After rinsing, cells were incubated in PBST containing Alexa Fluor 546 goat anti-rabbit secondary antibody (1:1000; Molecular Probes, Eugene, OR) for 90 min at room temperature. Cellular nuclei were subsequently stained with 1 µg/ml 4',6-diamidino-2-phenylindole (DAPI). Slides were cover-slipped with anti-fade (Molecular Probes, Eugene, OR) as mounting media. Fluorescence was visualized using Nikon Eclipse TS100 inverted microscope. Images were taken at 40x magnification with SPOT Advanced software. AhR was not detected in granule neurons isolated from AhR knockout animals or in cultures treated with secondary antibody alone.

Thymidine incorporation. Thymidine incorporation into DNA was measured by procedures similar to those previously described (Gao et al., 1991Go; Opanashuk and Hauser, 1998Go; Opanashuk et al., 2001Go). After reaggregation for 24 h, EGL cells were transferred to SFM. TCDD was added to cultures for 36 h and cells were labeled with 2 µCi/ml 3H-thymidine for the last 12 h of the treatment period. Reaggregates were subsequently harvested onto filter paper with TCA washes and repeated water elution with a Skatron cell harvester, as previously described (Gao et al., 1991Go; Opanashuk and Hauser, 1998Go; Opanashuk et al., 2001Go). After the filters dried, thymidine labeling was measured by liquid scintillation counting. At least four independent determinations from separate cell preparations were evaluated for each treatment.

Cell survival assay. Neuron viability was assessed with a commercially available kit (Live/Dead Cytotoxicity Kit, Molecular Probes, Eugene, OR), as previously described (Opanashuk and Hauser, 1998Go; Opanashuk et al., 2001Go). EGL reaggregates were transferred to SFM and plated onto poly-L-lysine–coated glass coverslips at the same densities used for the thymidine incorporation. After 24 h in SFM, EGL cells were treated with TCDD for 24 h. Cultures were then rinsed three times with DPBS (Gibco BRL) and incubated for 40 min at 34°–35°C in DPBS containing ethidium homodimer and calcein-AM. Ethidium binds to DNA in dead neurons and emits red fluorescence, while calcein-AM is converted by esterases within living cells and emits a green fluorescence. The proportion of surviving neurons was determined as a percentage of the number of live + dead neurons. About 800 neurons were counted in each culture using a Nikon Eclipse T100 fluorescent microscope (40x) with the experimenter blinded to the conditions. At least four cultures were evaluated for each experimental treatment and each culture consisted of cells pooled from separate litters.

Statistical analyses. Data were expressed as mean ± standard error of the mean (SEM). All experiments were completed at least four times. Data were analyzed by analysis of variance (ANOVA) with Statview (version 5.0). The Fisher's post hoc test was used for individual comparisons


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
AhR and ARNT Proteins Are Expressed in the Cerebellum During a Critical Period of Granule Neuron Development
To determine whether the developing cerebellum is a potential target for AhR-mediated gene expression or TCDD toxicity, cerebellar homogenates were analyzed for AhR and Arnt protein content between day of birth (PND 0) and adulthood by Western blot analysis. Both AhR and Arnt proteins were expressed throughout postnatal development and in adult cerebellum (Fig. 1). AhR protein levels peaked during PND 3–10, a critical period of granule neuron development (Altman and Bayer, 1997Go; Goldowitz and Hamre, 1998Go). Arnt protein was detected on PND 3 and expression was maintained at similar levels from PND 3 throughout adulthood. Arnt, but not AhR, was detected in the cerebellum of AhR –/– animals (data not shown). These findings suggest that the developing cerebellum is a potential target for AhR-mediated TCDD neurotoxicity.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 1. AhR and ARNT proteins are expressed during mouse postnatal cerebellar development. Mouse cerebellar homogenates (50 µg) were examined for AhR and ARNT protein expression between day of birth (PND 0) and adulthood by immunoblot analyses. Hepa1c1c7 (Hepa) protein lysate (5 µg) served as a positive control. Similar results were obtained in cerebellar lysates prepared from 4–5 separate litters.

