ToxSci Advance Access originally published online on November 24, 2004
Toxicological Sciences 2005 83(2):363-371; doi:10.1093/toxsci/kfi041
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicological Sciences vol. 83 no. 2 © Society of Toxicology 2005; all rights reserved.
Early Developmental 2,3,7,8-Tetrachlorodibenzo-p-Dioxin Exposure Decreases Chick Embryo Heart Chronotropic Response to Isoproterenol but Not to Agents Affecting Signals Downstream of the Beta-Adrenergic Receptor


* Bates College, Department of Biology, Lewiston, Maine 04240-6018, and
College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, New Mexico 87131-5691
Received August 12, 2004; accepted November 17, 2004
| ABSTRACT |
|---|
|
|
|---|
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) causes cardiovascular toxicity in laboratory animals, including alteration in several processes in which beta-adrenergic receptor (ß-AR) signaling plays important roles. Thus, our laboratory investigated the effects of TCDD on ß-AR expression and signal transduction. Fertile chicken eggs were injected with vehicle (corn oil), 0.24 or 0.3 pmol TCDD/g egg on incubation day 0 (D0) or D5. On D10, heart function was assessed by ECG in ovo. Exposure to TCDD increased the incidence of arrhythmias and decreased the positive chronotropic responsiveness of the heart to isoproterenol. The reduced ß-AR responsiveness was, in part, independent of any overt morphological changes in the heart as chick embryos exposed to TCDD on D5 displayed an intermediate responsiveness to ß-AR agonist in the absence of the dilated cardiomyopathy observed in chick embryos exposed to TCDD on D0. TCDD did not decrease the chronotropic response of the heart to agents that stimulate signals downstream of the ß-AR. In fact, TCDD-exposed embryos were more sensitive than controls to forskolin, increasing heart rates (HR) 21.8 ± 3.5 beats per min (bpm) above baseline versus control values at 6.3 ± 2.7 bpm above baseline. TCDD exposure also augmented the negative chronotropic response of the heart to verapamil, decreasing HR 23.2 ± 7.4 bpm relative to baseline versus control embryos at 12.7 ± 5.9 bpm below baseline. Finally, the mean cardiac ß1-AR mRNA expression in D10 embryos was not significantly altered by exposure to TCDD on D0. These findings establish that a functional end point of the developing chick heart is sensitive to TCDD exposure and that the TCDD-induced reduction in ß-AR responsiveness may result from alterations in signal transduction upstream of adenylyl cyclase.
Key Words: TCDD; dioxin; developmental cardiovascular toxicity; beta-adrenergic receptor; ECG, arrhythmia.
| INTRODUCTION |
|---|
|
|
|---|
The risk posed by chlorinated dioxins and related compounds to the human cardiovascular system is uncertain. An increased risk of death due to ischemic heart disease has been associated with exposure to chlorinated dioxins in cohorts of Seveso residents (Pesatori et al., 1998
The developing cardiovascular systems of mammalian, piscine, and avian species are also targets of TCDD-induced toxicity. Exposure to TCDD reduced heart-to-body weight ratios in fetal mice (Walker et al., 2003
) and rainbow trout sac fry (Hornung et al., 1999
). Developmental TCDD exposure increased the incidence of ventricular septal defects and aortic arch anomalies (Cheung et al., 1981
; Walker et al., 1997
) and induced dilated cardiomyopathy that progressed to heart failure in chick embryos (Walker and Catron, 2000
). Mechanistic studies investigating the effects of TCDD exposure on the developing chick cardiovascular system demonstrated that the compact layer of the ventricular myocardial wall does not thicken in TCDD-exposed chick embryos (Walker and Catron, 2000
; Walker et al., 1997
), perhaps due to increased apoptosis and decreased myocyte proliferation that preceded a reduction in coronary artery number and size (Ivnitski et al., 2001
).
One possible mechanism by which TCDD exposure could cause cardiovascular toxicity is disruption of beta-adrenergic receptor (ß-AR) signaling. ß-ARs and their signal transduction systems give the normal heart the ability to increase its output by several fold within a matter of seconds following activation by catecholamines. ß-AR signaling also plays an important role in the processes of heart failure (for review see Port and Bristow, 2001
), myocyte proliferation (Sambrano et al., 2002
; Tseng et al., 2001
), apoptosis (Communal et al., 1998
; Zhu et al., 2003
) and angiogenesis (Fredriksson et al., 2000
). All of these processes have been shown to be altered by TCDD exposure. In addition, several studies have shown that acute exposure to overtly toxic doses of TCDD inhibits ß-AR responsiveness. Six days after treatment with 40,000 ng TCDD/kg/day for 3 consecutive days, intact adult female rats displayed significantly lower blood pressures, resting heart rates (HRs), and isoproterenol-stimulated HRs (Hermansky et al., 1988
). Atrial and ventricular muscle isolated from adult guinea pigs exposed to 100010,000 ng TCDD/kg had decreased inotropic responses to ß-AR agonists (Brewster et al., 1987
; Canga et al., 1988
). Similarly, chick embryos exposed to approximately 5,00010,000 ng TCDD/kg egg on day 10 (D10) exhibited reduced cardiac contractile responses to isoproterenol on D15 (Canga et al., 1993
).
