Skip Navigation


ToxSci Advance Access originally published online on March 23, 2005
Toxicological Sciences 2005 85(2):906-915; doi:10.1093/toxsci/kfi155
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
85/2/906    most recent
kfi155v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Gurel, V.
Right arrow Articles by Sens, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gurel, V.
Right arrow Articles by Sens, M. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Toxicological Sciences vol. 85 no. 2 © The Author 2005. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org

Post-Transcriptional Regulation of Metallothionein Isoform 1 and 2 Expression in the Human Breast and the MCF-10A Cell Line

Volkan Gurel*, Donald A. Sens{dagger}, Seema Somji*, Scott H. Garrett*, Tim Weiland* and Mary Ann Sens*,1

* Department of Pathology School of Medicine and Health Sciences, University of North Dakota, Grand Forks, North Dakota 58202; {dagger} Department of Surgery, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, North Dakota 58202

1 To whom correspondence should be addressed at Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, 501 N. Columbia Road, Grand Forks, ND 58202–9037. Fax: 701–777–3108. E-mail: msens{at}medicine.nodak.edu.

Received January 19, 2005; accepted March 17, 2005


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Studies have shown, using immunohistochemical staining, that the MT-1 and MT-2 proteins (MT-1/2) are overexpressed in a substantial subset of ductal breast cancers, that overexpression occurs early in the disease process, and that this overexpression is indicative of a poor prognosis. Normal ductal breast epithelium fails to immunostain for the MT-1/2 protein, whereas the myoepithelial cells of the ducts stain intensely. There is no information regarding the expression of the mRNAs for the eight active MT-1 and MT-2 genes in normal breast duct epithelium. Microdissection of normal breast samples was used to obtain total RNA from enriched populations of ductal epithelium and myoepithelium. Analysis by reverse-transcription polymerase chain reaction (RT-PCR) demonstrated that the identity of the MT isoform-specific genes expressed (MT-2A and MT-1X) and their relative levels of expression were similar between the myoepithelial and ductal components. These findings indicate that the ductal and myoepithelial components express similar amounts of MT-2A and MT-1X mRNAs, but that they have distinctly different expression of the MT-1/2 protein. Confluent cultures of MCF-10A breast epithelial cells were exposed to Cd+2 to test for evidence of post-transcriptional regulation of MT-1/2 protein accumulation in ductal epithelium. It was demonstrated that Cd+2 elicited only a marginal induction of MT-1E, MT-1X, or MT-2A mRNAs, whereas, there was a marked increase in MT-1/2 protein, reaching levels of 6% of total cell protein under conditions of extended exposure. This study suggests that the mechanism underlying the finding of increased MT-1/2 protein expression in ductal breast cancer may involve, to some degree, the post-transcriptional regulation of MT-1/2 protein expression.

Key Words: metallothionein; breast cancer; cadmium; MCF-10A; ductal epithelium; myoepithelium; microdissection.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Evidence continues to accumulate that the heavy metal and environmental pollutant cadmium plays a role in the etiology of breast cancer. An epidemiological study conducted on mortality records from 24 states between 1984 and 1989, coded for occupation and industry, suggested that metals and metal-related exposures were associated with breast cancer risk (Cantor et al., 1995Go). In experiments using the MCF-7 estrogen-responsive breast cancer cell line, it was shown that several metal ions demonstrated estrogenic activity (Martin et al., 2003Go). These studies showed that divalent cadmium, copper, cobalt, nickel, lead, mercury, tin, and chromium ions activated responses mediated by the alpha isoform of the estrogen receptor ({alpha}ER). It was also shown that the metalloestrogen-induced activation of the {alpha}ER was greater than that produced by the phytoestrogens and the selective estrogen receptor modulators used for the treatment of hormone-dependent cancers and estrogen deficiencies. For cadmium, these cell culture–based findings were extended to an examination in the whole animal (Johnson et al., 2003Go). It was shown that when female rats were exposed to an environmentally relevant dose of cadmium, there was an induction of several well-characterized estrogenic responses. These included increased uterine weights, hyperplasia and hypertrophy of the endometrial lining, induction of uterine progesterone receptor and complement C3 gene expression, increased mammary epithelial density, and induction of milk protein synthesis in the mammary gland. Both cadmium chloride and 17ß-estradiol gave comparable responses, and the antiestrogen ICI-182,780 inhibited cadmium chloride–induced activities. Moreover, in utero exposure to cadmium produced prototypical endocrine disruptor–like responses, as noted by altered mammary gland development and onset of puberty in female offspring.

The metallothioneins (MT) are a family of low molecular weight (6–7 kDa), cysteine-rich proteins that are believed to play an important role in the homeostasis of essential metals such as Zn+2 and Cu+2. The MT-1 and MT-2 family members have been extensively studied and are widely recognized for their ability to attenuate Cd+2-induced effects through binding and sequestering of the metal within the cell (Andrews, 2000Go; Cherian et al., 1994Go; Hamer, 1986Go; Kägi, 1993Go). The MT-1 and MT-2 isoforms exhibit a ubiquitous pattern of tissue expression upon metal challenge and are highly inducible by a large number of stimuli (Andrews, 2000Go; Hamer, 1986Go; Kägi, 1993Go; Kägi and Hunziker, 1989Go). The expression of the MT-1 and MT-2 proteins has been routinely visualized immunohistochemically using antibodies raised against the E9 epitope, which is conserved in both the MT-1 and MT-2 isoform proteins (Jasani and Schmid, 1997Go). Studies employing this antibody have shown that only the outer myoepithelial cells of the bilayered ductales/acini are immunoreactive for the MT-1/2 protein, with very strong staining localized to both the nucleus and the cytoplasm (Bier et al., 1994Go; Fresno et al., 1993Go; Jin et al., 2001Go). Only very rarely was an immunoreactive cell profile found in the epithelial cells lining the large ducts. In contrast, a significant number of ductal breast cancers exhibit MT-1/2 immunoreactivity within the malignant ductal epithelium (Bier et al., 1994Go; Douglas-Jones et al., 1995Go; Fresno et al., 1993Go; Goulding et al., 1995Go; Haerslev et al., 1994Go; Ioachim et al., 1999Go; Oyama et al., 1996Go; Schmid et al., 1993Go).