 
Transcriptionally Active AhR is Localized to Developing Granule Neurons in TCDD-Responsive lacZ Reporter Mice
The transgenic lacZ-DRE mouse model provides a unique system to determine the temporal and spatial expression of transcriptionally active AhR following agonist exposure in vivo (Willey et al., 1998Go). To identify cell types in which AhR is activated to a transcriptionally functional form in the cerebellum during a critical period of granule neuron development, transgenic LacZ-DRE mice were injected with oil or 30 µg/kg TCDD on PD 10 and analyzed for activity 18 h later. This TCDD dosing regimen was chosen to ensure maximal responsiveness of AhR transcriptional activity (Poland and Glover, 1975Go). Following TCDD exposure, ß-gal activity was detected within pre-migratory granule neuron precursors in the external granule cell layer (EGL) and in molecular layer (ML) of the cerebellum (Fig. 2B, D). Less intense staining was also detected within the internal granule cell layer (IGL). Staining was not observed in the Purkinje cell layer. In addition, ß-gal staining was present in deep cerebellar nuclei and in perivascular cells located throughout the cerebellum. Endogenous ß-gal activity was not detected within the vehicle control treated lacZ-DRE (Fig. 2 A, C) or wild-type (data not shown) mouse cerebellum. As previously reported (Willey et al., 1998Go), endogenous ß-gal activity was detected in the choroid plexus of vehicle control lacZ-DRE (Fig. 2A) and wild-type animals (data not shown). Together, these data indicate that AhR is present and can become transcriptionally active in cerebellar granule neurons after agonist binding.



View larger version (123K):
[in this window]
[in a new window]
 
FIG. 2. AhR is transcriptionally active in developing mouse cerebellar granule neuroblasts. Photomicrographs taken at low-power magnification (10x: A, B) and high-power magnification (40x: C, D) depicting sagittal cerebellar sections from vehicle-treated (A, C) or TCDD-treated (B, D) DRE-LacZ transgenic mice. Blue staining indicates ß-gal activity. Endogenous background ß-gal staining was present only in the choroid plexus (A; arrow) and was not detected within the cerebellum (A, C). Transcriptionally active AhR, as indicated by ß-gal staining, was detected in EGL neuroblasts and migrating granule cells in the ML (D; arrows). Similar staining patterns were observed in mice from three separate litters.

 
AhR and ARNT Proteins Are Expressed by Cerebellar Granule Neuroblasts In Vitro
Although developing granule neurons contained transcriptionally active AhR and Arnt in vivo, it is not known whether expression of these molecules is retained in cultured granule neuroblasts. Primary granule neuroblast reaggregate cultures were analyzed to confirm that both AhR and Arnt are present in vitro. AhR and Arnt mRNA were detected in granule neuroblasts by RT-PCR (data not shown). Western blot analyses indicated that both AhR and Arnt proteins were expressed in cerebellar granule cells that were cultured for 3 days (Fig. 3A). Additionally, AhR was not detected in cultures prepared from AhR null mice (Fig. 3B), but was present in wild-type (WT) neuroblasts (Fig. 3B). These findings indicate that cerebellar granule neuroblasts are potentially direct targets for AhR-mediated TCDD neurotoxicity.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3. AhR and ARNT proteins are expressed in mouse cerebellar granule neuroblast cultures. Granule neuroblast cell lysates were prepared after 3 days in vitro. 50–100 µg proteins were separated by SDS-PAGE then analyzed for AhR and ARNT expression by Western blot (A). Hepa1c1c7 (Hepa) lysates (5 µg) served as positive controls for AhR and ARNT expression. AhR protein was not detected in granule neuroblasts isolated from AhR knockout (KO) mice (B) but was present in cells isolated from wild-type (WT) mice (B). Similar results were obtained in cultures prepared from at least four different litters.

 
AhR Undergoes Nuclear Localization After TCDD Treatment
Previous investigations in a variety of cell types indicate that AhR resides primarily within the cytosol and upon ligand binding, it translocates to the nucleus and dimerizes with Arnt (Gu et al., 2000Go). To determine whether AhR is activated in cultured cerebellar granule neurons, the cellular localization of AhR cultures was resolved by immunocytochemistry under both basal conditions and after treatment with TCDD for time intervals ranging from 15 to 60 min. AhR was typically present within the cytosol of both untreated and vehicle control-treated granule cells (Fig. 4A, E). After treatment with 10 nM TCDD for 15 min on DIV 3, AhR expression co-localized with the nuclear DAPI stain (Fig. 4B, F), indicating that the receptor translocated to the nucleus within 15 min and remained there for at least 60 min (data not shown). Occasional less intense nuclear staining was detected in untreated and vehicle control granule neurons.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. AhR translocates to the nucleus in cerebellar granule neuroblasts after TCDD treatment. Photomicrographs (40x) of cerebellar granule neuroblasts treated with either DMSO (A, C, E) or 10 nM TCDD (B, D, F) for 15 min at DIV 3, and then stained with anti-AhR and DAPI nuclear stain. The arrows show examples of cytoplasmic localization of AhR in vehicle-treated cells (A, E) or nuclear localization of AhR after TCDD treatment (B, F). Similar results were obtained in experiments using neuroblast cultures prepared from four separate litters.

