ToxSci Advance Access originally published online on June 23, 2005
Toxicological Sciences 2005 87(1):113-122; doi:10.1093/toxsci/kfi234
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Induction of Competing Apoptotic and Survival Signaling Pathways in the Macrophage by the Ribotoxic Trichothecene Deoxynivalenol


,
,1
Departments of * Microbiology and Molecular Genetics,
Food Science and Human Nutrition, and
Center for Integrative Toxicology, Michigan State University, East Lansing Michigan 48824-1224
1 To whom correspondence should be addressed at Department of Microbiology and Molecular Genetics, Michigan State University, 234 G. M. Trout Building, East Lansing, MI 48824. Fax: 517-353-8963. E-mail: pestka{at}msu.edu.
Received March 7, 2005; accepted June 7, 2005
| ABSTRACT |
|---|
|
|
|---|
Deoxynivalenol (DON) and other ribotoxic trichothecenes cause immune stimulation and suppression in leukocytes by upregulating gene expression and apoptosis, respectively. The purpose of this study was to test the hypothesis that MAPKs mediate both apoptosis and survival in DON-exposed macrophages. At concentrations which partially inhibit translation, DON induced phosphorylation of p38 and ERK 1/2 mitogen activated protein kinases within 15 min in RAW 264.7 macrophages and these effects lasted up to 3 h. DON-exposed cells exhibited marked caspase 3-dependent DNA fragmentation after 6 h which was suppressed and attenuated by the p38 inhibitor SB203580 and ERK inhibitor PD98059, respectively. DON readily induced the phosphorylation and activity of p53 and this was inhibitable by SB203580. DON exposure evoked BAX translocation to mitochondria and corresponding cytochrome C release but did not alter mitochondrial membrane potential. The p53 inhibitor PFT
reduced both DON-induced phosphorylation of p53 and p53 binding activity. Moreover, both PFT
and p53 siRNA transfection suppressed DON-induced caspase-3 activity and subsequent DNA fragmentation. Concurrent with p53 activation, DON activated two anti-apoptotic survival pathways as evidenced by both ERK-dependent p90 Rsk and AKT activation. Taken together, the results indicate that DON initiates competing apoptotic (p38/p53/Bax/Mitochondria/Caspase-3) and survival (ERK/AKT/p90Rsk/Bad) pathways in the macrophage. Key Words: deoxynivalenol; trichothecene; apoptosis; macrophages; ribotoxic.
| INTRODUCTION |
|---|
|
|
|---|
Trichothecene mycotoxins are a diverse group of sesquiterpenoid metabolites (Grove, 1988
The macrophage and innate immune system appear to be exquisitely sensitive to trichothecenes. Stimulation of macrophages by low doses or concentrations of trichothecenes upregulate expression of inflammation-related genes in vivo and in vitro including COX-2 (Moon and Pestka, 2003a
,b
), proflammatory cytokines (Wong et al., 1998
; Zhou et al., 1997
), nitric oxide synthase (Ji et al., 1998
), and numerous chemokines (Chung et al., 2003a
; Kinser et al., 2004
). In contrast, exposure to high doses or concentrations of trichothecene can induce apoptosis in macrophages (Yang et al., 2000
; Zhou et al., 2003a
) thereby suppressing innate immune function (Pestka et al., 2004
).
The underlying molecular mechanisms for the paradoxical effects of trichothecenes on leukocytes and, ultimately, the overall immune system are not completely resolved. The most prominent molecular target of trichothecenes is the 60S ribosomal subunit suggesting that one underlying mechanism is translational inhibition (Ueno, 1984
). However, it is now known that trichothecenes and other translational inhibitors which bind to ribosomes can also rapidly activate mitogen-activated protein kinases (MAPKs) and induce apoptosis in a process known as the "ribotoxic stress response" (Iordanov et al., 1997
; Laskin et al., 2002
). MAPKs modulate physiological processes including cell growth, differentiation, and apoptosis (Cobb, 1999
) and are critical for signal transduction in the immune response (Dong et al., 2002
). MAPK subfamilies include (1) p44 and p42 MAPKs, also known as extracellular signal regulated protein kinase 1 and 2 (ERK1 and 2); (2) p54 and p46 c-Jun N-terminal kinase 1 and 2 (JNK 1/2), and (3) p38 MAPK (Cobb, 1999
; Schaeffer and Weber, 1999
; Widmann et al., 1999
).
The demonstration that trichothecenes activate JNK, ERK, and p38 in vitro (Moon and Pestka, 2002
; Shifrin and Anderson, 1999
; Yang et al., 2000
; Zhou et al., 2003a
) and in vivo (Zhou et al., 2003b
) suggests that the ribotoxic stress response might mediate trichothecene immunotoxicity. DON induces ERK 1/2, p38, and JNK 1/2 phosphorylation in the RAW 264.7 macrophage cell line. ERK and p38 but not JNK are involved in trichothecene-induced transactivation of TNF-
and COX-2 in this cell line, whereas p38 appears to be involved in trichothecene-mediated mRNA stability (Chung et al., 2003b
, Moon and Pestka, 2002
, 2003
a,b; Moon et al., 2003
). Yang et al. (2000)
found that trichothecene-mediated cytotoxicity and apoptosis correlate closely with activation of all three different MAPK in RAW 264.7 macrophage cells and U937 monocyte models suggesting possible involvement of these kinases in trichothecene-induced apoptosis.