These observations, in conjunction with the findings that Cd+2 acts as an estrogen mimic, define a need to further examine MT-1/2 expression in the normal and malignant breast epithelial cell. To date, the expression of the MT-1 and MT-2 isoform–specific mRNAs have not been determined in the normal human breast epithelial cell. Likewise, no cell culture model of the normal human breast epithelial cell has been shown to retain the in vivo expression patterns of MT-1 and MT-2 mRNA and protein. The goals of the present study were to determine the expression of the MT-1 and MT-2 isoform–specific mRNAs in the ductal epithelium of the human breast; to determine if the MCF-10A cell line recapitulates the pattern of MT-1 and MT-2 expression found in the human breast duct epithelial cell; and to determine the effect on MT-1 and MT-2 expression when the MCF-10A cell line is exposed to Cd+2.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human breast tissue specimens.
Total RNA and protein were prepared from four control specimens of human breast that were obtained following elective reduction surgeries. The specimens were obtained after examination in surgical pathology, and the protocol for tissue acquisition was approved by the Institutional Review Board for Human Research. The tissue source was anonymous and no clinical data were recorded by the laboratory. The specimens were dissected free from attached fat and snap frozen under liquid nitrogen. For the immuohistochemical localization of MT-1/2 protein and the isolation of total RNA from microdissected breast duct cells, paraffin blocks of five specimens of normal breast were obtained from the pathology archives. The use of paraffin-embedded archival tissue was also approved by the Institutional Review Board for Human Research.

Immunohistochemical localization of MT-1/2.
The specimens of normal human breast obtained from the pathology archives were routinely fixed in neutral buffered formalin for 16–18 h. The tissue was transferred to 70% ethanol and dehydrated in 100% ethanol. The dehydrated tissue was cleared in xylene, infiltrated, and embedded in paraffin. Serial sections were cut at 3–5 µm for use in immunohistochemical protocols. Prior to immunostaining, sections were pretreated in a microwave at 700W in 10 mM citrate buffer (pH 6.0) for 5 min. Sections were allowed to cool for 5 min at room temperature, microwaved again for 5 min, and slowly immersed into distilled water. Metallothionein was localized using a monoclonal mouse anti-horse MT-1, MT-2 antibody (DAKO-MT, E9, in 0.05M Tris/HCl, 15 mM NaN3, pH 7.5, 1% BSA, DAKO Corporation, Carpinteria, CA) as the primary antibody. The primary anti-MT antibody was localized using the avidin-biotin-peroxidase complex (ABC) procedure (Vectastain Kit, Vector Laboratories, Burlingame, CA) with diaminobenzidine used for visualization (Stable DAB, Research Genetics, Huntsville, AL). Slides were rinsed in distilled water, dehydrated in graded ethanols, cleared in xylene, and coverslipped. The positive control was the demonstration of MT staining localized to the proximal tubule in human archival kidney specimens. The negative control consisted of replacement of primary antibody from the immunohistochemical ABC sequence with non-immune serum.

RNA isolation and RT-PCR from fresh tissues and cell lines.
Breast tissue was ground to a powder under liquid nitrogen. The MCF-10A cell line was grown in plastic flasks and plates. Total RNA was isolated from the cultured cells and powdered tissue according to the protocol supplied with TRI REAGENT (Molecular Research Center, Inc., Cincinnati, OH) as described previously (Garrett et al., 2000Go). The concentration and purity of the RNA samples were determined using spectrophotometer scan in the ultraviolet (UV) region and ethidium bromide (EtBr) visualization of intact 18S and 28S RNA bands after agarose gel electrophoresis. Total RNA (0.5 µg) was reverse transcribed (RT) with MuLV reverse transcriptase (50 U) in 10x polymerase chain reaction (PCR) buffer (500 mM KCl and 100 mM Tris-HCl, pH 8.3), 5 mM MgCl2, 20 U RNase inhibitor, 1 mM each of the dNTPs, and 2.5 µM random hexanucleotide primers. The samples underwent RT for 20 min at 42°C, followed by a 5-min denaturation step at 99°C in a DNA thermocycler (Gene Amp 9700, Applied Biosystems, Foster City, CA). The RT product was used for PCR amplification with the AmpliTaq DNA polymerase enzyme (2.5 U) and the specific upstream and downstream primers at a concentration of 0.1 µM each. The primers developed for analysis of each of the active MT genes have been previously described (Garrett et al., 1998aGo, 1998bGo). The thermocycler was programmed to cycle at 95°C for a 2-min initial step, at 95°C for 30 s, and at 68°C for 30 s. Controls for each PCR included a no-template control where, water was added instead of the RNA, and a no-RT control, where water was added instead of the enzyme. Samples were removed at 25, 30, 35, and 40 PCR cycles to ensure that the reaction remained in the linear region. The final PCR products were electrophoresed on 2% agarose gels containing EtBr along with DNA markers. The intensity (integrated optical density, IOD) of the PCR product bands was determined on a Dell workstation configured with Kontron KS 400 image-analysis software.

Microdissection of tissue from paraffin blocks, RNA isolation, and real time RT-PCR.
The procedures for laser capture microdissection of tissue from paraffin blocks and micro RNA isolation has been described previously (Garrett et al., 2000Go). Briefly, 5-µm-thick sections were cut from formalin-fixed, paraffin-embedded tissue blocks with a microtome and mounted on plain glass slides. After microdissection, total RNA was extracted from samples with the micro RNA isolation kit (Stratagene, Catalog No: 200344). The expression of the MT-1X, MT-1E, MT-2A, and ß-actin mRNAs were determined using real-time PCR. Briefly, one-half of the total RNA obtained from the microdissection was reverse transcribed in a 20-µl reaction by the iScript cDNA synthesis kit (Bio-Rad Laboratories Hercules, CA). The reaction was incubated for 5 min at 25°C, followed by 30 min at 42°C and 5 min at 85°C. Real-time PCR was performed with the iCycler iQ Real-Time detection system (Bio-Rad Laboratories) utilizing the iQ SYBR Green Supermix kit (Bio-Rad Laboratories). Amplification was monitored by SYBR Green fluorescence and compared to that of a standard curve of the PCR product cloned into pcDNA3.1/hygro (+) and linearized with Fsp I. The PCR product was verified by sequencing. The reaction conditions consisted of 2 µl of cDNA and 0.2 µM primers in a final volume of 20 µl of supermix, and the cycling parameters consisted of annealing and extension at 65°C for 45 s and denaturation at 95°C for 30 s. The primers for MT-1X, MT-1E, and ß-actin were as described above, and those for the MT-2A gene product were upper primer GCGTGCAACCTGTCCCGACTC and lower primer TGGGATCCATGGCGTGCT; yielding a product size of 47 base pairs.

