Skip Navigation


ToxSci Advance Access originally published online on June 15, 2005
Toxicological Sciences 2005 87(1):66-74; doi:10.1093/toxsci/kfi231
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
87/1/66    most recent
kfi231v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Garrett, S. H.
Right arrow Articles by Sens, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garrett, S. H.
Right arrow Articles by Sens, D. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org

Expression of Metallothoinein Isoform 3 Is Restricted at the Post-Transcriptional Level in Human Bladder Epithelial Cells

Scott H. Garrett*, Seongmi Park*, Mary Ann Sens*, Seema Somji*, Rajendra K. Singh*, Venugopal B. R. K. Namburi* and Donald A. Sens{dagger},1

* Department of Pathology, and {dagger} Department of Surgery, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, North Dakota 58202

1 To whom correspondence should be addressed at Department of Surgery, School of Medicine and Health Sciences, University of North Dakota, 501 N. Columbia Road, Grand Forks, ND 58202. Fax: (701) 777-3108. E-mail: dsens{at}medicine.nodak.edu.

Received April 26, 2005; accepted June 10, 2005


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study was designed to define the effect that overexpression of MT-3 would have on a cell culture model of bladder urothelium. Stable and inducible transfection was used to achieve overexpression of the MT-3 gene in the UROtsa cell line. When the UROtsa cells were stably transfected with the MT-3 coding sequence, there was highly elevated expression of MT-3 mRNA, but no MT-3 protein. An inducible vector showed that low basal levels of MT-3 mRNA and protein could be produced, but that induction only increased MT-3 mRNA and not protein. The clones expressing low basal levels of MT-3 protein also had reduced growth rates compared to control cells. Site directed mutagenesis was used to produce an MT-3 coding sequence where the prolines in positions 7 and 9 were converted to threonines. When this altered MT-3 was stably transfected into the UROtsa cells, the cells were able to accumulate the mutated form of the MT-3 protein. These studies show that MT-3 protein expression is inhibited by post-transcriptional control in the urothelial cell. Modifying the MT-3 protein to resemble the MT-1 isoform removes this component of post-transcriptional control and allows accumulation of the mutated MT-3 protein. The altered sequence involved in post-transcriptional control of MT-3 protein expression is the same sequence implicated in the neuronal growth inhibitory activity associated specifically with the MT-3 isoform of the MT gene family.

Key Words: metallothionein; bladder cancer; cadmium; urothelium; UROtsa; post-transcriptional control; growth inhibitory factor.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This laboratory has shown using archival paraffin-embedded diagnostic tissue that the third isoform of metallothionein (MT-3) is overexpressed in human bladder cancer and that the level of expression correlates to the grade of the tumor (Sens et al., 2000Go). In contrast, using both archival and fresh bladder tissue, it was shown that normal urothelium has no expression of MT-3 mRNA or protein. These findings show that at some point during malignant transformation, urothelial cells gain the ability to express MT-3 mRNA and protein. These findings were found to be similar in cell culture models of the human bladder. An analysis of MT-3 expression in four commonly utilized bladder cancer cell lines demonstrated that all expressed both MT-3 mRNA and protein (Garrett et al., 2000bGo). A similar analysis of MT-3 expression in the UROtsa cell line, an immortalized, but non-tumorigenic, model of normal human urothelium, demonstrated no expression of either MT-3 mRNA or protein; consistent with the in situ finding for normal urothelium (Rossi et al., 2001Go). The goal of the present study was to employ stable transfection technology to determine the effects that MT-3 expression would have on the UROtsa cell line and on its response when exposed to cadmium (Cd+2).