 
TCDD Treatment Induces CYP1A1 and CYP1B1 mRNA and Protein Expression
After translocating to the nucleus and dimerizing with ARNT, the AhR heteromeric complex binds to DREs of target genes, such as certain members of the cytochrome p450 (CYP) family of xenobiotic metabolizing enzymes (Gu et al., 2000Go; Whitlock, 1999Go). To confirm that TCDD is transcriptionally active for endogenous genes present in cultured cerebellar granule neurons, CYP1A1 and CYP1B1 expression was evaluated after 10 nM TCDD treatment for various time intervals. CYP1A1 mRNA was induced 3–5-fold and peaked between 4 and 8 h after 10 nM TCDD treatment (Fig. 5A). CYP1B1 gene expression was significantly elevated 1.5–2-fold in response to 10 nM TCDD treatment (Fig. 5B). To determine whether elevated protein levels accompanied alterations in CYP gene expression, granule neurons were treated with 0.1–10 nM TCDD for 24 h, and CYP expression was analyzed by Western blot. Both CYP1A1 and CYP1B1 proteins were upregulated in a concentration-dependent manner after TCDD treatment (Fig. 6). CYP1A1 protein expression was slightly induced in vehicle control (DMSO)-treated preparations (Fig. 6. upper panel); however, to a lesser extent than observed in TCDD-treated cells. Neither CYP isoform was induced by TCDD treatment in cultures prepared from AhR null mice (data not shown).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5. The AhR-responsive genes, CYP 1A1 and 1B1, are induced in cerebellar neuroblasts after TCDD treatment. CYP 1A1 and 1B1 gene expression was analyzed by reverse-transcriptase polymerase chain reaction (RT-PCR) after granule cells were exposed to 10 nM TCDD for 2–12 h. The upper figure shows relative levels of CYP1A1 (A) and CYP1B1 (B) mRNA induction in mouse cerebellar granule neuroblasts after TCDD treatment. CYP1A1 and 1B1 mRNA levels were normalized to ß-actin mRNA as measured by Taqman Quantitative RT-PCR. Values represent a comparison between TCDD-treated cells and vehicle (DMSO) controls. Results represent 4–6 independent experiments run in separate neuronal preparations. Data were analyzed by one-way ANOVA (*P < 0.01; +P < 0.05).

 


View larger version (70K):
[in this window]
[in a new window]
 
FIG. 6. CYP 1A1 and 1B1 protein levels increase after TCDD treatment in granule cells. Alterations in CYP1A1 and CYP1B1 protein levels were analyzed by Western blot after incubation with TCDD (0.1–10 nM) for 24 h. Both CYP1A1 (upper panel) and CYP1B1 (lower panel) proteins were induced in a concentration-dependent manner after TCDD treatment. Membranes were stripped and reprobed with antibodies specific for ß-actin to confirm equal loading in each lane. Similar finding were repeated in four experiments from separate neuroblast preparations.