Cell culture.
The MCF-10A cell line was obtained from the American Type Culture Collection and grown in a 1:1 mixture of Ham's F-12 medium and Dulbecco's minimum essential medium (DMEM) supplemented with 5% (v/v) fetal calf serum, 10 µg/ml insulin, 0.5 µg/ml hydrocortisone, 20 ng/ml epidermal growth factor, and 0.1 µg/ml cholera toxin. The cells were fed fresh growth medium every 3 days, and at confluence (normally 6–12 days post-subculture), the cells were subcultured at a 1:10 ratio using trypsin–ethylenediamine tetraacetic acid (EDTA; 0.25%, 1 mM). For use in experimental protocols, cells were subcultured at a 1:10 ratio, allowed to reach confluence (12 days after subculture), and then used in the described experiments. Preliminary experiments were performed to determine the approximate concentrations of CdCl2 that would result in MCF-10A cell toxicity over a 16-day period of exposure. From this preliminary determination, three concentrations of CdCl2 (7, 15, and 30 µM) were chosen for a short-term exposure of 48 h, and four concentrations (3, 7, 15, and 30 µM) were used for an extended exposure of 16 days. These concentrations were chosen such that over a 16-day time course, one concentration would result in no cell death and another would result in appreciable cell death early in the time course. The viability of confluent cell monolayers was determined by the automated counting of 4', 6-diamidino-2-phenylindole (DAPI)–stained nuclei as described previously by this laboratory (Garrett et al., 1998aGo). Triplicate cultures were analyzed for each time point and concentration.

MT protein determination.
The immunoblot protocol used for the determination of the co-expressed levels of the MT-1 and MT-2 protein in cell lysates has been described previously by this laboratory (Garrett et al., 1998aGo, 2000Go). For cultured cells, the cells were rinsed twice with phosphate buffered saline (PBS) and harvested in 10 mM Tris-HCl (pH 8.0) containing 1 mM dithiothreitol. For tissue, the samples were ground to a powder under liquid nitrogen, harvested in 10 mM Tris-HCl (pH 8.0) containing 1 mM dithiothreitol, and homogenized. The cells were lysed by two cycles of freezing and thawing under liquid nitrogen and a 37°C water bath. The lysates were centrifuged in a microfuge and the supernatants were stored at –70°C. The MT-1 and MT-2 proteins were detected by immunoblotting using a mouse anti-horse antibody (DAKO-MT, E9) as the primary antibody. This antibody detects both the MT-1 and MT-2 isoforms, and, in this report, the product detected is referred to as "MT-1/2." Using image analysis software (KS 400, Kontron), MT-1/2 protein was quantified by comparing the optical density of the sample dots to that of the standard MT curve. Rabbit liver Cd/Zn metallothionein-1 was applied to each blot to generate standard curves. This assay has detection limits in the range of 0.1–0.5 ng MT-1/2 per microgram of total protein.

Statistical analysis.
All experiments were performed in triplicate except as noted. Statistical analyses were performed with Systat software, using separate variance t-tests and analysis of variance (ANOVA) with Tukey post hoc testing. Unless otherwise stated, the level of significance was 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Basal Expression of MT-1 and MT-2 mRNA and Protein in Human Breast Tissue
With a total RNA input of 500 ng and 40 cycles of PCR, it was demonstrated that there was no expression of mRNA representing the MT-1A, MT-1B, MT-1F, MT-1G, or MT-1H genes in all four samples of human breast tissue (data not shown). With an identical total RNA input, it was demonstrated that mRNAs for the MT-1X, MT-2A, and g3pdh genes were expressed in all four samples of human breast tissue at 30, 35, and 30 PCR cycles, respectively (Fig. 1). Evidence of MT-1E mRNA was demonstrated in total RNA from two of four breast samples after 40 cycles of PCR (Fig. 1). The level of MT-1/2 protein in each of the human breast samples was also determined and found to be 1.1 ± 0.3 ng, 1.2 ± 0.3 ng, 1.6 ± 0.4 ng, and 1.8 ± 0.3 ng of MT-1/2 protein/µg total cell protein.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 1. A representative gel showing expression of MT-1E, MT-1X, and MT-2A mRNA in total RNA prepared from normal human breast tissue (Whole Tissue), microdissected ductal epithelial cells (Ductal), and microdissected myoepithelial cells (Myoepithelial). Total RNA from normal breast tissue was prepared from four independent samples, and reverse-transcriptase–polymerase chain reaction (RT-PCR) was performed using a 500 ng total RNA input. The mRNAs for the MT-1X, MT-2A, and g3pdh (GAP) genes were expressed in all four samples of human breast tissue at 30, 35, and 30 PCR cycles, respectively. The MT-1E mRNA was found in only two of four samples at 40 cycles of PCR. Total RNA samples representing myoepthelial and ductal cells were obtained after microdissection of four archival specimens of formalin-fixed, paraffin-embedded samples of normal human breast. These samples demonstrated the expression of MT-1X, MT-2A, and ß-actin mRNAs after 40 cycles of PCR in all four total RNA samples, regardless of origin from the ductal or myoepithelial cell fraction. Only one of eight total RNA preparations showed the expression of MT-1E mRNA, and this was a faint band after 40 cycles of PCR. Negative controls for the RT-PCR reactions included a non-template control where water was added instead of the RNA and no-reverse-transcriptase control where water was added instead of the enzyme.

 
Basal Expression of MT-1E, MT-1X, and MT-2A mRNA in Ductal and Myoepithelial Cells of the Human Breast
For this analysis, five specimens of formalin-fixed, paraffin-embedded normal breast tissue were obtained from the pathology archives. The initial step in this analysis was to confirm the previously published studies, which demonstrated that the expression of the MT-1/2 protein was confined to the cytoplasm and nucleus of the myoepithelial cells of the human breast. The results of this immunohistochemical analysis confirmed the previously published observations that immunoreactivity for the MT-1/2 protein was confined to the myoepithelial cells of the human breast (Fig. 2A and 2B). The technique of laser capture microdissection was then employed to isolate highly enriched fractions of the ductal and myoepithelial cell components from each of the five samples (Fig. 2C, 2D, 2E). After separation of the two cell types, total RNA was prepared and analyzed for the expression of the MT-1E, MT-1X, MT-2A, and ß-actin mRNAs using semiquantitative RT-PCR. A primer pair for the ß-actin housekeeping gene was used in this analysis instead of the g3pdh housekeeping gene. The ß-actin primer pair was added to the analysis because the PCR product is similar in size to the MT reaction products. The g3pdh PCR product is much larger than the MT isoform mRNA reaction products, and it has been reported that total RNA from formalin-fixed, paraffin-embedded tissue yields more fragmented RNA than fresh tissue (Rook et al., 2004Go). This controls for the possibility that the size difference between g3pdh and MT PCR products could affect the amounts of MT mRNA expression. Four of the five samples yielded both ductal and myoepithelial total RNA preparations that were shown to express the ß-actin gene at 40 cycles of PCR (Fig. 1). Further analysis of these samples for expression of MT-1E, MT-1X, and MT-2A mRNAs demonstrated the expression of MT-1X and MT-2A mRNAs at 40 cycles of PCR in all four samples, regardless of origination from the ductal or myoepithelial cell fraction (Fig. 1). A semi-qualitative analysis of relative expression suggested equal expression of these two isoforms (MT-1X and MT-2A) between the ductal and myoepithelial cell components (data not shown). A faint reaction product representing MT-1E mRNA was found in only one of the eight microdissected samples at 40 cycles of PCR (data not shown), confirming the lower comparative abundance of MT-1E mRNA in relation to MT-1X and MT-2A mRNAs that was noted in total RNA preparations from fresh tissue.