Apoptosis in the immune system is orchestrated by two general categories of proteases known as caspases (Green, 2003
). The executioner caspases including caspase-3 exist as inactive dimers which are activated by initiator caspases. Two distinct pathways for apoptosis (Downward, 2004
) exist based on the types of initiator caspases and adapter molecules that bind them. The intrinsic pathway is initiated by mitochondria, which are regulated by Bcl-2 protein family. The anti-apoptotic Bcl-2 and Bcl-xL reside in the outer mitochondrion membrane and inhibit cytochrome c release. In response to death stimuli, the pro-apoptotic Bad and Bax translocate to the mitochondrial membrane and form a proapoptotic complex with Bcl-xL or Bcl-2. This complex induces pores in the mitochondrial membrane leading to cytochrome C release. Caspase-9 is activated by cytochrome C, which complexes with Apaf-1 initiating activation of caspase-3 which is an "executioner" that degrades a variety of cellular components producing apoptosis. In contrast to the intrinsic pathway, the extrinsic apoptotic pathway is initiated by death receptors such as (e.g., FAS, TNFR) and their respective ligands. Death receptor ligands initiate signaling via receptor oligomerization, which in turn result in the recruitment of specialized adaptor proteins and activation of caspase cascades.
The purpose of this study was to test the hypothesis that MAPKs mediate both apoptosis and survival in DON-exposed macrophages. RAW 264.7 murine macrophage cells were used as the model for apoptosis based on its previously described susceptibility to trichothecenes (Yang et al., 2000
). The results indicate that DON induced the intrinsic pathway of apoptosis via phosphorylation of p38 and p53. DON concurrently induced survival pathways mediated by phosphorylation of ERK and p90Rsk as well as AKT, both of which drive multiple anti-apoptotic pathways.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture.
RAW 264.7 murine macrophage cells (American Type Culture Collection, Rockville, MD) were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Sigma Chemical Co., St. Louis, MO) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (HIFBS, Sigma), 100 units/ml penicillin, and 100 µg/ml streptomycin (Sigma) in a 5% CO2 humidified incubator at 37°C. Macrophage cell number and viability were assessed by tryphan blue (Sigma) dye exclusion using a hematocytometer and were verified to exceed 95% in each study. Cells (5 x 105/ml) were seeded in 10 ml of medium in a 100 mm2 sterile tissue culture dishes overnight to achieve 80% confluency. DON concentrations which partially inhibit translation (250500 ng/ml) were used for assessing competing pathways. These concentrations are known to induce both gene induction and apoptosis in RAW 264.7 cells (Zhou et al., 2003a
Western analysis.
Cells were washed with ice-cold phosphate-buffered saline (PBS), lysed in boiling lysis buffer (1%[w/v] Sodium dodecylsulfate, 1 mM sodium ortho-vanadate and 10 mM Tris pH 7.4), boiled for 5 min and sonicated briefly, The lysate was centrifuged at 12,000 x g for 15 min at 4°C. Protein was measured in the resultant supernatant with a Bio-Rad DC protein assay kit (Bio Rad Laboratories Inc., Melville, NY). Total cellular proteins were resolved by 8% (w/v) acrylamide gel and transferred to a polyvinylidene difluoride (PVDF) membrane (Amersham, Arlington Heights, IL). After blocking with 3% (w/v) bovine serum albumin 20 mM Tris (pH 7.4) containing 1500 mM 0.05% NaCl and Tween 20 immobilized proteins were incubated with phosphospecific antibodies followed by horseradish peroxidase-conjugated anti-rabbit IgG antibodies (Amersham). Bound peroxidase was determined using an ECL Chemiluminescence Detection Kit (Amersham). Western analysis was conducted using primary antibodies specific for phospho-JNK1/2, phospho-ERK1/2, phopho-p38, phospho-p53 (Ser 15), phospho-p21 (Ser 146), phospho-p90Rsk (Ser 380), phospho-Bad (Ser 136), phospho-AKT (Ser 473), phospho-GSK-3ß (Ser 9), and phospho-FKRH (Ser 256) (Cell Signaling, Beverly, MA). To assess loading, membranes were stripped and reprobed with specific antibodies that recognize both phosphorylated and unphosphorylated forms (Cell Signaling) of each protein or antibody against housekeeping ß-actin.
For determination of the translocation of Bax and cytochrome C, the mitochondrial fraction was separated from cytosolic fraction of cells using an ApoAlert Cell Fractionation Kit (Clontech, Palo Alto, CA). Briefly, cells were suspended in fractionation buffer mix and homogenized with Dounce tissue homogenizer. Cell debris was removed by centrifugation at 700 x g for 10 min at 4°C. The supernatant was recentrifuged at 10,000 x g for 25 min at 4°C. Resultant supernatant fraction (cytosol) and pellet (mitochondria) were subjected to Western analysis as described above using primary antibodies to Bax (Cell Signaling) and cytochrome C (BD-PharMingen, San Diego, CA).
DNA fragmentation analysis.
DNA fragmentation was determined by a modification of the method of Sellins and Cohen (1987)
. Briefly, cells (1 x 107) in PBS were centrifuged for 5 min (500 x g) at 4°C and the pellet suspended in 0.1 ml hypotonic lysing buffer (10 mM Tris, 10 mM EDTA, 0.5% Triton X-100, pH 8.0). Cells were incubated at 4°C for 10 min. The resultant lysate was centrifuged for 30 min (13,000 x g) at 4°C. The supernatant containing fragmented DNA was digested for 1 h at 37°C with RNase A (0.4 mg/ml) and then incubated for another hour at 37°C with proteinase (0.4 mg/ml). DNA was precipitated in 50% (v/v) isopropanol and 0.5 M NaCl overnight at 20°C. The precipitate was centrifuged at 13,000 x g for 30 min at 4°C. The resultant pellet was air dried, resuspended in 10 mM Tris, 1 mM EDTA, pH 8.0, then electrophoresed at 8.5 V/cm for 2 h in 2% (w/v) agarose gel in 90 mM Tris-borate buffer (pH 8.0) containing 2 mM EDTA. After electrophoresis, gels were stained with ethidium bromide and the nucleic acid bands visualized with a UV transilluminator and photographed.