The purpose of our study was to determine whether early developmental exposure to a relatively low dose of TCDD (75100 ng/kg) impairs ß-AR signaling and to gain insights into the molecular mechanisms of any such impairment. Accordingly, we (1) measured HRs of control and TCDD-exposed chick embryos by ECG in ovo before and after administration of pharmacological agents that stimulated or inhibited ß-AR or ß-AR signal transduction, (2) determined whether TCDD-induced inhibition of ß-AR chronotropic responsiveness is dependent on overt morphological changes in the heart, and (3) measured ß1-AR mRNA levels.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chicken embryos and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure. Fertile chicken eggs of Plymouth Rock-Barred strain (Privett Hatchery, Portales, NM) were obtained fresh, stored at 15°C and were set within 1 week of arriving at the University of New Mexico. On incubation day 0 (D0), eggs were allowed to warm to room temperature for 24 h and were injected with 5 µl corn oil vehicle, 0.24 pmol TCDD/g egg, or 0.3 pmol TCDD/g egg into the aircell through a hole in the shell. The injection hole was sealed with paraffin wax, and eggs were placed in automatic tilting racks in an incubator with circulated air at 38°C, 55% humidity. In a second study, eggs were treated as described, except administration of corn oil vehicle or 0.3 pmol TCDD/g egg occurred on D5.
Drug treatments. Urethane,
-chloralose, (-)-isoproterenol hydrochloride, forskolin, theophylline, (s)-(-)-Bay K8644, (±)-verapamil hydrochloride, and DL-propranolol hydrochloride were purchased from Sigma-Aldrich Co. (St. Louis, MO). Solutions were made fresh each day with filter-sterilized 0.9% sodium chloride (saline) and were administered by injection of a 100-µl volume into the aircell of the egg. Forskolin and Bay K8644 were first dissolved in sterile dimethyl sulfoxide (DMSO), resulting in a concentration of 5% DMSO in saline in their final working solutions. Pilot studies were conducted to establish that the vehicles (saline or 5% DMSO in saline) did not affect ECG measurements and to determine the dose at which each drug maximally changed HR without causing intermittent heart block or ectopic heart beats in either control or TCDD-exposed chick embryos.
Electrocardiography. To determine whether TCDD exposure alters cardiac ß-AR signaling, HRs of control and TCDD-exposed chick embryos administered ß-AR agonist, ß-AR antagonist, or agents affecting downstream events of ß-AR signaling were determined by three-lead ECG in ovo. On D10, eggs were removed from the incubator one-at-a-time, candled to determine the location of the embryo and marked for correct placement of electrodes. Embryos were anesthetized by injection of a mixture of urethane (45 mg/egg) and
-chloralose (4.5 mg/egg), a dose previously established to inhibit spontaneous motion of the embryo and provide stable ECG recordings, which has no affect on HR (Sugiyama, et al., 1996
; Walker and Catron, 2000
). Three small holes were made in the shell: the first 10 mm down from the aircell 180° across from the embryo (lead I), a second 45 mm down from the position of the embryo (lead II), and a third in the pointed bottom of the egg (ground). Silver wire electrodes (0.5 mm) were inserted into the holes, taped in position and connected to a BMA-931 bioamplifier (CWE, Inc.). Eggs were placed into a 37°C incubator (Boekel), and ECGs were digitally recorded (DI-720 Waveform Recording System, Dataq Instruments) continuously for 10 min before and 15 min after injection of saline, 5% DMSO in saline, 30120 µg/egg isoproterenol, 25 µg/egg forskolin, 2.5 mg/egg theophylline, 10 µg/egg Bay K8644, 112 µg/egg propranolol, or 10 µg/egg verapamil. HRs were determined from the RR intervals of 10- to 12-beat segments at the beginning of each min of ECG recordings and were expressed as beats per min (bpm). Basal HRs were reported from the 10-min time point just prior to drug treatment. The effect of drug on change in HR was calculated by subtracting the HR recorded at the time of drug injection (time 0) from the HR at each min postinjection. All drugs induced maximal change in HR within 10 min of injection, and the change was maintained through 15 min postinjection. The average change in HR from time 10- to 15-min postinjection was determined for each embryo and used to calculate the mean ± SE change in HR for control and TCDD-exposed embryos for each drug treatment. Five to eight embryos were analyzed from both corn oil vehicle and 0.3 pmol TCDD/g egg administered on D0 dose groups for each drug treatment. In addition, six embryos from the corn oil vehicle and five embryos from the 0.3 pmol TCDD/g egg administered on D5 dose groups were analyzed for 60 µg/egg isoproterenol. Embryos exhibiting an arrhythmia during basal ECG recordings were not used for HR determinations or any drug treatment experiments.