View larger version (91K):
[in this window]
[in a new window]
 
FIG. 2. Immunohistochemical localization of MT-1/2 protein in normal breast and microdissection of the ductal and myoepithelial cell components. A. Hematoxylin and eosin profile of the human breast duct. B. Immunostaining for the MT-1/2 protein using the E-9 antibody at a 1:200 dilution. The arrows identify intense staining of the myoepithelium, and arrowheads show the lack of staining of ductal epithelium. C. A profile of a representative breast duct before laser capture microdissection. D. The same profile after isolation of the ductal epithelium. E. The profile shown in panel D after removal of the myoepithelium. The profile shown to illustrate the microdissection is only very lightly stained with hematoxylin and eosin (H&E).

 
The finding that ductal and myoepithelial cells had similar semi-qualitative expression of the MT-1X and MT-2A mRNAs was unexpected based on the previously shown differential immunostaining of the MT-1/2 protein between ductal and myoepithelial cells. To further confirm this observation, real-time PCR was employed to quantify the expression of the MT-1X and MT-2A mRNAs using total RNA isolated from microdissected ductal and myoepithelial cells. For this analysis, the expression of MT-2A and ß-actin mRNAs, and of MT-1X and ß-actin mRNAs, was determined in total RNA isolated from mircodissected ductal and myoepithelial cell components of four independent samples of formalin-fixed, paraffin-embedded human breast tissue. The microdissection protocol was biased in the direction of obtaining a pure population of ductal epithelial cells, because this cell type showed no immunostaining for the MT-1/2 protein. This bias was achieved by means of a two-step process. The first microdissection removed the outer 2/3 of the ductal epithelial cells with a bias toward avoidance of the underlying myoepithelial cells. Total RNA was isolated from this microdissection. The second step was the microdissection and isolation of total RNA from the remaining ductal epithelial cells and the underlying myoepithelial cells. With this approach, the first microdissection is highly enriched to contain only ductal epithelium, while the second isolation is enriched for myoepithelium, and yet would contain a significant contamination with total RNA from the duct cells. The results of this analysis confirmed that the expression levels of the MT-2A and MT-1X mRNAs were similar between the ductal and myoepithelial cells (Table 1). For all four samples, the levels of the MT-2A and MT-1X mRNAs in the ductal and myoepithelial cell components were expressed relative to the ß-actin housekeeping mRNA. Relative expression was used because the concentrations of total RNA isolated from the microdissections are below the level that can be quantified, precluding normalization of the PCR results to the total RNA inputs into the reaction mixtures. The relative expression of the MT-2A mRNA between the ductal and myoepithelial cell components from the four samples was 0.39 MT-2A transcripts in the ductal cells and 0.46 transcripts in the myoepithelial cells. The relative expression of the MT-1X mRNA was 1.48 transcripts in the ductal cells and 1.72 transcripts in the myoepithelial cells. These results show that both the ductal and the myoepithelial cells of the human breast have appreciable expression of the MT-2A and MT-1X mRNAs, and that there is no significant difference (p > .05) in the levels of either MT-2A or MT-1X mRNA between these cell types. The levels of MT-1/2 protein cannot be determined on formalin-fixed tissue.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Relative Expression of MT-2A and MT-1X mRNA in Breast Duct and Myoepithelial Cells

 
Basal Expression of MT-1 and MT-2 mRNA and Protein in MCF-10A Cells
Total RNA and protein were isolated from confluent MCF-10A cells and used to determine the basal expression of MT-1/2 protein and the MT isoform–specific mRNAs relative to the g3pdh housekeeping gene. With a total RNA input of 500 ng and 40 cycles of PCR, it was demonstrated that there was no expression of mRNA representing the MT-1A, MT-1B, MT-1F, MT-1G, or MT-1H genes in MCF-10A cells (Fig. 3). In contrast, mRNAs representing the MT-1E, MT-1X, MT-2A, and g3pdh genes were expressed in MCF-10A cells using identical total RNA inputs after 30, 22, 25, and 30 cycles of PCR, respectively (Fig. 3). Immunoblotting with an MT antibody that recognizes both the MT-1 and MT-2 isoforms, but not the other isoforms of MT, demonstrated that the MCF-10A cells expressed 3.3 ± 0.6 ng (n = 6) of MT-1/2 protein per microgram of total cell protein.



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 3. Expression of MT-1A, MT-1B, MT-1E, MT-1F, MT-1G, MT-1H, MT-1X, MT-2A, and g3pdh mRNA in MCF-10A cells. No expression was detected at 40 cycles of PCR and a total RNA input of 500 ng for the MT-1A, MT-1B, MT-1F, MT-1G, and MT-1H genes. Using identical reaction conditions, reaction products for MT-1E, MT-1X, MT-2A, and g3pdh (GAP) mRNAs were detected at 30, 22, 25, and 30 cycles of PCR, respectively. Negative controls for the RT-PCR reactions included a non-template control, where water was added instead of the RNA, and a no-reverse-transcriptase control, where water was added instead of the enzyme.

 
Expression of MT-1/2 Protein and MT-Isoform–Specific mRNAs When MCF-10A Cells Are Exposed to Lethal and Sublethal Levels of Cd+2
An analysis of MT isoform-specific mRNA expression within the in situ ductal epithelium of the human breast demonstrated the expression of the MT-2A and MT-1X isoforms at levels comparable to the ß-actin housekeeping gene. In contrast, immunostaining with an MT-1/2–specific antibody demonstrated no expression of the MT-1/2 protein within the ductal epithelial cells. These results suggested that the in situ normal breast ductal epithelial cells expressed abundant amounts of MT mRNA, but only a very modest amount of MT-1/2 protein. A similar pattern of MT expression was shown in the MCF-10A cell line. Because Cd+2 is an inducer of MT gene transcription, and because it can bind and stabilize the MT-1/2 protein in most mammalian cell systems, studies were designed to determine what effect Cd+2 exposure would have on the accumulation of MT mRNA and protein in the MCF-10A cells. This was accomplished by determining the expression of the MT-1 and MT-2 isoform–specific mRNAs and MT-1/2 protein when the MCF-10A cells were exposed to CdCl2 over both a short-term (48-h) and an extended (16-day) time course. Four concentrations of CdCl2 were used: 3.0 µM, which produced no cell death over the 16-day time course; intermediate concentrations of 7.0 µM and 15.0 µM, which produced approximately 50% cell death over the 16-day time course; and, 30 µM, which produced significant levels of cell death midway in the 16-day time course (Fig. 4). The respective mRNAs and MT protein were determined at 4, 8, 12, 24, 36, and 48 h for the short-term time course and at 1, 2, 4, 7, 10, 13, and 16 days for the extended time course. The expression of MT mRNA was normalized to a control value of 1.0 for data presentation. For each of the respective MT mRNAs analyzed, there was no significant difference in the expression levels of the control cells over the respective 48-h and 16-day time courses (data not shown). The RT-PCR analysis of MT-isoform–specific MT-1 and MT-2 mRNAs at 500 ng total RNA inputs and 40 reaction cycles demonstrated no expression of the MT-1A, MT-1B, MT-1F, MT-1G, or MT-1H mRNA at any point in the time courses (data not shown).