Caspase-3 assay.
Cells were suspended 200 µl of CHAPS buffer (100 mM HEPES [pH 7.5]) containing 10% (v/v) sucrose, 0.5% (w/v) CHAPS, 1 mM EDTA, 10 mM DTT, and protease inhibitor cocktail 2 µl [Sigma], placed on ice for 30 min sonicated briefly, and then centrifuged 10,000 x g for 10 min. Following protein assay, lysates (50 µg in 100 ul CHAPS buffer) were incubated at 37°C for 30 min with an equal volume of fluorogenic substrate consisting of 25 µM DEVD-AMC (Calbiochem, San Diego, CA) dissolved in CHAPS buffer. Substrate cleavage was measured using a Cyto Fluor II microplate fluorescence reader (Biosearch, Bedford, MA) at excitation 360 nm and emission wavelengths of 460 nm, respectively.
Electrophoretic mobility shift assay (EMSA).
EMSA was used to characterize p53 binding activity in nuclear extracts (Laniel et al., 2001
). Briefly, double-stranded p53 consensus probe (Santa Cruz Biotech, Santa Cruz, CA) was radiolabelled with [
-32P] ATP using Ready to Go Polynucleotide Kinase Kit (Pharmacia Biotech, Piscataway, NJ). Nuclear extracts containing 5 to 10 µg protein were added to DNA-binding reaction buffer consisting of 20 mM HEPES, (pH 7.9) containing 60 mM KCl, 1 mM EDTA, 0.5 mM DTT, and 2 µg poly (dI-dC) in a total volume of 20 µl. These were preincubated on ice for 15 min. to block the nonspecific binding. Following the addition of 1 µl 32P-labeled probe containing 30,000 cpm, the incubation was continued for 30 min at room temperature to promote the formation of nucleoprotein complex. Resultant nucleoprotein complexes were resolved on 4% (w/v) native polyacrylamide gels in 0.5x TBE buffer, which were then dried and visualized by autoradiography.
Immunofluorescence staining.
Phospho-p53 was determined by immunofluorescence. RAW cells (5 x 105/ml) were grown on slides and fixed with 4% (w/v) paraformaldehyde for 20 min at 25°C. After washing with PBS for 5 min three times, slides were blocked with 1.5% (v/v) goat serum in PBS for 20 min at 25°C. These were then incubated with anti-phospho-p53 (Ser 15) (Santa Cruz SC-11764 R) for 1 h at 25°C. After washing three more times with PBS, slides were incubated with goat anti-rabbit IgG-FITC conjugates (2 µg/ml) for 30 min at 25°C, washed three times with PBS. Gel/mount (Bio media Corp., Foster City, CA) was added to slide and then sealed with coverslip. Slides were examined under a Nikon Labophot fluorescence microscope (Mager Scientific, Inc., Dexter, MI).
Analysis of mitochondrial membrane potential.
Mitochondrial membrane potential (
) was analyzed with a MitoProbe JC-1 Assay Kit (Molecular Probes, Eugene, OR), according to manufacturer's protocols. Briefly, RAW 264.7 cells (1 x 106/ml) were incubated in 12 well tissue culture plates with vehicle, DON at various concentrations or 50 µM CCCP (positive control). After appropriate time intervals supernatant was removed. Cells were released with 1 ml of Accutase (Innovative Cell Technologies, San Diego, CA). After centrifugation, cells were suspended in 1 ml PBS containing 2 µM JC-1 dye which exists as a green monomer but accumulates as a red aggregate in mitochondria. Normal mitochondria will appear red following aggregation of the JC-1 reagent which emits at 590 nm (red). Following mitochondrial depolarization, the dye remains in its monomeric form and emits at 529 nm (green). Cell suspensions were incubated in 5% CO2 37°C for 30 min and supernatant removed by centrifugation from 400 x g for 5 min and analyzed by flow cytometry on a Becton Dickinson FACS Vantage (San Jose, CA) using 488 nm excitation with 530 and 585 nm band p457 emission filters (Cossarizza et al., 1993
).
siRNA preparation and transfection.
p53 siRNAs were generated with a Silencer siRNA Cocktail Kit (Rnase III) (Ambion Inc., Austin, Texas). Briefly, total RNA was extracted from RAW 264.7 cells with TRIZOL (Invitrogen, Carlsbad, CA) and reverse transcribed with a RETRO Script Kit (Ambion) to produce cDNA, PCR primers containing T7 RNA polymerase promoters were designed to amplify a 217 bp fragment of murine macrophage p53 gene (641 bp from the 5' end), and had the following sequences: forward 5'TAATACGACCACTATAGGGCACAGCGTGGTGGTACCTTA and reverse 5'-TAATACGACTCACTATAGGGCTTCTGTACGGCGGTCTCTC. Following PCR amplification of cDNA with these primers, the resultant templates were used to generate dsRNA by in vitro transcription reaction. After column (Ambion) purification, 15 µg of dsRNA was digested with 15 units of Rnase III at 37°C for 1 h. Digestion products were then purified with a siRNA Purification Unit (Ambion) and siRNA quantified spectrophotometrically. Transfections were carried out using 1.5 µl siPORT Lipid (Ambion) and 25 nM p53 siRNA or Silencer negative siRNA control (Ambion) in 24 well cell culture plates. After 48 h, cells were treated with DON and analyzed for caspase-3 activity.
Statistics.