Cardiac morphology. On D10, hearts of embryonic chicks exposed to corn oil vehicle (n = 6) or 0.24 pmol TCDD/g egg (n = 11) on D0, or to corn oil vehicle (n = 12) or 0.3 pmol TCDD/g egg (n = 11) on D5 were excised, weighed, and preserved in 4% paraformaldehyde. Fixed hearts were embedded in paraffin, sectioned at 10 µm in a transverse orientation, and stained with hematoxylin and eosin. Hearts from both D0 and D5 corn oil vehicle and TCDD dose groups were analyzed for morphological signs of heart failure, including ventricular cavity dilation and thickening of the left ventricle wall (Walker and Catron, 2000
).
Northern blot analysis. On D10, hearts were quickly excised, frozen in liquid nitrogen, and stored at 80°C until RNA extraction. RNA was extracted using TRIzol Reagent (Life Technologies, Inc.) as described by the manufacturer. Northern blots were prepared using 25 µg total RNA, size-fractionated by electrophoresis through 1.2% agarose/formaldehyde gels, and transferred by capillary action to nylon membranes (Hybond N, Amersham) using 20x SSC. After UV cross-linking, membranes were prehybridized for at least 2 h at 42°C in a solution containing 50% formamide, 25 mM potassium phosphate (pH 7.4), 5x SSC, 5x Denhardt's reagent, 0.5% SDS, and 50 µg/ml sheared salmon sperm DNA. Hybridization was carried out in fresh prehybridization solution supplemented with 10% dextran sulfate and 1 x 106 cpm/ml of 32P-dCTP-labeled, random-primed cDNA probe. The ß1-AR cDNA probe was generated using a 579-bp chick ß1-AR cDNA fragment corresponding to nucleotides 486-1065 (numbers based on turkey sequence; GenBank Accession Number M14379), which had been amplified by RT-PCR (forward primer, CTACCTGGCCATCACTTCG; reverse primer, GCCCAACCAGTTGAAGAAAA). The GAPDH probe was generated using a 267-bp chick GAPDH cDNA fragment corresponding to nucleotides 912-1179 (Genbank Accession Number K01458), which had been amplified by RT-PCR (forward primer, GGTGACAGCCATTCTT; reverse primer, GAGACAGAAGGGAACA). Membranes were washed stringently (0.1x SSC, 0.1%SDS, 65°C) and exposed to film for 72 h (ß1-AR) or 45 min (GAPDH). Two bands were readily visible at the expected size for the avian ß1-AR transcript (2.6 kb; Wang and Ross, 1995
) and the avian GAPDH transcript (1.3 kb; Panabieres et al., 1984
). The films were scanned, and band intensities were analyzed using a Kodak Image Station. Based on observation of rRNA and GAPDH band intensities, there were small loading differences between samples, which were controlled for by normalizing B1-AR mRNA volumes to GAPDH volumes. Six individual hearts were analyzed from both corn oil vehicle and 0.3 pmol TCDD/g egg administered on D0 dose groups.
Statistical analysis. Results are presented as means ± SE. Statistical analysis of data was performed using SigmaStat 3.0 statistical package (Point Richmond, CA). Data were analyzed for normality (Kolmogorov-Smirnov test with Lilliefors' correction) and homogeneity of variance (Levene Median test) and, when necessary, were transformed (natural log or square root) to obtain a normal distribution and/or equal variance. Data were analyzed by the Mann-Whitney Rank sum test when failures of normal distribution (basal HR data) or equal variance (ß1-AR mRNA expression data) persisted. Data were analyzed by Student's t-test to compare the effect of corn oil versus TCDD exposure on heart wet weight and by z-test to compare proportions of embryos presenting with arrhythmias. The effects of vehicle or various drug treatments on HR in corn oil and TCDD-exposed embryos were analyzed by two-way analysis of variance (ANOVA) using the Holm-Sidak all pairwise multiple comparison method. Significance was set at p < 0.05.
| RESULTS |
|---|
|
|
|---|
Developmental Exposure to TCDD Does Not Change Basal Heart Rate but Does Increase the Incidence of Arrhythmias
In ovo ECGs were used to assess cardiac function in D10 chick embryos exposed to corn oil (control) or 0.3 pmol TCDD/g egg on D0 or D5. We obtained ECGs with readily visible QRS complexes (Fig. 1). Thus, we were able to use RR intervals to determine HRs of chick embryos at an earlier age than commonly reported in the literature. TCDD, regardless of the day of administration, did not alter basal HR. On D10, HRs of control and TCDD-exposed embryos were 218.4 ± 3.7 (mean ± SE, n = 38) and 221.9 ± 4.1 (n = 42) bpm, when exposure began on D0, and were 208.4 ± 14.6 (n = 7) and 216.5 ± 9.1 (n = 7) bpm, when exposure began on D5.
|
Administration of TCDD on D0 significantly increased the incidence of arrhythmias recorded during basal ECGs on D10 from 0% in control embryos to 11% in the TCDD-exposed embryos (Table 1). A small proportion of embryos, similar in both control and TCDD treated groups, first displayed arrhythmias after drug treatment (Table 1). All arrhythmias observed were intermittent heart blocks (Fig. 1B), except two embryos exposed to TCDD on D0 that displayed bigeminy arrhythmias during basal ECGs (Fig. 1C). Based on RR intervals, the intermittent heart block arrhythmias were likely Type I AV blocks, however, this could not be confirmed due to insufficient clarity of P waves on most ECGs.