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 4. Viability of confluent MCF-10A cells exposed to CdCl2. The MCF-10A cells were exposed to: 3 µM ({square}); 7 µM ({blacktriangleup}); 15 µM ({circ}); and, 30 µM ({blacksquare}) of CdCl2 for 16 days. Cell viability was determined by automated counting of DAPI-stained nuclei, and all determinations were in triplicate. Twenty fields were counter per time point. Values shown are the percentage of the mean cell numbers at each time point divided by the mean cell numbers of the control cells for each triplicate determination.

 
Exposure of the MCF-10A cells to 7, 15, or 30 µM Cd+2 for 48 h demonstrated that there was no significant increase in MT-1X or MT-2 mRNA and a significant increase in MT-1E mRNA only at 3 of 21 points of the acute time course (Fig. 5A, 5B, 5C). In contrast, the corresponding analysis of MT-1/2 protein expression demonstrated that, after 24 h of Cd+2 exposure, there were significant increases in MT-1/2 protein at all three levels of Cd+2 exposure (Fig. 5D). The level of MT-1/2 protein showed a significant increase with increasing time of exposure between 24 and 48 h, but there was not a dose response as judged by there being no significant difference (p > .05) in accumulation due to the level of exposure to Cd+2 at the 24-, 36-, or 48-h time points.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 5. Expression of MT-1E, MT-1X, MT-2A mRNA, and MT-1/2 protein in MCF-10A cells during short-term exposure to CdCl2. The MCF-10A cells were exposed to 7 µM (gray bars), 15 µM (white bars), and 30 µM (black bars) CdCl2 for 48 h. The expression of MT-1E, MT-X, and MT-2A mRNA is shown relative to that of the g3pdh housekeeping gene and then normalized to a control value of 1.0. The expression of MT-1/2 protein is shown relative to the control levels in MCF-10A cells not exposed to CdCl2 (angular cross-hatched bars). The determinations were performed in triplicate. The asterisk indicates a significant difference (at least p < .05) compared to control.

 
Exposure of the MCF-10A cells to 3 µM Cd+2 for 16 days demonstrated no increase in the expression of mRNAs for the MT-2A gene and a single increase on days 13 and 16 for MT-1X and –1E, respectively (Fig. 6A, 6B, 6C). An increase in exposure level to 7 µM Cd+2 for 16 days produced an increase in MT-1X on day 7 and a modest, but significant increase in MT-2A mRNA on days 13 and 16. The MT-1E mRNA was induced on day 2, 4, and 10 of the time course at this concentration. A further increase in exposure level to 15 µM Cd+2 resulted in a significant increase in MT-1X on day 2; MT-2A on days 10, 13, and 16; and, MT-1E on days 4 and 13. These increases were approximately twofold over control levels. The highest level of Cd+2 exposure (30 µM), which was 100% lethal to the cells by day 7 of the time course, produced no significant increase in MT-2A mRNA and a significant increase on days 2 and 4 for both MT-1E and MT-1X. There was no evidence of a dose response between mRNA expression of the MT-2A, MT-1X, or MT-1E genes and Cd+2 level. In contrast, the level of MT-1/2 protein was significantly increased at all levels of Cd+2 exposure by day 4 of the time course (Fig. 6D). The MT-1/2 protein level at the lowest level of Cd+2 exposure, a level that produced no cell lethality over the 16-day time course, increased from 4 to 37 ng/µg total protein by day 16 of exposure. There was an incremental increase in MT-1/2 protein at day 4, 7, and 10, with a plateau at days 10 through 16. A similar pattern of MT-1/2 protein accumulation occurred at the 7- and 15-µM levels of Cd+2 exposure, except the increase and plateau occurred earlier in the time course (days 2 and 7, respectively) and levels of accumulation were approximately twofold higher (5–6% of total cell protein). There was no clear evidence of a dose response between MT-1/2 protein expression and level of Cd+2 exposure.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 6. Expression of MT-1E, MT-1X, MT-2A mRNA, and MT-1/2 protein in MCF-10A cells during a 16-day exposure to CdCl2. The MCF-10A cells were exposed to: 3 µM (straight cross-hatched open bars); 7 µM (gray bars); 15 µM (white bars); and, 30 µM (black bars) CdCl2 for 16 days. The expression of MT-1E, MT-1X, and MT-2A mRNA is shown relative to that of the g3pdh housekeeping gene, normalized to a control value of 1.0. The expression of MT-1/2 protein is shown relative to the control levels in MCF-10A cells not exposed to CdCl2 (angular cross-hatched bars). The determinations were performed in triplicate. The asterisk indicates a significant difference (at least p < .05) compared to control.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
There is compelling evidence that the MT-1/2 proteins are overexpressed in a substantial subset of ductal breast cancers, that overexpression occurs early in the disease, and that it is indicative of a poor prognosis. An immunohistochemical analysis of MT-1/2 expression in 86 cases of paraffin-embedded primary breast carcinomas, MT-1/2 overexpression was found in the invasive components of 7 of 32 pT1 invasive ductal carcinomas and 17 of 28 pT2 invasive ductal carcinomas (Schmid et al., 1993Go). Furthermore, 14 of the 17 pT2 and 2 of the 7 pT1 invasive ductal carcinomas with MT-1/2 overexpression developed metastases during follow-up, and all had poor prognostic outcome. In contrast, only 3 of 11 pT2 and none of the 25 pT1 cases without MT-1/2 overexpression followed a poor clinical course. This study concluded that MT-1/2 overexpression is associated with a significantly poorer prognosis, particularly in pT2 invasive ductal breast carcinomas. These findings were extended in a study employing 79 breast carcinomas (Fresno et al., 1993Go). A statistically significant association was found between MT-1/2 immunostaining and histological grade as well as nuclear grade. An inverse relationship between MT-1/2 staining and estrogen receptor content was also demonstrated. A statistically significant association was demonstrated between moderate and strong MT-1/2 immunostaining and decreased overall survival and shorter disease-free survival. MT-1/2 immunostaining was also predictive of a worse prognosis in the subgroup of lymph-node–negative and estrogen-receptor–negative patients. These studies were further augmented to include an analysis showing that MT-1/2 staining was also predictive of a poor prognosis in lymph-node–positive patients (Haerslev et al., 1994Go).