 
TCDD Decreases 3H-Thymidine Incorporation in Granule Neuroblasts
Prior to differentiating, dividing neuroblasts receive a signal to exit the cell cycle. To evaluate whether TCDD exposure affects DNA synthesis, 3H-thymidine incorporation into DNA was determined as previously described (Opanashuk and Hauser, 1998Go; Opanashuk et al., 2001Go). After a 24-h reaggregation period, granule neuroblasts were exposed to DMSO or TCDD 0.1–10 nM for 24 h then labeled with 2 µCi/ml 3H-thymidine for 12 h, resulting in a 36-h treatment period. Heparin-binding epidermal growth factor (HB-EGF; 10 ng/ml) served as a positive control for growth (Opanashuk and Hauser, 1998Go) and was added at the same time as TCDD. Whereas, 10 ng/ml HB-EGF stimulated a 50% elevation in thymidine incorporation, TCDD treatment reduced DNA synthesis by 10–30% in a concentration-dependent manner (Fig. 7).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 7. TCDD decreases 3H-thymidine incorporation between DIV 1–2. Cerebellar granule neuroblast DNA synthesis was reduced in a concentration-dependent manner after treatment with 0.1–10 nM TCDD for 36 h. HB-EGF (10 ng/ml) served as a positive control for cell growth. Data represent the means ± SEM from 4–6 separate experiments. Data were analyzed by ANOVA and the Fisher's post-hoc test (*P < 0.01 vs. untreated cultures).

 
TCDD Attenuates Granule Neuroblast Survival in a Concentration-Dependent Manner
During the normal course of development, granule neurons undergo a tightly regulated program of apoptosis (White and Barone, 2001Go). To ascertain whether TCDD affected granule precursor cell survival, EGL neuroblast viability was assessed in response to 0.1–10 nM TCDD after 24 h on DIV 2 using the live-dead assay (Molecular Probes, Eugene OR) as previously described (Opanashuk and Hauser, 1998Go; Opanashuk et al., 2001Go). As controls for the viability assay, cultures were treated with staurosporine for 24 h or lysed with 0.1% Triton-X-100, resulting in 100% neuronal death (data not shown). The live-dead markers did not overlap in the same cell, and all cells were labeled as living or dead. In general, there was a low percentage of cell death, ranging between 5% and 10%, in untreated or vehicle control cultures after the 24-h treatment period. However, TCDD treatment decreased granule neuroblast survival by 10–20% after a 24-h exposure (Fig. 8).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 8. TCDD stimulated modest levels of cell death between DIV 2 and DIV 3. EGL neuroblasts were plated on poly-L-lysine coated coverslips on DIV 1. Cultures were treated with 0.1–10 nM TCDD on for 24 h on DIV 2. Cell viability was assessed on DIV 3. On DIV 3 cell death in control cultures ranged between 5% and 10%. TCDD reduced cell survival by 5–20% in a concentration-dependent manner. Data represent the mean ± SEM from four independent experiments and were analyzed by ANOVA and the Fisher's post-hoc test (+P ≤ 0.05; *P ≤ 0.01 vs. untreated cultures)

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
AhR and Arnt genes were recently identified in the internal granule cell layer of adult rat cerebellum (Petersen et al., 2000Go), yet the developmental expression of these proteins has not been examined. The observations in this study are the first to suggest potential roles for the AhR/Arnt complex during the course of cerebellar granule neuron development, which could be disrupted in response to TCDD exposure. Immunoblot analyses revealed that AhR and Arnt proteins were present in cerebellar tissue from birth throughout adulthood. Whereas Arnt levels remained constant throughout postnatal ontogeny, AhR expression was detected on the day of birth and peaked between PND 3 and PND 10 in cerebellar homogenates. AhR protein was upregulated during a critical window of granule neuron maturation, a time period in which several processes are coordinately regulated, including proliferation, migration, differentiation, and programmed cell death (apoptosis) (Altman and Bayer, 1997Go; Goldowitz and Hamre, 1998Go; White and Barone, 2001Go). The presence of both AhR and Arnt in cultured cerebellar granule cells indicates that these developing neuroblasts have the potential to be direct targets for AhR-mediated neurotoxicity in response to TCDD or related PAH xenobiotics.

For AhR to disrupt the molecular events that regulate brain development after TCDD exposure, the receptor must be transcriptionally functional. The data from this study strongly indicate that cerebellar granule neuroblasts are responsive to dioxin and that AhR is transcriptionally active. The transgenic DRE-LacZ reporter mouse (Willey et al., 1998Go) served as an ideal system with which to explore the spatial distribution of transcriptionally active AhR in the developing cerebellum. A maximally inducing dose of TCDD (Poland and Glover, 1975Go) administered on PND 10 revealed activation of the DRE-LacZ reporter gene in cerebellar granule neuroblasts residing in the EGL, molecular layer, and IGL, suggesting that an AhR-mediated signaling pathway was stimulated. The absence of detectable DRE-LacZ reporter gene activation in tissues from mice not treated with TCDD does not exclude the possibility that AhR normally participates in granule neuron development. Only a single time point was examined in the present investigation, and the sensitivity of the exogenous LacZ gene may be lower than particular endogenous DRE-containing genes. Nevertheless, the DRE-LacZ reporter mouse will be useful to elucidate endogenous roles for AhR by examining the spatiotemporal expression of transcriptional activity throughout brain development. Furthermore, this transgenic model will facilitate identifying additional cellular and anatomical targets of AhR-mediated developmental TCDD neurotoxicity.