|
TCDD Decreases the Responsiveness of the Heart to a ß-AR Agonist but Not to Pharmacological Agents Affecting Downstream Events of the ß-AR
The drug treatments used in this study and their actions on cardiac ß-AR signaling are depicted in a schematic diagram in Figure 2. Isoproterenol (ß-AR agonist), forskolin (activator of adenylyl cyclase), theophylline (phosphodiesterase inhibitor), and Bay K8644 (L-type calcium channel agonist) are positive chronotropes, whereas propranolol (ß-AR antagonist) and verapamil (L-type calcium channel antagonist and
1-AR antagonist) are negative chronotropes.
|
To assess the effect of TCDD exposure on ß-AR signaling, chronotropic responsiveness to isoproterenol administration was assessed using D10 embryos exposed to corn oil or 0.3 pmol TCDD/g egg on D0. Control embryos responded as expected with isoproterenol (30120 µg/egg) increasing HR of control embryos 16.1 ± 6.8 to 29.5 ± 11.2 bpm above baseline (n = 56 per dose) compared to control embryos administered saline that did not increase HR (0.5 ± 2.3 bpm change from baseline, n = 5) (Fig. 3). TCDD-exposed embryos did not significantly increase HR in response to isoproterenol administration (Fig. 3).
|
To determine whether TCDD exposure causes a generalized decrease in the ability of the heart to increase HR or whether it specifically impairs ß-AR signaling at the level of the receptor or at particular effectors of ß-AR signal transduction, embryos exposed to corn oil or 0.3 pmol TCDD/g egg on D0 were administered pharmacological agents to stimulate or inhibit ß-AR signaling, and ECGs were recorded on D10. Saline vehicle had no effect on HR (Fig. 4). Five percent DMSO vehicle tended to increase HR in control (9.7 ± 3.1 bpm above baseline, n = 6) and TCDD-exposed embryos (7.4 ± 5.3 bpm above baseline, n = 6), but this was not significantly different from baseline HRs or from HRs of embryos administered saline alone. Following administration of theophylline and BayK8644, control and TCDD-exposed embryos significantly increased HRs to a similar extent above HRs of embryos treated with vehicle alone (Fig. 4).
|
TCDD-exposed embryos presented an enhanced response to forskolin (25 µg/egg), increasing HR 21.8 ± 3.5 bpm above baseline (n = 5) versus control at 6.3 ± 2.7 (n = 6) bpm above baseline (Fig. 4). During pilot studies, higher doses of forskolin (50100 µg/egg) significantly increased control embryo HRs, but caused an initial increase in HR quickly followed by complete heart block and death in TCDD-exposed embryos (data not shown). Thus, chick embryos exposed to TCDD were more sensitive to the positive chronotropic and lethal effects of forskolin. TCDD-exposed embryos also displayed an increased sensitivity to verapamil, decreasing HRs 29.8 ± 5.7 bpm below baseline (n = 5) as compared to 16.9 ± 3.9 bpm below baseline in control embryos (n = 5) (Fig. 4). Since TCDD-exposed embryos tended to decrease HR to a lesser extent than control embryos following propranolol administration (Fig. 4), the lower HRs of TCDD-exposed embryos administered verapamil were not a generalized negative chronotropic effect.
TCDD Exposure Beginning on Day 5 Results in an Intermediate Responsiveness to ß-AR Agonist in the Absence of Dilated Cardiomyopathy
In an attempt to determine whether TCDD-induced resistance to isoproternol-stimulated tachycardia is independent of, or occurs prior to, the overt cardiomyopathy observed in chick embryos exposed to TCDD on D0 (Walker and Catron, 2000
), we exposed chick embryos to TCDD on D5. We hypothesized that TCDD exposure beginning at this later time-point would not cause dilated cardiomyopathy but would significantly reduce responsiveness to ß-AR agonist stimulation. As has been described previously, exposure of chick embryos on D0 to TCDD significantly increased heart weight, induced dilated cardiomyopathy, and reduced responsiveness to ß-AR-mediated tachycardia (Fig. 5). Consistent with our hypothesis, chick embryos exposed to 0.3 pmol TCDD/g egg on D5 did not have increased heart wet weights (Fig. 5A), nor did they have morphological signs of dilated cardiomyopathy (Fig. 5B). In addition, embryos exposed to TCDD on D5 increased HR 8 ± 8 bpm above baseline versus control embryos' increase of 22 ± 6 bpm above baseline, but counter to our hypothesis, this was not a statistically significant difference (Fig. 5C, p = 0.15).
|
TCDD Exposure Beginning on Day 0 Does Not Decrease Cardiac ß1-AR mRNA Expression on D10
Northern analysis was done to determine whether the TCDD-induced decrease in ß-AR responsiveness was associated with a decrease in ß1-AR mRNA in the D10 heart. We observed that TCDD exposure did not decrease ß1-AR mRNA levels when normalized to GAPDH mRNA expression; however, control samples exhibited a much larger variation in ß1-AR mRNA expression than that observed among TCDD samples (Fig. 6, p = 0.02).