The MT-1/2 protein was also analyzed in normal breast tissue and in a variety of benign, pre-invasive, and malignant breast lesions (Bier et al., 1994Go). Of significance was the finding that in 12/24 ductal in situ carcinomas and in 9/20 invasive ductal carcinomas there was MT-1/2 overexpression, suggesting that the in situ components within invasive ductal carcinomas generally reflected the MT-1/2 status of their invasive counterpart. It was concluded that breast carcinoma cases with MT-1/2 protein overexpression arise from lesions that also demonstrate MT-1/2 overexpression and that MT-1/2 overexpression is a genuine feature of the tumor cells and not simply related to endogenous or exogenous factors known to induce MT-1/2 synthesis. This is in agreement with studies by Douglas-Jones and coworkers (1995)Go, which analyzed MT-1/2 expression in duct carcinoma in situ and found MT overexpression to arise from early lesions that also overexpress MT-1/2.

Despite these compelling observations, there is no information regarding the expression of the mRNAs for the eight active MT-1 and MT-2 genes in normal breast duct epithelium. Without such information, no conclusions can be drawn from examinations of MT-1 and MT-2 isoform–specific mRNA expression in human ductal breast cancers. The first goal of this study was to determine the expression of the MT-1 and MT-2 isoform–specific mRNAs in the ductal epithelium of the normal breast. As part of this initial goal, the previous immunohistochemical reports that demonstrated intense staining for the MT-1/2 protein in the myoepithelium of the normal breast and a corresponding lack of immunoreactivity in adjacent ductal epithelial cells were confirmed in this laboratory (Bier et al., 1994Go; Fresno et al., 1993Go; Jin et al., 2001Go). Laser capture microdissection was used to separate the ductal and myoepithelial cells into separate components, with subsequent isolation of total RNA and RT-PCR to determine expression of MT-1 and MT-2 isoform-specific mRNAs in each fraction. Rather than the expected finding that there would be limited expression of MT isoform–specific mRNAs in the ductal fraction, in agreement with the absence of immunoreactive MT-1/2 protein, the results of this analysis demonstrated that both the identity of the MT isoform–specific genes expressed (MT-2A and MT-1X), and their relative levels of expression were similar between the myoepithelial and ductal components. These findings showed that the ductal and myoepithelial components of the human breast express similar amounts of MT-2A and MT-1X mRNAs, but that they have distinctly different expression of the MT-1/2 protein. The finding of similar MT mRNA expression, but vastly different MT protein expression, in two adjacent cell types provides initial evidence for a component of post-transcriptional regulation of MT-1 and MT-2 protein expression in the human breast.

The finding that MT-1/2 immunonegative normal ductal epithelial cells express MT-2A and MT-1X mRNA in amounts similar to the highly MT-1/2 immunoreactive myoepithelial cells has several impacts on the observation that MT-1/2 protein expression is increased in a subset of ductal breast cancers. The first impact is that no assumption can be made that the increased expression of the MT-1/2 protein in breast cancer is due solely to an induction of transcription of the MT-1 and MT-2 mRNAs, but rather could be due to post-transcriptional regulation of MT-1/2 protein accumulation. Historically, evidence indicates that the MT-1 and MT-2 genes are primarily regulated at the level of transcription (Samson and Gedamu, 1998Go). However, there is recent evidence in rodents after treatment with Cu+2 and Cd+2 that shows that MT-1/2 protein levels can be regulated at the post-transcriptional level (Vasconcelos et al., 1996Go, 2002Go). To determine if post-transcriptional control of MT-1/2 protein expression could occur in ductal epithelium, the MCF-10A cell line was analyzed for its basal and Cd+2-induced expression of the MT-1 and MT-2 isoform–specific mRNAs and protein. The spontaneously immortalized MCF-10A cell line is widely employed as a model of the normal human breast epithelial cell (Soule et al., 1990Go). First, the basal expression pattern of the MT-1/2 protein and the MT-1 and –2 isoform–specific mRNAs was determined to establish if the cell line would have similar expression patterns to that found for in situ ductal epithelium. The basal expression of MT-1/2 protein was modest, being approximately 3.3 ng of MT-1/2 protein per microgram of total MCF-10A protein. The MCF-10A cells expressed mRNA for the MT-1X and MT-2A genes, in agreement with the gene expression found for in situ ductal epithelium. Furthermore, the MT-1X and MT-2A mRNAs were found to be very abundant transcripts and in large excess to what would be expected for the accumulation of the low amount of MT-1/2 protein. The only discrepancy between the MCF-10A cells and the in situ epithelium was in the level of expression of the MT-1E gene. The expression of the MT-1E was noted at 30 cycles of PCR in the MCF-10A cells and at the limits of detection in the in situ ductal epithelium. Overall, theses findings demonstrated a similarity to ductal epithelium in the expression of the MT-1/2 proteins and isoform-specific mRNAs.

The MCF-10A cells were exposed to lethal and sublethal levels of Cd+2 to determine if evidence could be found for post-transcriptional regulation of MT-1/2 protein accumulation. It was demonstrated that Cd+2 elicited only a marginal induction of MT-1E, MT-1X, or MT-2A mRNAs in the MCF-10A cells at either lethal or sublethal levels of exposure and under both acute and extended periods of exposure. In marked contrast, it was demonstrated that Cd+2 exposure under identical conditions resulted in a large increase in MT-1/2 protein expression, reaching levels of 6% of total cell protein under conditions of extended exposure to Cd+2. The likely mechanism underlying these findings is the classic observation that apoMT (metal-free MT) is rapidly degraded by the cell and that metal binding stabilizes the MT protein against such degradation (Hamer, 1986Go; Kägi, 1993Go; Kägi and Hunziker, 1989Go). These findings are strong evidence that post-transcriptional regulation could be one mechanism determining MT-1/2 protein levels in malignant human breast duct epithelial cells.