At the cellular level, ligand interaction stimulates AhR to transit from the cytosol into the nucleus, where the receptor dimerizes with Arnt prior to activating gene transcription by binding to DREs (Gu et al., 2000Go). TCDD stimulated nuclear translocation of AhR in cultured granule neuroblasts rapidly following treatment. Interestingly, AhR was intermittently expressed in the nuclei of vehicle-treated and untreated control granule cells. This phenomenon has been previously been observed in other tissue types (Chang and Puga, 1998Go; Singh et al., 1996Go). It is not clear whether nuclear expression can be attributed to the presence of an endogenous ligand or a ligand-independent process. After entering the nucleus, AhR regulates the expression of several genes, termed the "Ah target gene battery" (Nebert et al., 2000Go), of which the best characterized are certain CYP metabolic enzymes. The CYP family members are heme-containing enzymes that are responsible for the metabolic oxidation of a wide variety of exogenous and endogenous substrates (Whitlock, 1999Go). Although TCDD was recently shown to induce CYP1A1 mRNA in adult rat cerebellar granule neurons (Huang et al., 2000Go), the developmental regulation of AhR target gene expression has not been examined at the cellular level. In the current study, TCDD stimulated concentration-dependent and time-dependent increases in CYP1A1 and 1B1 mRNA in cerebellar granule neuroblast cultures. Elevated CYP1A1 and 1B1 protein levels accompanied alterations in gene expression. These findings indicate that TCDD modulates CYP expression, most likely via interaction with the AhR, in developing cerebellar granule neuroblasts.

Although TCDD served as a means to examine the transcriptional activity of AhR by monitoring CYP 1A1 and 1B1 expression, the altered profiles of these metabolic enzymes produced after environmental exposures could impair normal brain function. The CYP family members are heterogeneously distributed at modest levels in several brain regions (Hedlund et al., 2001Go), which suggests that the CNS participates in bioactivation or detoxification of environmental toxicants and the regulation of endogenous substances. Previous studies have indicated that the CYP isozymes normally participate in the metabolism of neurotransmitters, endogenous steroids, and neurosteroids in the brain (Miksys and Tyndale, 2002Go). Often inert exogenous or endogenous compounds are bioactivated to reactive metabolites by CYP1A1, which can lead to oxidative stress production and cell death (Nebert et al., 2000Go), potentially mechanisms by which TCDD could mediate neurotoxicity. The relationships between AhR-mediated CYP induction, neuronal development, and TCDD neurotoxicity obviously require further study.

The most compelling issues that emerge from this study are related to the impact of reduced granule neuroblast DNA synthesis and survival on cerebellar development and ultimately function. Cerebellar granule neuron precursors (GNP) originate in the rostral aspect of the rhombic lip, and then migrate laterally to form the external granule cell layer (EGL) on the dorsal surface of the cerebellum during the embryonic period in rodents (Altman and Bayer, 1997Go; Goldowitz and Hamre, 1998Go). During the postnatal period in rodents, GNPs proliferate in the outer EGL, leave the cell cycle, and move into the inner EGL before migrating through the molecular and Purkinje cell layers and settling in the IGL, where terminal differentiation and synaptogenesis occur. A tightly regulated spatiotemporal program of gene expression orchestrates these molecular events during granule neuron maturation. Considering that TCDD treatment decreased DNA synthesis and cell survival in granule neuroblast cultures, environmental exposure could influence final granule neuron numbers in the cerebellum by interfering with normal proliferative and apoptotic programs. Such disruption of granule neuron production could adversely affect cell interactions and neural circuitry formation, thereby leading to functional abnormalities.