|
| DISCUSSION |
|---|
|
|
|---|
Our findings demonstrate that early developmental exposure of the chick embryo to an environmentally relevant dose of TCDD increases the incidence of basal arrhythmias and decreases chronotropic responsiveness of the heart to ß-AR agonist. These data are consistent with previous reports of TCDD exposure decreasing cardiac ß-AR signaling (Brewster et al., 1987
In this study, 11% of chick embryos exposed to TCDD on D0 displayed intermittent heart block or bigeminy arrhythmias. We do not believe that TCDD treatment has previously been reported to increase incidence of cardiac arrhythmias. TCDD exposure in late-stage chick embryos inhibited flecainide-induced Wenckebach type AV conduction block (progressive prolongation of the PR interval prior to a ventricular beat), possibly by increasing resting concentrations of intracellular calcium (Fan et al., 2000
). Data from our study in mid-stage chick embryos, however, are not consistent with TCDD increasing resting concentrations of intracellular calcium. We observed that TCDD-exposed chick embryos were more susceptible to the negative chronotropic effects of verapamil, whereas increased concentrations of intracellular calcium should confer resistance to verapamil. It is tempting to speculate that, in the early development of the chick embryo, TCDD exposure may impair normal impulse conduction, leaving the embryo susceptible to both heart block arrhythmias and the inhibitory actions of verapamil on AV nodal conduction.
In contrast to the TCDD-induced negative chronotropic effects reported in this study, Rifkind and colleagues observed negative inotropic but no chronotropic effects of TCDD exposure in late stage chick embryos (Canga et al., 1993
; Fan et al., 2000
). This discrepancy may be explained by differences in timing of exposure. In Rifkind and colleagues' work, chick embryos were exposed to TCDD beginning on D1416, for 48 h prior to in ovo ECG recordings. Development of pacemaker activity occurs early in chick embryo cardiogenesis. Intrinsic beat rate is established by D23 (reviewed in DeHaan, 1988
), and the His-Purkinje system is completely formed by D710 (Arguello et al., 1988
; Chuck et al., 1997
). Thus, TCDD exposure occurring early in embryonic development, as in our study, might affect the development of pacemaker activity or the conduction system and, thus, have more impact on chronotropic responses. In support of this notion, we observed that TCDD administration on D0 reduced isoproterenol-stimulated HR to a greater degree than when TCDD was administered on D5 (Fig. 5C). We did not, however, observe any changes in basal HR, suggesting that early developmental TCDD exposure does not alter sinoatrial pacemaker activity or that, through homeostatic processes, TCDD-exposed embryos can compensate for any effect on basal HR.
TCDD exposure could decrease ß-AR responsiveness by altering any one or more of a number of sites in the ß-AR-activated transduction pathway (schematized in Fig. 2). This pathway involves ligand-receptor activation of stimulatory GTP regulatory protein (Gs), in the case of ß1-AR, or Gs and inhibitory GTP regulatory protein (Gi), in the case of ß2-AR. Stimulation of Gs leads to activation of adenylyl cyclase (AC), accumulation of cAMP, stimulation of cAMP-dependent protein kinase A (PK-A), and phosphorylation of key proteins including L-type calcium channels to induce positive inotropic, chronotropic, and lusitropic (relaxant) responses in the heart. Our results show that TCDD exposure decreases the chronotropic responsiveness of the heart to ß-AR stimulation, but does not reduce responsiveness to agents affecting downstream events of the ß-AR. In fact, TCDD-exposed embryos were more responsive to forskolin, a direct activator of AC. Together, these observations suggest that TCDD may reduce ß-AR signaling by interactions at the level of the receptor to upstream of AC.
The TCDD-induced increased response to forskolin may be a compensatory mechanism. Sensitization of AC as part of a compensatory mechanism by which neuronal cells adapt to chronic inhibitory input by Gi is well known (for review see Johnston and Watts, 2003
). AC compensatory mechanisms have also been reported in the heart. Spontaneously hypertensive and diabetic rats have decreased cardiac ß-AR density and increased cardiac AC activity (Beenen et al., 1997
). With age, cardiac ß-AR responsiveness decreases, but expression of several cardiac transcripts whose gene products elevate intracellular cAMP levels are increased (Dobson et al., 2003
). In addition, sensitization of cardiac AC also occurs developmentally. Catalytic activity of AC markedly increased in 6-day-old rats pretreated with isoproterenol for 4 days (Giannuzzi et al., 1995
). It is not known whether TCDD exposure, directly or indirectly, increases cardiac AC activity. However, it is interesting to note that microarray analysis of livers of adult female rats exposed to TCDD (a single oral dose of 5 µg/kg, 2472 h exposure, or 100 ng/kg/day for 5 days per week for 13 weeks) increased the expression of adenylyl cyclase-associated protein-2 (CAP2) 60- to 160-fold above control animals (Ovando et al., 2004
). CAPs are known to be essential for adenylyl cyclase activation in yeast, but mammalian CAP2 has not been well characterized (for review see Hubberstey and Mottillo, 2002
).