Data were analyzed using SigmaStat for Windows (Jandel Scientific, San Rafael, CA). Data were subjected to one-way ANOVA and pairwise comparisons made by Bonferroni or Student-Newman-Keuls methods. Differences were considered significant at p < 0.05.
| RESULTS |
|---|
|
|
|---|
DON-Induced MAPK Activation Mediates Apoptotic and Survival Pathways in RAW 264.7 Cells
Incubation of RAW 264.7 murine macrophages with 250 ng/ml DON was verified to induce phosphorylation of p38 within 15 min and phosphorylation of these MAPKs were maintained for at least 180 min (Fig. 1). A similar pattern was observed for ERK 1/2 with phosphorylation being most apparent after 30 min. DON at 250 ng/ml induced marked DNA fragmentation in the cells after 6 h. Inclusion of the p38 inhibitor SB203580 blocked DON-induced fragmentation whereas the ERK inhibitor PD98059 enhanced the fragmentation (Fig. 2A). DON-induced DNA fragmentation was dose-dependently inhibited by caspase 3 inhibitor 1 suggesting apoptosis was caspase-3-dependent (Fig. 2B). DON upregulated caspase-3 activation, which was suppressed by the p38 inhibitor (Fig. 3A) but potentiated by the ERK inhibitor (Fig. 3B). The results suggested that DON induced caspase-dependent apoptosis and competing survival pathways via p38 and ERK 1/2, respectively in the macrophage.
|
|
|
DON-Induced Apoptosis Is Mediated by the Intrinsic Pathway
The intrinsic pathway of apoptosis involves translocation of BAX to the mitochondrial membrane resulting in depolarization and subsequent cytochrome C release (Marsden and Strasser, 2003
|
DON Induces p53 Activation
p53 is a critical mediator of apoptosis in stressed cells (Hofseth et al., 2004
, a p53-specific inhibitor (Fig. 6).
|
|
DON-Induced Apoptosis Is p53-Dependent
When PFT
was used to assess the role of p53 in DON-induced apoptosis, the inhibitor dose dependently abrogated both caspase-3 activation (Fig. 7A) and DNA fragmentation (Fig. 7B). These findings were further confirmed using p53 siRNA transfection. Sip53 transfection reduced DON-induced caspase-3 activation by approximately 65 percent (Fig. 8A). Similarly siRNA abrogated DON-induced DNA fragmentation (Fig. 8B).
|
|
A linkage between p38 and p53 activation was demonstrated using SB203580, which blocked phosphorylation of p21, a substrate of p53 (Fig. 9A) as well as p53 binding to its consensus sequence (Fig. 9B). Thus, in the macrophage, exposure to DON sequentially induced p38 phosphorylation, p53 activation and finally apoptosis via the intrinsic mitochondrial pathway.
|
DON Induces Two Survival Pathways
Based on the apparent protective effects of ERK 1/2, potential downstream survival pathways were investigated. p90RSK is phosphorylated by ERK 1/2 and capable of phosphorylation and inactivating BAD, a critical factor in the intrinsic apoptotic pathway (Franklin and McCubrey, 2000
|
In addition to the p90RSK, the kinase AKT (PKB) is known to mediate survival in stressed cells by multiple pathways including BAD phosphorylation (Downward, 2004
|
| DISCUSSION |
|---|
|
|
|---|
DON and other trichothecenes paradoxically can stimulate or suppress immune function by upregulating gene expression or apoptosis, respectively. Pivotal to these opposing effects is the capacity to activate both apoptotic and survival pathways (Fig. 12). The DON concentrations described here (250500 ng/ml) partially inhibit protein synthesis and have been previously shown to both induce proinflammatory gene expression as well as apoptosis in the macrophage (Zhou et al., 2003a
Even though myeloid cells are critical to both innate and acquired immune function, relatively little is known about regulation of their survival and death compared to B and T cells (Marsden and Strasser, 2003
). The capacity of DON to prevent or cause macrophage cell death can impact host defense, inflammation, phagocytosis and antigen uptake for presentation and activation of T cells. Indeed, macrophage apoptosis might explain why animals exposed to high doses of trichothecenes exhibit diminished resistance to pathogens such as Listeria, Salmonella, and Cryptococcus as well as diminished phagocytic capabilities (Pestka, 2003
). Both intrinsic mitochondrial and extrinsic death receptor pathways are operational in macrophages (Marsden and Strasser, 2003
). Our finding that the intrinsic pathway was induced by DON in macrophages is consistent with reported induction of cytochrome C release, as well as caspase-3, -8, and -9 activation by trichothecenes T-2 toxin (Holme et al., 2003
; Nagase et al., 2001
), fusarenone-X (Miura et al., 2002
), satratoxin G (Nagase et al., 2002
), and AETD (Pae et al., 2003
) in HL-60 cells. These data do not, however, preclude the possibility that TNF-
or other mediators induced by DON could also contribute to the extrinsic apoptotic pathway which would function in parallel to mitochondrial-driven apoptosis.
Extrusion of cytochrome C occurs following disruption of the association of the hemoprotein with cardiolipin which anchors it to the outer surface of the inner mitochondrial membrane (Orrenius, 2004
). This can occur after (1) permeabilization of the outer mitochondrial membrane mediated by BAX or other proapoptotic Bcl 2 family proteins, or (2) Ca2+-triggered mitochondrial permeability transition. Although it has been suggested that these two mechanisms are linked, De Marchi et al. (2004)
recently reported that BAX has no major role in regulating Ca2+-induced mitochondrial permeability transition. This is consistent with our observations that DON mediated apoptosis by the intrinsic mitochondrial pathway without altering mitochondrial membrane potential. However, these results differ from the recent observation that the ribosomal inactivating protein abrin induces mitochondrial membrane depolarization in Jurkat T cells (Narayanan et al., 2004
).