One can only speculate how the present findings might influence the role of cadmium in the development of breast cancer. Cadmium is a pollutant produced almost exclusively by the Industrial Revolution. Because of this relatively recent time frame of cadmium accumulation, it is certain that the pattern of MT expression found in the human breast duct has no evolutionary correlation to the presence of cadmium as an environmental pollutant. Rather, it is more likely that the pattern of MT expression in the breast duct reflects a past nutritional need to rapidly sequester zinc, perhaps under certain conditions of zinc deficiency during lactation. A limited, but rapid need to sequester zinc is suggested because this would be most consistent with the pattern of MT expression found in the breast duct. The high basal expression of MT mRNA, coupled with a post-transcriptional stabilization of the protein by zinc, would provide the cell a means to rapidly accumulate zinc without the need to induce new transcription. To have a link to cadmium and the development of breast cancer, one would have to speculate that at some stage of the transformation process, the duct cell acquires a zinc- and cadmium-accumulating phenotype as noted through stabilization of the MT protein. Evidence for this hypothesis comes from whole-body autoradiography of lactating mice injected with 109CdCl2 which documents that breast tissue is a major organ of cadmium accumulation and that the duct epithelial cells are the accumulating cell type (Grawe and Okarsson, 2000Go). Fractionation of cytosolic proteins in this study also showed that most of the accumulated metal is bound to MT. Brako and co-workers have also shown an increase in cadmium accumulation in lactating breast and that MT levels increase in the mammary gland during lactation in cadmium-treated animals (Brako et al., 2003Go). Thus, either there is a lactating-specific induction of MT or there is a post-transcriptional regulation of MT by cadmium similar to that shown in the present study. An interaction of cadmium, MT and breast cancer is also implicated by the recent observation that some smokers have increased expression of MT protein in invasive breast cancers, and it is well-established that cigarette smoking produces a high level of exposure to cadmium (Gallicchio et al., 2004Go). The inherent ability of ductal epithelium to accumulate cadmium and MT under lactating conditions, coupled with the chronic low-level activation of the estrogen receptor by this metal, could have a potential role in cadmium-induced breast carcinogenesis.

There have been only limited examinations of the expression of the mRNAs supporting MT-1/2 protein overexpression in breast cancer, and none have examined a relationship to disease outcome. The examination of MT-2A mRNA expression in fresh surgical specimens of ductal breast cancer found that increased expression correlated with higher histological grade but not with patient age or lymph node status (Jin et al., 2002Go). The level of expression of MT-2A mRNA was not compared to that found in normal breast duct epithelium. The expression of the MT-1E isoform was also examined in a similar series of breast cancers and was found to be highly expressed in estrogen-receptor–negative breast cancers compared to estrogen-receptor–positive breast cancers (Jin et al., 2000Go). This observation is important because, in conjunction with the current findings, it would indicate that these breast cancers had gained the expression of the MT-1E gene compared to the normal ductal epithelial cell. Such an increase in expression would have to be initiated at the level of transcription. The relationship between the expression of the MT-1E gene and estrogen receptor status was first noted in breast cancer cell lines (Friedline et al., 1998Go). In these studies, the estrogen-receptor–positive cell lines MCF-7 and T-47D were shown to express only MT-2A and MT-1X mRNA, whereas the estrogen-receptor–negative cell lines Hs578T and MDA-MB-231 were shown to express MT-1E in addition to the MT-2A and MT-1X genes. Together, these findings suggest that elucidation of the expression pattern of the underlying MT-1 and MT-2 genes in breast cancers could increase the prognostic significance beyond that of just knowing the expression of the MT-1/2 protein.

The present study suggests that the mechanism underlying the finding of increased MT-1/2 protein expression in ductal breast cancer and its relationship to disease prognosis may be very complex, involving the post-transcriptional regulation of MT-1/2 protein expression from normally expressed MT-1X and MT-2A mRNAs and new, induced transcription from at least one additional MT-1 isoform-specific gene.


    NOTES
 
The authors certify that all research involving human subjects was done under full compliance with all government policies and the Helsinki Declaration.


    ACKNOWLEDGMENTS
 
The project described was supported by grants R01 CA094997 and R01 CA098832 from the National Cancer Institute (NCI), National Institutes of Health (NIH). The contents of this article are solely the responsibility of the authors and do not necessarily represent the official views of the NCI, NIH. Project support was also provided by the North Dakota Biomedical Research Infrastructure Network, NIH.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Andrews, G. K. (2000). Regulation of metallothionein gene expression by oxidative stress and metal ions. Biochem. Pharmacol. 59, 95–104.[CrossRef][Web of Science][Medline]

Bier, B., Douglas-Jones, A., Totsch, M., Dockhorn-Dworniczak, B., Bocker, W., Jasani, B., and Schmid, K. W. (1994). Immunohistochemical demonstration of metallothionein in normal human breast tissue and benign and malignant lesions. Breast Cancer Res. Treat. 30, 213–221.[CrossRef][Web of Science][Medline]

Brako, E. E., Wilson, A. K., Jonah, M. M., Blum, C. A., Cerny, E. A., Williams, K. L., and Bhattacharyya, M. H. (2003). Cadmium pathways during gestation and lactation in control versus metallothionein 1,2-kockout mice. Toxicol. Sci. 71, 154–163.[Abstract/Free Full Text]

Cantor, K. P., Stewart, P. A., Brinton, L. A., and Dosemeci, M. (1995). Occupational exposures and female breast cancer mortality in the United States. J. Occup. Med. 37, 336–348.

Cherian, M. G., Howell, S. B., Imura, N., Klaassen, C. D., Koropatnick, J., Lazo, J. S., and Waalkes, M. P. (1994). Role of metallothionein in carcinogenesis. Toxicol. Appl. Pharmacol. 126, 1–5.[CrossRef][Medline]

Douglas-Jones, A. G., Schmid, K. W., Bier, B., Horgan, K., Lyons, K., Dallimore, N. D., Moneypenny, I. J., and Jasani, B. (1995). Metallothionein expression in duct carcinoma in situ of the breast. Hum. Pathol. 26, 217–222.[CrossRef][Web of Science][Medline]

Fresno, M., Wu, W., Rodriguez, J. M., and Nadji, M. (1993). Localization of metallothionein in breast carcinomas. An immunohistochemical study. Virchows Arch. A Pathol. Anat. Histopathol. 423, 215–219.[CrossRef][Web of Science][Medline]

Friedline, J. A., Garrett, S. H., Somji, S., Todd, J. H., and Sens, D. A. (1998). Differential expression of the MT-1E gene in estrogen receptor positive and negative human breast cancer cell lines. Am. J. Pathol. 152, 23–27.[Abstract]

Gallicchio, L., Flaws, J. A., Sexton, M., and Ioffe, O. B. (2004). Cigarette smoking and metallothionein expression in invasive breast carcinomas. Toxicol. Lett. 152, 245–253.[Medline]