Although it is premature to speculate about functional consequences of TCDD exposure, our observations are the first to demonstrate that AhR and ARNT proteins are expressed and transcriptionally active in cerebellar granule cells during a critical period of neuronal maturation. Most importantly, the reduction in DNA synthesis and cell survival in cultured granule neuroblasts after TCDD treatment leads to the speculation that TCDD may impede granule neuron production by diverting AhR from its endogenous function. Findings from ongoing and future studies will provide information regarding the mechanisms by which perinatal TCDD exposure affects neurogenesis, perhaps by dysregulating the expression of candidate genes involved in the normal proliferation, differentiation, and apoptosis programs during granule neuron development. Inappropriate activation of AhR after exposure to an environmental toxicant such as TCDD could interfere with the requisite gene profiles for neuronal maturation and disrupt the proper formation of brain circuitry, which might ultimately engender adverse neurobehavioral or neurological outcomes.


    ACKNOWLEDGMENTS
 
We are grateful to Drs. Mayer-Proschel, McCabe, Noble, Olschowka, and the members of their laboratories for help and advice with these studies. We appreciate the assistance with statistical analyses and preparation of this manuscript provided by Brian Barlow. Many thanks to Jennifer Keister, for generating the DRE-LacZ reporter mice. In addition, Nancy Proper and Ann Colasurdo are acknowledged for breeding and genotyping the AhR null mice. This research was supported by the National Institutes of Health under grants NIH P30 ES01247, T32 ES07026, and ES09430.


    NOTES
 

1 To whom correspondence should be addressed at Box EHSC, 575 Elmwood Avenue, Rochester, NY 14642. Fax: 585–273–2591. E-mail: lisa_opanashuk{at}urmc.rochester.edu


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Abbott, B. D., Birnbaum, L. S., and Perdew, G. H. (1995). Developmental expression of two members of a new class of transcription factors: I. Expression of aryl hydrocarbon receptor in the C57BL/6N mouse embryo. Dev. Dyn. 204, 133–143.[Web of Science][Medline]

Abbott, B. D., and Probst, M. R. (1995). Developmental expression of two members of a new class of transcription factors: II. Expression of aryl hydrocarbon receptor nuclear translocator in the C57BL/6N mouse embryo. Dev. Dyn. 204, 144–155.[Web of Science][Medline]

Altman, J., and Bayer, S. A. (1997). Development of the Cerebellar System in Relation to Its Evolution, Structure, and Functions. CRC Press, Boca Raton. FL.

Birnbaum, L. S., and Tuomisto, J. (2000). Non-carcinogenic effects of TCDD in animals. Food Addit. Contam. 17, 275–288.[CrossRef][Web of Science][Medline]

Chang, C. Y., and Puga, A. (1998). Constitutive activation of the aromatic hydrocarbon receptor. Mol. Cell Biol. 18, 525–535.[Abstract/Free Full Text]

Ferguson, S. A. (1996). Neuroanatomical and functional alterations resulting from early postnatal cerebellar insults in rodents. Pharmacol. Biochem. Behav. 55, 663–671.[CrossRef][Web of Science][Medline]

Filbrandt, C. R., Wu, Z., Zlokovic, B., Opanashuk, L., and Gasiewicz, T. A. (2004). Presence and functional activity of the aryl hydrocarbon receptor in isolated murine cerebral vascular endothelial cells and astrocytes. Neurotoxicology 25, 605–616.[CrossRef][Web of Science][Medline]

Gao, W. O., Heintz, N., and Hatten, M. E. (1991). Cerebellar granule cell neurogenesis is regulated by cell-cell interactions in vitro. Neuron 6, 705–715.[CrossRef][Web of Science][Medline]

Goldowitz, D., and Hamre, K. (1998). The cells and molecules that make a cerebellum. Trends Neurosci. 21, 375–382.[CrossRef][Web of Science][Medline]

Gu, Y. Z., Hogenesch, J. B., and Bradfield, C. A. (2000). The PAS superfamily: Sensors of environmental and developmental signals. Annu. Rev. Pharmacol. Toxicol. 40, 519–561.[CrossRef][Web of Science][Medline]

Hakkola, J., Pasanen, M., Pelkonen, O., Hukkanen, J., Evisalmi, S., Anttila, S., Rane, A., Mantyla, M., Purkunen, R., Saarikoski, S., Tooming, M., and Raunio, H. (1997). Expression of CYP1B1 in human adult and fetal tissues and differential inducibility of CYP1B1 and CYP1A1 by Ah receptor ligands in human placenta and cultured cells. Carcinogenesis 18, 391–397.[Abstract/Free Full Text]