p38 and ERK 1/2 activation were essential for inducing the competing apoptotic and survival pathways observed here. Trichothecenes and other translational inhibitors can activate MAPKs by an incompletely understood mechanism known as the "ribotoxic stress response" (Iordanov et al., 1997
; Laskin et al., 2002
). Recently, we have observed that both double-stranded RNA activated protein kinase (PKR) (Zhou and Pestka, 2003a
) and Src-family tyrosine kinases (Zhou and Pestka, 2005
) are essential upstream signals for MAPK activation by DON and other ribotoxins. Both have the potential to be physically linked to the ribosome and endoplasmic reticulum and thus might be capable of transducing a signal from the ribosome to a downstream MAPK. Impairment of PKR (Zhou et al., 2003a
) or the Src Hck (Zhou et al., 2005
) with inhibitors or interference with gene expression in macrophages have been shown previously to inhibit DON-induced apoptosis.
p53 is a central regulator of cell death which acts pleiotropically by transcriptional-dependent and -independent mechanisms (Oren, 2003
). p53 can upregulate transcription of apoptosis-dependent genes related to the extrinsic pathway such as Fas, DR5, and PERP as well as the intrinsic pathway including the BH3-only proteins Bax, Noxa, Puma, and Bid (Haupt et al., 2003
). p53 can also transactivate genes associated with apoptosome activation (Apaf-1) and caspase 6. In contrast, Chipuk et al. (2004)
reported that a transcription-independent mechanism whereby p53 functions analogously to the BH3-only proapoptotic Bcl-2 proteins in the activation of Bax and triggering of apoptosis. Erster et al. (2004)
found in sensitive organs in vivo that mitochondrial p53 accumulation occurs soon after a death stimulus triggering a rapid first wave of apoptosis that is transcription-independent and precedes a second slower wave of transcription-dependent apoptosis. It is likely that p53-independent mechanisms for DON-induced apoptosis are also possible based on our previous findings that the toxin can induce apoptosis in U937 monocytes which lack functional p53 (Zhou and Pestka, 2003a
). Further investigation is needed on whether DON-induced p53 activation induces transcriptional-dependent or -independent apoptosis. It was interesting to note that p53 activation also mediated p21 phosphorylation. This action can cause cell cycle arrest which is widely described effect of trichothecenes (Fornelli et al., 2004
).
Several mechanisms downstream of ERK 1/2 have been reported to prevent apoptosis (Franklin and McCubrey, 2000
). Notably p90Rsk, a substrate of ERK 1/2, is affected by DON. p90Rsk is known to phosphorylate Bad which can decrease interaction of this protein with anti-apoptotic Bcl2 family members thereby inhibiting mitochondrial release of cytochrome C. p90Rsk can also mediate CREB phosphorylation which promotes cell survival via transactivation of anti-apoptotic genes such as Bcl-XL (Bonni et al., 1999
). In addition to these downstream mechanisms, MEK, the kinase upstream of ERK 1/2 and the actual target of PD98059, also phosphorylates Bad thereby releasing anti-apoptotic Bcl proteins.
The data presented here demonstrated that DON induced phosphorylation and activation of AKT as well as phosphorylation of its substrates GSK-3ß and FKRH. The AKT anti-apoptotic pathway mediated is perhaps the most widely studied survival pathway and has many facets (Downward, 2004
; Franklin and McCubrey, 2000
). Like p90Rsk, AKT phosphorylates Bad and blocks cytochrome C release from mitochondria (del Peso et al., 1997
; Kennedy et al., 1999
). AKT also promotes phosphorylation of the forkhead transcription factor, FKRH, which results in cytoplasmic retention of FKRH suppressing transcription of pro-apoptotic genes (Brunet et al., 1999
; Downward, 2004
). GSK3 (glycogen synthease kinase-3) is inhibited following phosphorylation by AKT thus promoting storage of glucose as glycogen (Cross et al., 1995
) which promotes survival through a poorly understood mechanism (Downward, 2004
). Another proposed anti-apoptotic mechanism for AKT is activation of the E3 ubiquitiin ligase MdM2 which inhibits both level and function of p53 (Ashcroft et al., 2002
; Gottlieb et al., 2002
; Mayo and Donner, 2001
). The mechanism by which DON activates AKT is unknown but might involve PI3K (Downward, 2004
). One possibility is that the N-terminal cleavage product of RasGAP generated by executioner caspases can directly activate the Ras-PI3KAKT survival pathway (Yang et al., 2004
). Clearly, further exploration of the linkage between PI3K and ribotoxic stress response is needed.
In conclusion, DON induced competing apoptotic and survival pathways in RAW 264.7 macrophages (Fig. 12). There have been over 1500 research publications employing this cell line as a mimic of macrophages during the past 25 years suggesting the veracity of this model. Nevertheless, it will be desirable in the future to validate whether these aforementioned pathways similarly occur in primary macrophage cultures. Towards this end, we have indeed observed that DON induces p38, ERK, and AKT phosphorylation in peritoneal macrophages (data not shown). Future work should also focus on the capacity of other ribotoxins such as abrin to also mediate apoptotic and survival pathways in the macrophage.
|
| SUPPLEMENTARY DATA |
|---|
|
|
|---|
Supplementary data are available online at www.toxsci.oupjournals.org.
| ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service Grant ES03358 (J.J.P.) from the National Institute for Environmental Health Sciences and DK58833 (J.J.P.) from the National Institute for Diabetes, Digestive and Kidney Diseases. We thank Mary Rosner for manuscript preparation and Theresa Bahns for technical assistance. Conflict of interest: none declared.
| REFERENCES |
|---|
|
|
|---|
Adler, S. S., Lowenbraun, S., Birch, B., Jarrell, R., and Garrard, J. (1984). Anguidine: A broad phase II study of the Southeastern Cancer Study Group. Cancer Treat. Rep. 68, 423425.[Web of Science][Medline]
Ammann, H. M. (2003). Is indoor mold contamination a threat to health? Part two. J. Environ. Health 66, 4749.[Medline]
Ashcroft, M., Ludwig, R. L., Woods, D. B., Copeland, T. D., Weber, H. O., and MacRae, E. J. (2002). Phosphorylation of HDM2 by AKT. Oncogene 21, 19551962.[CrossRef][Web of Science][Medline]
Bonni, A., Brunet, A., West, A. E., Datta, S. R., Takasu, M. A., and Greenberg, M. E. (1999). Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and independent mechanism. Science 286, 13581362.
Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S., Anderson, M. J., Arden, K. C., Blenis, J., and Greenberg, M. E. (1999). AKT promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857868.[CrossRef][Web of Science][Medline]
Bukowski, R., Vaughn, C., Bottomley, R., and Chen, T. (1982). Phase II study of anguidine in gastrointestinal malignancies: A Southwest Oncology Group study. Cancer Treat. Rep. 66, 381383.[Web of Science][Medline]
Chipuk, J. E., Kuwana, T., Bouchier-Hayes, L., Drolin, N. M., Newmeyer, D. D., Schuler, M., and Green, D. R. (2004). Direct activation of bax by p53 mediates mitochondrial membrane permeabilization and apoptosis. Science 303, 10101014.
Chung, Y. J., Yang, G. H., Islam, Z., and Pestka, J. J. (2003a). Up-regulation of macrophage inflammatory protein-2 and complement 3A receptor by the trichothecenes deoxynivalenol and satratoxin G. Toxicology 186, 5165.[CrossRef][Web of Science][Medline]
Chung, Y. J., Zhou, H. R., and Pestka, J. J. (2003b). Transcriptional and posttranscriptional roles for p38 mitogen-activated protein kinase in upregulation of TNF-alpha expression by leoxynivalenol (romitoxin). Toxicol. Appl. Pharmacol. 193, 188201.[CrossRef][Web of Science][Medline]
Cobb, M. H. (1999). MAP kinase pathways. Prog. Biophys. Mol. Biol. 71, 479500.[CrossRef][Web of Science][Medline]
Cossarizza, A., Baccarani-Contri, M., Kalashnikova, G., and Franceschi, C. (1993). A new method for the cytofluorimetric analysis of mitochondrial membrane potential using the J-aggregate forming lipophilic cation 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolcarbocyanine iodide (JC-1). Biochem. Biophys. Res. Comm. 197, 4045.[CrossRef][Web of Science][Medline]
Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., and Hemmings, B. A. (1995). Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378, 785789.[CrossRef][Medline]
De Marchi, U., Campello, S., Szabo, I., Tombola, F., Martinou, J-C., and Zoratti, M. (2004). Bax does not directly participate in the Ca2+-induced permeability transition of isolated mitochondria. J. Biol. Chem. 279, 3741537422.
del Peso, L., Gonzalez-Garcia, M., Page, C., Herrera, R., and Nunez, G. (1997). Interleukin-3-induced phosphorylation of BAD through the protein kinase AKT. Science 278, 687689.
Dong, C., Davis, R. J., and Flavell, R. A. (2002). MAP kinases in the immune response. Annu. Rev. Immunol. 20, 5572.[CrossRef][Web of Science][Medline]
Downward, J. (2004). PI 3-kinase, AKT and cell survival. Sem. Cell Devel. Biol. 15, 177182.[CrossRef][Web of Science][Medline]
Erster, S., Mihara, M., Kim, R. H., Petrenko, O., and Moll, U. M. (2004). In vivo mitochondrial p53 translocation triggers a rapid first wave of cell death in response to DNA damage that can precede p53 target gene activation. Molec. Cell. Biol. 24, 67286741.
Etzel, R. A. (2002). Mycotoxins. JAMA 287, 425427.
Fornelli, F., Minervini, F., and Mule, G. (2004). Cytotoxicity induced by nivalenol, deoxynivalenol, and fumonisin B1 in the SF-9 insect cell line. In Vitro Cell Dev. Biol. Anim. 40, 166171.[CrossRef][Web of Science][Medline]
Franklin, R. A., and McCubrey, J. A. (2000). Review: Spotlight on apoptosis: Kinases: Positive and negative regulators of apoptosis. Leukemia 14, 20192034.[CrossRef][Web of Science][Medline]
Gottlieb, T. M., Leal, J. F., Seger, R., Taya, Y., and Oren, M. (2002). Cross-talk between AKT, p53 and Mdm2: Possible implications for the regulation of apoptosis. Oncogene 21, 12991303.[CrossRef][Web of Science][Medline]
Green, D. R. (2003). Overview: Apoptotic signaling pathways in the immune system. Immunol. Revs. 193, 59.[CrossRef][Web of Science][Medline]
Grove, J. F. (1988). Non-macrocyclic trichothecenes. Nat. Prod. Rep. 5, 187209.[CrossRef][Web of Science][Medline]
Grove, J. F. (1993). Macrocyclic trichothecenes. Nat. Prod. Rep. 10, 429448.[CrossRef]
Grove, J. F. (2000). Non-macrocyclic trichothecenes. Part 2. Prog. Chem. Org. Nat. Prod. 69, 170.
Iordanov, M. S., Pribnow, D., Magun, J. L., Dinh, T. H., Pearson, J. A., Chen, S. L., and Magun, B. E. (1997). Ribotoxic stress response: Activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the alpha-sarcin/ricin loop in the 28S rRNA. Mol. Cell Biol. 17, 33733381.[Abstract]
Haupt, S., Berger, M., Goldberg, Z., and Haupt, Y. (2003). Apoptosis the p53 network. J. Cell Sci. 116, 40774085.