TCDD does not decrease ß-AR signaling on D10 by decreasing ß1-AR mRNA at that time (Fig. 6); however, large variation in ß1-AR mRNA expression was observed among hearts of control embryos. This could be a result of preferential degradation of ß1-AR mRNA over the loading control (GAPDH) mRNA but no such variation was observed in the TCDD-exposed samples, which were collected and processed at the same time as the controls. Rather, we believe it could be a result of sampling at a time of developmentally changing ß1-AR gene expression. ß-AR density peaks on D79 and then decreases by more than 80% by D19 during normal embryonic chick heart development (Stewart et al., 1986
). This developmental reduction in ß-AR density is presumably regulated, at least in part, at the transcriptional level, as has been observed in rats (Wadhawan et al., 2003
). Thus the higher mean level and smaller degree of variation in cardiac ß1-AR mRNA expression in TCDD-exposed embryos may represent a TCDD-induced developmental delay in the downregulation of cardiac ß-ARs. The dynamic nature of cardiac ß-AR mRNA levels during embryonic development requires that a time-course be done to establish whether TCDD exposure alters the normal developmental changes in ß-AR mRNA expression.
In conclusion, early developmental exposure to TCDD (1) increases incidence of basal arrhythmias, (2) decreases chronotropic responsiveness to ß-AR stimulation, (3) enhances the negative chronotropic response to calcium channel blockade, (4) increases chronotropic responsiveness to AC activation, and (5) does not decrease ß1-AR mRNA levels. Given the importance of ß-AR signaling in normal cardiac development and function, as well as in the progression and severity of cardiovascular disease, it is important to continue to study the effects and elucidate the mechanisms of TCDD-induced ß-AR signal impairment.
| ACKNOWLEDGMENTS |
|---|
This work was supported by R15 ES011806 and Bates College.
| NOTES |
|---|
1 To whom correspondence should be addressed at Bates College, 44 Campus Ave., Lewiston, ME 042406018. Fax: (207) 786-8334. E-mail: rsommer{at}abacus.bates.edu
| REFERENCES |
|---|
|
|
|---|
Arguello, C., Alanis, J., and Valenzuela, B. (1988). The early development of the atrioventricular node and bundle of His in the embryonic chick heart. An electrophysiological and morphological study. Development 102, 623637.[Abstract]
Beenen, O. H., Batink, H. D., Pfaffendorf, M., and van Zwieten, P. A. (1997). Beta-adrenoceptors in the hearts of diabetic-hypertensive rats: Radioligand binding and functional experiments. Blood Press. 6(1), 4451.[Medline]
Brewster, D. W., Matsumura, F., and Akera, T. (1987). Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on guinea pig heart muscle. Toxicol. Appl. Pharmacol. 89(3), 408417.[CrossRef][Web of Science][Medline]
Canga, L., Levi, R., and Rifkind, A. B. (1988). Heart as a target organ in 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity: Decreased ß-adrenergic responsiveness and evidence of increased intracellular calcium. Proc. Natl. Acad. Sci. U.S.A. 85, 905909.
Canga, L., Paroli, L., Blanck, T. J. J., Silver, R. B., and Rifkind, A. B. (1993). 2,3,7,8-Tetrachlorodibenzo-p-dioxin increases cardiac myocyte intracellular calcium and progressively impairs ventricular contractile responses to isoproterenol and to calcium in chick embryo hearts. Mol. Pharmacol. 44, 11421151.[Abstract]
Cheung, M. O., Gilbert, E. F., and Peterson, R. E. (1981). Cardiovascular teratogenicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the chick embryo. Toxicol. Appl. Pharmacol. 61(2), 197204.[CrossRef][Web of Science][Medline]
Chuck, E. T., Freeman, D. M., Watanabe, M., and Rosenblum, D. S. (1997). Changing activation sequence in the embryonic chick heart: Implications for the development of the His-Purkinje system. Circ. Res. 81, 470476.
Communal, C., Singh, K., Pimentel, D. R., and Colucci, W. S. (1998). Norepinephrine stimulates apoptosis in adult rat ventricular myocytes by activation of the beta-adrenergic pathway. Circulation 98(13), 13291334.
Dalton, T. P., Kerzee, J. K., Wang, B., Miller, M., Dieter, M. Z., Lorenz, J. N., Shertzer, H. G., Nerbert, D. W., and Puga, A. (2001). Dioxin exposure is an environmental risk factor for ischemic heart disease. Cardiovasc. Toxicol. 1(4), 285298.[CrossRef][Medline]
DeHaan, R. L. (1989). Embryonic origin of the heartbeat. In The Heart (J. W. Hurst, R. C. Schlant, C. E. Rackley, E. H. Sonnenblick, and N. K. Wenger, Eds.), 7th ed., pp. 7276. McGraw-Hill, New York.
Dobson, J. G., Jr., Fray, J., Leonard, J. L., and Pratt, R. E. (2003). Molecular mechanisms of reduced ß-adrenergic signaling in the aged heart as revealed by genomic profiling. Physiol. Genomics 15, 142147.