Hedlund, E., Gustafsson, J. A., and Warner, M. (2001). Cytochrome P450 in the brain; a review. Curr. Drug Metab. 2, 245–263.[CrossRef][Web of Science][Medline]

Huang, P., Rannug, A., Ahlbom, E., Hakansson, H., and Ceccatelli, S. (2000). Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the expression of cytochrome P450 1A1, the aryl hydrocarbon receptor, and the aryl hydrocarbon receptor nuclear translocator in rat brain and pituitary. Toxicol. Appl. Pharmacol. 169, 159–167.[CrossRef][Web of Science][Medline]

Kellen, J. A., Kolin, A., and Fletch, A. L. (1976). Cerebellar dysgenesis in rats by diaplacental effects of 7,12-dimethylbenz[a]anthracene. J. Natl. Cancer Inst. 56, 1063–1067.[Web of Science][Medline]

Kuramoto, N., Baba, K., Gion, K., Sugiyama, C., Taniura, H., and Yoneda, Y. (2003). Xenobiotic response element binding enriched in both nuclear and microsomal fractions of rat cerebellum. J. Neurochem. 85, 264–273.[Web of Science][Medline]

Lai, Z. W., Pineau, T., and Esser, C. (1996). Identification of dioxin-responsive elements (DREs) in the 5' regions of putative dioxin-inducible genes. Chem. Biol. Interact. 100, 97–112.[CrossRef][Web of Science][Medline]

Miksys, S. L., and Tyndale, R. F. (2002). Drug-metabolizing cytochrome P450s in the brain. J. Psychiatry Neurosci. 27, 406–415.[Web of Science][Medline]

Nayyar, T., Zawia, N. H., and Hood, D. B. (2002). Transplacental effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the temporal modulation of Sp1 DNA binding in the developing cerebral cortex and cerebellum. Exp. Toxicol. Pathol. 53, 461–468.[CrossRef][Web of Science][Medline]

Nazarenko, D. A., Dertinger, S. D., and Gasiewicz, T. A. (2001). In vivo antagonism of AhR-mediated gene induction by 3'-methoxy-4'-nitroflavone in TCDD-responsive lacZ mice. Toxicol. Sci. 61, 256–264.[Abstract/Free Full Text]

Nebert, D. W., Roe, A. L., Dieter, M. Z., Solis, W. A., Yang, Y., and Dalton, T. P. (2000). Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochem. Pharmacol. 59, 65–85.[CrossRef][Web of Science][Medline]

Neuberger, M., Rappe, C., Bergek, S., Cai, H., Hansson, M., Jager, R., Kundi, M., Lim, C. K., Wingfors, H., and Smith, A. G. (1999). Persistent health effects of dioxin contamination in herbicide production. Environ. Res. 81, 206–214.[Medline]

Opanashuk, L. A., and Hauser, K. F. (1998). Opposing actions of the EGF family and opioids: Heparin binding-epidermal growth factor (HB-EGF) protects mouse cerebellar neuroblasts against the antiproliferative effect of morphine. Brain Res. 804, 87–94.[CrossRef][Web of Science][Medline]

Opanashuk, L. A., Pauly, J. R., and Hauser, K. F. (2001). Effect of nicotine on cerebellar granule neuron development. Eur. J. Neurosci. 13, 48–56.[CrossRef][Web of Science][Medline]

Petersen, S. L., Curran, M. A., Marconi, S. A., Carpenter, C. D., Lubbers, L. S., and McAbee, M. D. (2000). Distribution of mRNAs encoding the arylhydrocarbon receptor, arylhydrocarbon receptor nuclear translocator, and arylhydrocarbon receptor nuclear translocator-2 in the rat brain and brainstem. J. Comp. Neurol. 427, 428–439.[CrossRef][Web of Science][Medline]

Poland, A., and Glover, E. (1975). Genetic expression of aryl hydrocarbon hydroxylase by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Evidence for a receptor mutation in genetically non-responsive mice. Mol. Pharmacol. 17, 389–398.