Hofseth, L. J., Hussain, S. P., and Harris, C. C. (2004). p53: 25 years after its discovery. Trends Pharmacol. Sci. 25, 177181.[CrossRef][Medline]
Holme, J. A., Morrison, E., Samuelsen, J. T., Wiger, R., Lag, M., Schwarze, P. E., Bernhoft, A., and Refsnes, M. (2003). Mechanisms involved in the induction of apoptosis by T-2 and H2 toxins in HL-60 human promyelocytic leukemia cells. Cell. Biol. Toxicol. 19, 5368.[CrossRef][Web of Science][Medline]
Ji, G. E., Park, S. Y., Wong, S. S., and Pestka, J. J. (1998). Modulation of nitric oxide, hydrogen peroxide and cytokine production in a clonal macrophage model by the trichothecene vomitoxin (deoxynivalenol). Toxicology 125, 203214.[CrossRef][Web of Science][Medline]
Kennedy, S. G., Kandel, E. S., Cross, T. K., and Hay, N. (1999). AKT/protein kinase B inhibits cell death by preventing the release of cytochrome c form mitochondria. Mol. Cell Biol. 19, 58005810.
Kinser, S., Jia, Q., Li, M., Laughter, A., Cornwell, P., Corton, J. C., and Pestka, J. (2004). Gene expression profiling in spleens of deoxynivalenol-exposed mice: Immediate early genes as primary targets. J. Toxicol. Environ. Health A 67, 14231441.[CrossRef][Web of Science][Medline]
Laniel, M. A., Beliveau, A., and Guerin, S. L. (2001). Electrophoretic mobility shift assays for the analysis of DNA-protein interactions. Methods Mol. Biol. 148, 1330.[Medline]
Laskin, J. D., Heck, D. E., and Laskin, D. L. (2002). The ribotoxic stress response as a potential mechanism for MAP kinase activation in xenobiotic toxicity. Toxicol. Sci. 69, 89291.
Marsden, V. S., and Strasser, A. (2003). Control of apoptosis in the immune system: Bcl-2, BH3-only proteins and more. Annu. Rev. Immunol. 21, 71105.[CrossRef][Web of Science][Medline]
Mayo, L. D., and Donner, D. B. (2001). A phosphatidylinositol 3-kinase/AKT pathway promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc. Natl. Acad. Sci. U.S.A. 98, 1159811603.
Miura, K., Aminova, L., and Murayama, Y. (2002). Fusarenon-X induced apoptosis in HL-60 cells depends on caspase activation and cytochrome c release. Toxicology 172, 103112.[CrossRef][Web of Science][Medline]
Moon, Y., and Pestka, J. J. (2002). Vomitoxin-induced cyclooxygenase-2 gene expression in macrophages mediated by activation of ERK and p38 but not JNK mitogen-activated protein kinases. Toxicol. Sci. 69, 373382.
Moon, Y., and Pestka, J. J. (2003a). Cyclooxygenase-2 mediates interleukin-6 upregulation by vomitoxin (deoxynivalenol) in vitro and in vivo. Toxicol. Appl. Pharmacol. 187, 8088.[CrossRef][Web of Science][Medline]
Moon, Y., and Pestka, J. J. (2003b). Deoxynivalenol-induced mitogen-activated protein kinase phosphorylation and IL-6 expression in mice suppressed by fish oil. J. Nutr. Biochem. 14, 717726.[CrossRef][Web of Science][Medline]
Moon, Y., Uzarski, R., and Pestka, J. J. (2003). Relationship of trichothecene structure to COX-2 induction in the macrophage: Selective action of type B (8-keto) trichothecenes. J. Toxicol. Environ. Health A 66, 19671983.[Web of Science][Medline]
Nagase, M., Alam, M. M., Tsushima, A., Yoshizawa, T., and Sakato, N. (2001). Apoptosis induction by T-2 toxin: Activation of caspase-9, caspase-3, and DFF-40/CAD through cytosolic release of cytochrome c in HL-60 cells. Biosci. Biotechnol. Biochem. 65, 17411747.[Medline]
Nagase, M., Shiota, T., Tsushima, A., Murshedul Alam, M., Fukuoka, S., Yoshizawa, T., and Sakato, N. (2002). Molecular mechanism of satratoxin-induced apoptosis in HL-60 cells: Activation of caspase-8 and caspase-9 is involved in activation of caspase-3. Immunol. Lett. 84, 2327.[CrossRef][Web of Science][Medline]
Narayanan, S., Surolia, A., and Karande, A. A. (2004). Ribosome-inactivating protein and apoptosis: abrin causes cell death via mitobhondrial pathway in Jurkat cells. Biochem. J. 377, 233240.[CrossRef][Web of Science][Medline]
Oren, M. (2003). Decision making by p53: Life, death and cancer. Cell Death Differ. 10, 431442.[CrossRef][Web of Science][Medline]
Orrenius, S. (2004). Mitochondrial regulation of apoptotic cell death. Toxicol. Lett. 149, 1923.[CrossRef][Web of Science][Medline]
Pae, H. O., Oh, G. S., Choi, B. M., Seo, E. A., Oh, H., Shin, M. K., Kim, T. H., Kwon, T. O., and Chung, H. T. (2003). Induction of apoptosis by 4-acetyl-12,13-epoxyl-9-trichothecene-3,15-diol from Isaria japonica Yasuda through intracellular reactive oxygen species formation and caspase-3 activation in human leukemia HL-60 cells. Toxicol. In Vitro 17, 4957.[CrossRef][Web of Science][Medline]
Pestka, J. J. (2003). Deoxynivalenol-induced IgA production and IgA nephropathy-aberrant mucosal immune response with systemic repercussions. Toxicol. Lett. 140141, 287295.[CrossRef]
Pestka, J. J., and Smolinski, A. (2005). Deoxynivalenol: Toxicology and potential effects on humans. J. Toxicol. Environ. Health, Part B 8, 1.