Fan, L., Ovadia, M., Friedman, D. M., and Rifkind, A. B. (2000). Ventricular preexcitation sensitive to flecainide in late stage chick embryo ECGs: 2,3,7,8-Tetrachlorodibenzo-p-dixoin impairs inotropic but not chronotropic or dromotropic responses to isoproterenol and confers resistance to flecainide. Toxicol. Appl. Pharacol. 166, 4350.[CrossRef][Web of Science][Medline]
Fredriksson, J. M., Lindquist, J. M., Bronnikov, G. E., and Nedergaard, J. (2000). Norepinephrine induces vascular endothelial growth factor gene expression in brown adipocytes through a ß-adrenoreceptor/cAMP/protein kinase A pathway involving src but independently of erk1/2. J. Biol. Chem. 275(18), 1380213811.
Giannuzzi, C. E., Seidler, F. J., and Slotkin, T. A. (1995). Beta-adrenoceptor control of cardiac adenylyl cyclase during development: Agonist pretreatment in the neonate uniquely causes heterologous sensitization, not desensitization. Brain Res. 694(12), 271178.[CrossRef][Web of Science][Medline]
Greene, J. F., Hays, S., and Paustenbach, D. (1998). Basis for a proposed reference dose (RfD) for dioxin of 110 pg/kg-day: A weight of evidence evaluation of the human and animal studies. J. Toxicol. Environ. Health Part B Crit. Rev. 6(2), 115159.
Hermansky, S. J., Holcslaw, T. L., Murray, W. J., Markin, R. S., and Stohs, S. J. (1988). Biochemical and functional effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the heart of female rats. Toxicol. Appl. Pharmacol. 95(2), 175184.[CrossRef][Web of Science][Medline]
Hornung, M. W., Spitsbergen, J. M., and Peterson, R. E. (1999). 2,3,7,8-Tetrachlorodibenzo-p-dioxin alters cardiovascular and craniofacial development and function in sac fry of rainbow trout (Oncorhynchus mykiss). Toxicol. Sci. 47(1), 4051.
Hubberstey, A. V., and Mottillo, E. P. (2002). Cyclase-associated proteins: CAPacity for linking signal transduction and actin polymerization. FASEB J. 16, 487499.
Ivnitski, I., Elmaoued, R., and Walker, M. K. (2001). 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) inhibition of coronary development is preceded by a decrease in myocyte proliferation and an increase in cardiac apoptosis. Teratology 64, 201212.[CrossRef][Web of Science][Medline]
Jokinen, M. P., Walker, N. J., Brix, A. E., Sells, D. M., Haseman, J. K., and Nyska, A. (2003). Increase in cardiovascular pathology in female Sprague-Dawley rats following chronic treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin and 3,3'4,4',5-pentachlorobiphenyl. Cardiovasc. Toxicol. 3(4), 299310.[CrossRef][Medline]
Johnston, C. A., and Watts, V. J. (2003). Sensitization of adenylate cyclase: A general mechanism of neuroadaption to persistent activation of G
i/o-coupled receptor? Life Sci. 73, 29132925.[CrossRef][Web of Science][Medline]
Kim, J. S., Lim, H. S., Cho, S. I., Cheong, H. K., and Lim, M. K. (2003). Impact of Agent Orange exposure among Korean Vietnam veterans. Ind. Health 41(3), 149157.[Web of Science][Medline]
Ovando, B. J., Foxenberg, R. J., Vezina, C. M., and Olson, J. R. (2004). Hepatic gene expression profiling of HAHS and the identification of novel dioxin-responsive genes. Society of Toxicology 43rd Annual Meeting Supplement, Toxicol. Sci. 78(1-S) 95 (abstract).
Panabieres, F., Piechaczyk, M., Rainer, B., Dani, C., Fort, P., Riaad, S., Marty, L., Imbach, J. L., Jeanteur, P., and Blanchard, J. M. (1984). Complete nucleotide sequence of the messenger RNA coding for chicken muscle glyceraldehyde-3-phosphate dehydrogenase. Biochem. Biophys. Res. Commun. 118(3), 767773.[CrossRef][Web of Science][Medline]
Pesatori, A. C., Consonni, D., Bachetti, S., Zocchetti, C., Bonzini, M., Baccarelli, A., and Bertazzi, P. A. (2003). Short- and long-term morbidity and mortality in the population exposed to dioxin after the "Seveso accident." Ind. Health 41(3), 127138.[Web of Science][Medline]
Pesatori, A. C., Zocchetti, C., Guercilena, S., Consonni, D., Turrini, D., and Bertazzri, P. A. (1998). Dioxin exposure and nonmalignant health effects, a mortality study. Occup. Environ. Med. 55, 126131.