Puga, A., Xia, Y., and Elferink, C. (2002). Role of the aryl hydrocarbon receptor in cell cycle regulation. Chem. Biol. Interact. 141, 117–130.[CrossRef][Web of Science][Medline]

Rogan, W. J., and Gladen, B. C. (1992). Neurotoxicology of PCBs and related compounds. Neurotoxicology 13, 27–35.[Web of Science][Medline]

Safe, S. (1990). Polychlorinated biphenyls (PCBs), dibenzo-p-dioxins (PCDDs), dibenzofurans (PCDFs), and related compounds: Environmental and mechanistic considerations which support the development of toxic equivalency factors (TEFs). Crit. Rev. Toxicol. 21, 51–88.[Web of Science][Medline]

Schmidt, J. V., Su, G. H., Reddy, J. K., Simon, M. C., and Bradfield, C. A. (1996). Characterization of a murine Ahr null allele: Involvement of the Ah receptor in hepatic growth and development. Proc. Natl. Acad. Sci. U. S. A. 93, 6731–6736.[Abstract/Free Full Text]

Singh, S. S., Hord, N. G., and Perdew, G. H. (1996). Characterization of the activated form of the aryl hydrocarbon receptor in the nucleus of HeLa cells in the absence of exogenous ligand. Arch. Biochem. Biophys. 329, 47–55.[CrossRef][Web of Science][Medline]

Thiel, R., Koch, E., Ulbrich, B., and Chahoud, I. (1994). Peri- and postnatal exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Effects on physiological development, reflexes, locomotor activity and learning behaviour in Wistar rats. Arch. Toxicol. 69, 79–86.[CrossRef][Web of Science][Medline]

White, L. D., and Barone, S., Jr. (2001). Qualitative and quantitative estimates of apoptosis from birth to senescence in the rat brain. Cell Death Differ. 8, 345–356.[CrossRef][Web of Science][Medline]

Whitlock, J. P., Jr. (1999). Induction of cytochrome P4501A1. Annu. Rev. Pharmacol. Toxicol. 39, 103–125.[CrossRef][Web of Science][Medline]

Willey, J. J., Stripp, B. R., Baggs, R. B., and Gasiewicz, T. A. (1998). Aryl hydrocarbon receptor activation in genital tubercle, palate, and other embryonic tissues in 2,3,7,8-tetrachlorodibenzo-p-dioxin-responsive lacZ mice. Toxicol. Appl. Pharmacol. 151, 33–44.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
International Journal of ToxicologyHome page
R. A. Howd
Considering Changes in Exposure and Sensitivity in an Early Life Cumulative Risk Assessment
International Journal of Toxicology, January 1, 2010; 29(1): 71 - 77.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Gabbi, H.-J. Kim, K. Hultenby, D. Bouton, G. Toresson, M. Warner, and J.-A. Gustafsson
Pancreatic exocrine insufficiency in LXR{beta}-/- mice is associated with a reduction in aquaporin-1 expression
PNAS, September 30, 2008; 105(39): 15052 - 15057.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
L. L. Collins, M. A. Williamson, B. D. Thompson, D. P. Dever, T. A. Gasiewicz, and L. A. Opanashuk
2,3,7,8-Tetracholorodibenzo-p-Dioxin Exposure Disrupts Granule Neuron Precursor Maturation in the Developing Mouse Cerebellum
Toxicol. Sci., May 1, 2008; 103(1): 125 - 136.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. J. McMillan and C. A. Bradfield
The Aryl Hydrocarbon Receptor sans Xenobiotics: Endogenous Function in Genetic Model Systems
Mol. Pharmacol., September 1, 2007; 72(3): 487 - 498.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. W. Garrett and T. A. Gasiewicz
The Aryl Hydrocarbon Receptor Agonist 2,3,7,8-Tetrachlorodibenzo-p-dioxin Alters the Circadian Rhythms, Quiescence, and Expression of Clock Genes in Murine Hematopoietic Stem and Progenitor Cells
Mol. Pharmacol., June 1, 2006; 69(6): 2076 - 2083.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. C. Bemis, D. A. Nazarenko, and T. A. Gasiewicz
Coplanar Polychlorinated Biphenyls Activate the Aryl Hydrocarbon Receptor in Developing Tissues of Two TCDD-Responsive lacZ Mouse Lines
Toxicol. Sci., October 1, 2005; 87(2): 529 - 536.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
83/2/340    most recent
kfi031v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Williamson, M. A.
Right arrow Articles by Opanashuk, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williamson, M. A.
Right arrow Articles by Opanashuk, L. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?