Garrett, S. H., Somji, S., Todd, J. H., Sens, M. A., and Sens, D. A. (1998b). Differential expression of human metallothionein isoform I mRNAs in human proximal tubule cells exposed to metals. Environ. Health Perspect. 106, 825–832.[Web of Science][Medline]

Garrett, S. H., Somji, S., Todd, J. H., and Sens, D. A. (1998a). Exposure of human proximal tubule cells to Cd+2, Zn+2, and Cu+2 induces metallothionein protein accumulation, but not metallothionein isoform 2 mRNA. Environ. Health Perspect. 106, 587–595.[Web of Science][Medline]

Garrett, S. H., Sens, M. A., Shukla, D., Flores, L., Somji, S., Todd, J. H., and Sens, D. A. (2000). Metallothionein isoform 1 and 2 gene expression in the human prostate: Down-regulation of MT-1X in advance prostate cancer. Prostate 43, 125–135.[CrossRef][Web of Science][Medline]

Goulding, H., Jasani, B., Pereira, H., Reid, A., Galea, M., Bell, J. A., Elston, C. W., Robertson, J. F., Blamey, R.W., Nicholson, R.A. et al. (1995). Metallothionein expression in human breast cancer. Br. J. Cancer 72, 968–972.[Web of Science][Medline]

Grawe, K. P., and Oskarsson, A. (2000). Cadmium in milk and mammary gland in rats and mice. Arch. Toxicol. 73, 519–527.[CrossRef][Web of Science][Medline]

Haerslev, T., Jacobsen, K., Nedergaard, L., and Zedeler, K. (1994). Immunohistochemical detection of metallothionein in primary breast carcinomas and their axillary lymph node metastases. Pathol. Res. Pract. 190, 675–681.[Web of Science][Medline]

Hamer, D. H. (1986). Metallothionein. Annu. Rev. Biochem. 55, 913–951.[Web of Science][Medline]

Ioachim, E., Kamina, S., Demou, A., Kontostolis, M., Lolis, D., and Agnantis, N. J. (1999). Immunohistochemical localization of metallothionein in human breast cancer in comparison with cathepsin D, stromelysin-1, CD44, extracellular matrix components, P53, Rb, C-erbB-2, EGFR, steroid receptor content and proliferation. Anticancer Res. 19, 2133–2140.[Web of Science][Medline]

Jasani, B., and Schmid, K. W. (1997). Significance of metallothionein overexpression in human tumours. Histopathology 31, 211–214.[CrossRef][Web of Science][Medline]

Jin, R., Bay, B. H., Chow, V. T. K., Tan, P. H., and Dheen, T. (2001). Significance of metallothionein expression in breast myoepithelial cells. Cell Tissue Res. 303, 221–226.[CrossRef][Web of Science][Medline]

Jin, R., Bay, B. H., Chow, V. T. K., Tan, P. H., and Lin, V. C. L. (2000). Metallothionein 1E mRNA is highly expressed in oestrogen receptor–negative human invasive ductal breast cancer. Br. J. Cancer 83, 319–323.[CrossRef][Web of Science][Medline]

Jin, R., Chow, V. T. K., Tan, P. H., Dheen, T., Duan, W., and Bay, B. H. (2002). Metallothionein 2A expression is associated with cell proliferation in breast cancer. Carcinogenesis 23, 81–86.[Abstract/Free Full Text]

Johnson, M. D., Kenney, N., Stoica, A., Hilakivi-Clarke, L., Singh, B., Chepko, G., Clarke, R., Sholler, P. F., Lirio, A. A., Foss, C. et al. (2003). Cadmium mimics the in vivo effects of estrogen in the uterus and mammary gland. Nat. Med. 9, 1081–1084.[CrossRef][Web of Science][Medline]

Kägi, J. H. R., and Hunziker, P. (1989). Mammalian metallothionein. Biol. Trace Element Res. 21, 111–118.[Web of Science][Medline]

Kägi, J. H. R. (1993). Evolution, structure and chemical activity of class I metallothioneins: An overview. In Metallothionein III. Biological Roles and Medical Implications (Suzuki, K.T., Imura, N., and Kimura, M., Eds.), pp. 29–56. Birkhaüser Verlag, Berlin.

Martin, M. B., Reiter, R., Pham, T., Avellanet, Y. R., Camara, J., Lahm, M., Pentecost, E., Pratap, K., Gilmore, B. A., Divekar, S. et al. (2003). Estrogen-like activity of metals in mcf-7 breast cancer cells. Endocrinology 144, 2425–2436.[Abstract/Free Full Text]

Oyama, T., Take, H., Hikino, T., Iino, Y., and Nakajima, T. (1996). Immunohistochemical expression of metallothionein in invasive breast cancer in relation to proliferative activity, histology and prognosis. Oncology 53, 112–117.[Web of Science][Medline]

Rook, M. S., Delach, S. M., Deyneko, G., Worlock, A., and Wolfe, J. L. (2004). Whole genome amplification of DNA from laser capture-microdissected tissue for high-throughput single nucleotide polymorphism and short tandem repeat genotyping. Am. J. Pathol. 164, 23–33.[Abstract/Free Full Text]

Samson, S. L., and Gedamu, L. (1998). Molecular analysis of metallothionein gene regulation. Prog. Nucleic Acid Res. Mol. Biol. 59, 257–288.[Web of Science][Medline]

Schmid, K. W., Ellis, I. O., Gee, J. M. W., Darke, B. M., Lees, W. E., Kay, J., Cryer, A., Stark, J. M., Hittmair, A., Ofner, D. et al. (1993). Presence and possible significance of immunocytochemically demonstrable metallothionein over-expression in primary invasive ductal carcinoma of the breast. Virchows Arch. A Pathol. Anat. Histopathol. 422, 153–159.[CrossRef][Web of Science][Medline]

Soule, H. D., Maloney, T. M., Wolman, S. R., Peterson, W. D., Brenz, R., McGrath, C. M., Russo, J., Pauley, R. J., Jones, R. F., and Brooks, S. C. (1990). Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10A. Cancer Res. 50, 6075–6086.[Abstract/Free Full Text]

Vasconcelos, M. H., Tam, S. C., Beattie, J. H., and Hesketh, J. (1996). Evidence for differences in the post-transcriptional regulation of rat metallothionein isoforms. Biochem. J. 315, 665–671.

Vasconcelos, M. H., Tam, S. C., Hesketh, J., Reid, M., and Beattie, J. H. (2002). Metal- and tissue-dependent relationship between metallothionein mRNA and protein. Toxicol. Appl. Pharmacol. 182, 91–97.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
85/2/906    most recent
kfi155v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Gurel, V.
Right arrow Articles by Sens, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gurel, V.
Right arrow Articles by Sens, M. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?