Port, D. J., and Bristow, M. R. (2001). Altered-adrenergic receptor gene regulation and signaling in chronic heart failure. J. Mol. Cell. Cardiol. 33, 887905.[CrossRef][Web of Science][Medline]
Riecke, K., Grimm, D., Shakibaei, M., Kossmehl, P., Schulze-Tanzil, G., Paul, M., and Stahlmann, R. (2002). Low doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin increase transforming growth factor? and cause mycardial fibrosis in marmosets (Callithrix jacchus). Arch. Toxicol. 76, 360366.[CrossRef][Web of Science][Medline]
Sambrano, G. R., Fraser, I., Han, H., Ni, Y., O'Connell, T., Yan, Z., and Stull, J. T. (2002). Navigating the signaling network in mouse cardiac myocytes. Nature 420, 712714.[CrossRef][Medline]
Stewart, D. E., Kirby, M. L., and Aronstam, R. S. (1986). Regulation of ß-adrenergic receptor density in the non-innervated and denervated embryonic chick heart. J. Mol. Cell. Cardiol. 18, 469475.[CrossRef][Web of Science][Medline]
Sugiyama, T., Miyazaki, H., Saito, K., Shimada, H., and Miyamoto, K.-I. (1996). Chick embryos as an alternative experimental animal for cardiovascular investigations: Stable recording of electrocardiogram of chick embryos in ovo on the 16th day of incubation. Toxicol. Appl. Pharmacol. 138, 262267.[CrossRef][Web of Science][Medline]
Sweeney, M. H., and Mocarelli, P. (2000). Human health effects after exposure to 2,3,7,8-TCDD. Food Addit. Contam. 17(4), 303316.[CrossRef][Web of Science][Medline]
Tseng, Y. T., Kopel, R., Stabila, J. P., McGonnigal, B. G., Nguyen, T. T., Gruppuso, P. A., and Padbury, J. F. (2001). Beta-adrenergic receptors (betaAR) regulate cardiomyocyte proliferation during early postnatal life. FASEB J. 15(11), 19211926.
Vena, J., Boffetta, P., Bechner, H., Benn, T., Bueno-de-Mesquita, H. B., Coggon, D., Colin, D., Flesch-Janys, D., Green, L., Kauppinen, T., et al. (1998). Exposure to dioxin and nonneioplastic mortality in the expanded IARC international cohort study of phenoxy herbicide and chlorophenol production workers and sprayers. Environ. Health Perspect. 106 (Suppl. 2), 645653.
Wadhawan, R., Tseng, Y. T., Stabila, J., McGonnigal, B., Sarkar, S., and Padbury, J. (2003). Regulation of cardiac beta 1-adrenergic receptor transcription during the developmental transition. Am. J. Physiol. Heart Circ. Physiol. 284(6), H2146H2152.
Walker, M. K., and Catron, T. F. (2000). Characterization of cardiotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin and related chemicals during early chick embryo development. Toxicol. Appl. Pharmacol. 167, 210221.[CrossRef][Web of Science][Medline]
Walker, M. K., Johnson, C. D., Tadesse, M., Ramos, K. S., Steele, I. D., and Thackaberry, E. A. (2003). Dioxin induces growth arrest and reduces cell cycle gene expression in the fetal murine heart. Society of Toxicology 42nd Annual Meeting Supplement, Toxicol. Sci. 72(S-1) 1124 (abstract).
Walker, M. K., Pollenz, R. S., and Smith, S. M. (1997). Expression of the arylhydrocarbon receptor (AhR) and AhR nuclear translocator during chick cardiogenesis is consistent with 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced heart defects. Toxicol. Appl. Pharmacol. 143, 407419.[CrossRef][Web of Science][Medline]
Wang, J., and Ross, E. M. (1995). The carboxyl-terminal anchorage domain of the turkey ß1adrenergic receptor in encoded by an alternatively spliced exon. J. Biol. Chem. 270(12), 64886495.
Xiao, R.-P. (2001). ß-Adrenergic signaling in the heart: Dual coupling of the ß2-adrenergic receptor to Gs and Gi proteins. Sci. STKE 104, RE15.
Zhu, W. Z., Wang, S. Q., Chakir, K., Yang, D., Zhang, T., Brown, J. H., Devic, E., Kobilka, B. K., Cheng, H., and Xiao, R. P. (2003). Linkage of beta 1-adrenergic stimilation to apoptic heart cell death through protein kinase A-independent activation of Ca2+/calmodulin kinase II. J. Clin. Invest. 111, 617625.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Tonack, K. Kind, J. G. Thompson, A. M. Wobus, B. Fischer, and A. N. Santos Dioxin Affects Glucose Transport via the Arylhydrocarbon Receptor Signal Cascade in Pluripotent Embryonic Carcinoma Cells Endocrinology, December 1, 2007; 148(12): 5902 - 5912. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Carney, J. Chen, C. G. Burns, K. M. Xiong, R. E. Peterson, and W. Heideman Aryl Hydrocarbon Receptor Activation Produces Heart-Specific Transcriptional and Toxic Responses in Developing Zebrafish Mol. Pharmacol., August 1, 2006; 70(2): 549 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Thackaberry, B. A. Nunez, I. D. Ivnitski-Steele, M. Friggins, and M. K. Walker Effect of 2,3,7,8-Tetrachlorodibenzo-p-Dioxin on Murine Heart Development: Alteration in Fetal and Postnatal Cardiac Growth, and Postnatal Cardiac Chronotropy Toxicol. Sci., November 1, 2005; 88(1): 242 - 249. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