Pestka, J. J., Zhou, H. R., Moon, Y. Y., and Chung, Y. J. (2004). Cellular and molecular mechanisms for immune modulation by deoxynivalenol and other trichothecenes: Unraveling a paradox. Toxicol. Lett. 153, 6173.[CrossRef][Web of Science][Medline]
Pluquet, O., and Hainaut, P. (2001). Genotoxic and non-genotoxic pathways of p53 induction. Cancer Lett. 174, 115.[CrossRef][Web of Science][Medline]
Schaeffer, H. J., and Weber, M. J. (1999). Mitogen-activated protein kinases: Specific messages from ubiquitous messengers. Mol. Cell Biol. 19, 24352444.
Sellins, K. S., and Cohen, J. J. (1987). Gene induction by gamma-radiation leads to DNA fragmentation in lymphocytes. J. Immunol. 139, 31993206.[Abstract]
Shifrin, V. I., and Anderson, P. (1999). Trichothecene mycotoxins trigger a ribotoxic stress response that activates c-Jun N-terminal kinase and p38 mitogen-activated protein kinase and induces apoptosis. J. Biol. Chem. 274, 1398513992.
Sudakin, D. L. (2003). Trichothecenes in the environment: Relevance to human health. Toxicol. Lett. 143, 97107.[CrossRef][Web of Science][Medline]
Ueno, Y. (1984). Toxicological features of T-2 toxin and related trichotnecenes. Fundam Appl. Toxicol. 4 S124S132.
Widmann, C., Gibson, S., Jarpe, M. B., and Johnson, G. L. (1999). Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol. Rev. 79, 143180.
Wong, S. S., Zhou, H. R., Marin-Martinez, M. L., Brooks, K., and Pestka, J. J. (1998). Modulation of IL-1beta, IL-6 and TNF-alpha secretion and mRNA expression by the trichothecene vomitoxin in the RAW 264.7 murine macrophage cell line. Food Chem. Toxicol. 36, 409419.[CrossRef][Web of Science][Medline]
Yang, G., Jarvis, B. B, Chung, Y., and Pestka, J. J. (2000). Apoptosis induction by the satratoxins and other trichothecene mycotoxins: Relationship to ERK, p38 MAPK and SAPK/JNK Activation. Toxicol. Appl. Pharmacol. 164, 149160.[CrossRef][Web of Science][Medline]
Yang, J. Y., Michod, D., Walicki, J., and Widmann, C. (2004). Surviving the kiss of death. Biochem. Pharmacol. 68, 10271031.[CrossRef][Web of Science][Medline]
Zapor, M., and Fishbain, J. T. (2004). Aerosolized biologic toxins as agents of warfare and terrorism. Respir. Care Clin. N. Am. 10, 111122.[CrossRef][Medline]
Zhou, H. R., Lau, A. S., and Pestka, J. J. (2003a). Role of double-stranded RNA-activated protein kinase R (PKR) in deoxynivalenol-induced ribotoxic stress response. Toxicol. Sci. 74, 335344.
Zhou, H. R., Yan, D., and Pestka, J. J. (1997). Differential cytokine mRNA expression in mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): Dose response and time course. Toxicol. Appl. Pharmacol. 144, 294305.[CrossRef][Web of Science][Medline]
Zhou, H. R., Islam, Z., and Pestka, J. J. (2003b). Rapid, sequential activation of mitogen-activated protein kinases and transcription factors precedes proinflammatory cytokine mRNA expression in spleens of mice exposed to the trichothecene vomitoxin. Toxicol. Sci. 72, 130142.
Zhou, H. R., Jia, Q., and Pestka, J. J. (2005). Ribotoxic stress response to the trichothecene deoxynivalenol in the macrophage involves the Src family kinase Hck. Toxicol. Sci. 85, 916926
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
Y. Shi, K. Porter, N. Parameswaran, H. K. Bae, and J. J. Pestka Role of GRP78/BiP Degradation and ER Stress in Deoxynivalenol-Induced Interleukin-6 Upregulation in the Macrophage Toxicol. Sci., June 1, 2009; 109(2): 247 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Bae and J. J. Pestka Deoxynivalenol Induces p38 Interaction with the Ribosome in Monocytes and Macrophages Toxicol. Sci., September 1, 2008; 105(1): 59 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li and J. J. Pestka Comparative Induction of 28S Ribosomal RNA Cleavage by Ricin and the Trichothecenes Deoxynivalenol and T-2 Toxin in the Macrophage Toxicol. Sci., September 1, 2008; 105(1): 67 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Pestka, I. Yike, D. G. Dearborn, M. D. W. Ward, and J. R. Harkema Stachybotrys chartarum, Trichothecene Mycotoxins, and Damp Building-Related Illness: New Insights into a Public Health Enigma Toxicol. Sci., July 1, 2008; 104(1): 4 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Buck and M. Chojkier C/EBP phosphorylation rescues macrophage dysfunction and apoptosis induced by anthrax lethal toxin Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1788 - C1796. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Islam, C. J. Amuzie, J. R. Harkema, and J. J. Pestka Neurotoxicity and Inflammation in the Nasal Airways of Mice Exposed to the Macrocyclic Trichothecene Mycotoxin Roridin A: Kinetics and Potentiation by Bacterial Lipopolysaccharide Coexposure Toxicol. Sci., August 1, 2007; 98(2): 526 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, J. R. Harkema, C. F. Cuff, and J. J. Pestka Deoxynivalenol Exacerbates Viral Bronchopneumonia Induced by Respiratory Reovirus Infection Toxicol. Sci., February 1, 2007; 95(2): 412 - 426. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||