This study is part of an overall goal of defining the relationship between cadmium (Cd+2) exposure, the expression of the MT gene family, and the development of cancer. To date, there is strong evidence to directly link any of the two with one another, but only indirect evidence for a linkage among the three entities. There is a strong relationship between cadmium exposure and carcinogenesis, as Cd+2 is accepted as a human carcinogen and exposure has been associated in some studies with the development of bladder cancer (IARC, 1993Go; Siemiatycki et al., 1994Go; Waalkes, 2000Go). Furthermore, this laboratory has shown that the UROtsa cell line can be directly malignantly transformed by Cd+2, and that the resulting tumor heterotransplants display a histology consistent with transitional cell carcinoma (Sens et al., 2004Go). A relationship between Cd+2 and MT also exists, as Cd+2 is sequestered inside the cell through high affinity binding to the MT protein (Hamer, 1986Go). The MTs are a family of low molecular weight (6kD), intracellular proteins that have a very high conserved number of cysteine residues that allow the efficient binding of transition metals (Hamer, 1986Go). This gene family has been extensively studied and is believed to serve an important role in the homeostasis of essential metals such as Zn+2 and Cu+2 during growth and development as well as in the detoxification of heavy metals such as Cd+2 and Hg+2; rendering the MTs important mediators and attenuators of heavy metal-induced toxicity (Andrews, 2000Go; Cousins, 1983Go; Goering and Klaassen, 1983Go; Hamer, 1986Go; Kägi, 1993Go; Kägi and Hunziker, 1989Go). The evidence for an alteration of MT expression in cancer is also strong, but more indirect, in that the association with MT has been as a prognostic marker for many human cancers. In general, these studies show an association of MT-1/2 overexpression with the type, grade, and aggressiveness of tumors (Cherian et al., 2003Go; Jasani and Schmid, 1997Go; Theocharis et al., 2004Go). In colonic carcinoma (Guiffrè et al., 1996Go; Öfner et al., 1994Go) MT overexpression is more frequently associated with more differentiated lower grade tumors. In contrast, in ductal breast cancer (Bier et al., 1994Go; Douglas-Jones et al., 1995Go; Fresno et al., 1993Go; Goulding et al., 1995Go; Haerslev et al., 1994Go; Oyama et al., 1996Go; Schmid et al., 1993Go), skin carcinomas (Zelger et al., 1994Go) and melanomas (Zelger et al., 1993Go), cervical cancer (Lim et al., 1996Go), acute lymphoblastic leukemia (Sauerbrey et al., 1994Go), and pancreatic carcinomas (Ohishio et al., 1996Go) MT-1/2 overexpression is predominantly associated with the more malignant, higher grade tumors. Furthermore, MT overexpression also correlates with anticancer drug resistance (Kelly et al., 1988Go). This is illustrated effectively by studies in transitional cell carcinoma of the urinary tract that show that overexpression of the MT-1 and MT-2 protein is correlated with development of cisplatin resistance (Bahnson et al., 1991Go, 1994Go; Kotoh et al., 1994Go). The present study was designed to determine how the forced expression of MT-3 would affect the urothelial cell.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture.
Stock cultures of the UROtsa cell line were grown in serum-free growth medium as described by Rossi and coworkers (Rossi et al., 2001Go). Briefly, the growth medium was composed of a 1:1 mixture of Dulbecco's modified Eagles' medium (DMEM) and Ham's F-12 supplemented with selenium (5 ng/ml), insulin (5 µg/ml), transferrin (5 µg/ml), hydrocortisone (36 ng/ml), triiodothyronine (4 pg/ml), and epidermal growth factor (10 ng/ml). The cells were fed fresh growth medium every three days, and at confluence, the cells were subcultured at a 1:4 ratio using trypsin-EDTA (0.05%, 0.02%). For use in experimental protocols, cells were subcultured at a 1:4 ratio, allowed to reach confluence (nine days following subculture) and then used in the described experimental protocols. Preliminary experiments were performed to determine the approximate concentrations of CdCl2 that would result in cell toxicity over a 16-day period of exposure. From these preliminary determinations three concentrations of Cd+2 were chosen for the UROtsa cells; 1, 5, and 9 µM. These concentrations were chosen such that over the 16 day period, one concentration would always result in minimal cell death and another would result in appreciable cell death early in the time course. Cell viability, as a measure of cytotoxicity, was determined by measuring the capacity of the cells to reduce MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) to formazan (Rossi et al., 2002Go). Cell growth rates were also determined using the MTT assay following a 1:10 subculture of the cells. Triplicate cultures were analyzed for each time point and concentration. The conditions for the growth of the PC-3, MCF-7, T-47D, Hs578T, and MDA-MB-231 prostate and breast cancer cell lines has been described previously (Dutta et al., 2002Go; Gurel et al., 2003Go).

Stable transfection of UROtsa cells with the wild-type and mutated MT-3 coding sequence under the control of the CMV promoter.
The MT-3 coding sequence was cloned from cultured human proximal tubule cell RNA by RT-PCR using primers described previously (Dutta et al., 2002Go; Gurel et al., 2003Go; Kim et al., 2002Go). The sequence was blunt end ligated into the EcoR V site of pcDNA3.1/Hygro (+) (Invitrogen, Carlsbad, CA), placing the MT-3 sequence under unregulated control of the CMV promoter. The DNA construct was linearized by Fsp I before transfection. The cells were transfected with the MT-3 plasmid construct in the sense direction or the vector alone (blank vector) by using the EffecteneJ transfection reagent (Qiagen) as described previously (Dutta et al., 2002Go; Kim et al., 2002Go). Clones were selected using cloning rings and the stable transfectants were identified, recloned, and preserved in liquid nitrogen storage.

Studies by Sewell and coworkers (1995)Go demonstrated that the two prolines at amino acid positions 7 and 9 were essential for the neuronal growth inhibitory activity that is specific to the MT-3 isoform of the MT gene family. This was shown using site directed mutagenesis where these prolines were substituted with threonines. In the present study, the MT-3 coding sequence cloned above from human proximal tubule cells into the pcDNA3.1/Hygro (+) vector was subcloned into the BamH1/Xba1 site of pAlter-1, a vector which allows for the selection of mutated plasmids. Mutagenesis was performed per the manufactures instructions utilizing the MT-3 mutagenesis oligo: GGAGCCACCAGAAGTGCAGGTGCAGGTCTCA (bold bases designate G to T substitutions). Clones were isolated and verified by sequencing. The mutated MT-3 coding sequence was then subcloned back into pcDNA3.1/Hygro (+) and stably transfected into UROtsa cells as described above for the wild type coding sequence.

Stable transfection of UROtsa cells with MT-3 under control of an inducible vector.
The LacSwitch II Inducible Mammalian Expression System (Stratagene) was employed to isolate stable transfectants of UROtsa cells where MT-3 is under the control of an inducible promoter. The first step in establishing this expression system was to transfect the UROtsa cells with pCMV/LacI and isolate Lac-repressor expressing clones. This was done by transfecting the FspI linearized constuct utilizing the Effectene transfection reagent (Qiagen) at a ratio of 1:10 plasmid to lipid and 2 µg of DNA per 9.6 cm2 culture well. Clones were selected on 60 µg/ml of hygromycin B, isolated with cloning rings, expanded, and assessed for the expression of the repressor protein by Western analysis with the Lac-repressor antibody provided by Promega. The highest Lac-repressor expressing clone was designated to receive the second vector. The neomycin resistance gene in the second vector, pOPRSVI/MCS, was replaced with the blasticidin resistance gene from the pTracer-EF/Bsd A vector (Invitrogen) because the UROtsa cells already contain a neomycin resistance gene. For this, an XbaI-FspI fragment from pTracer-EF/Bsd A, containing the blasticidin resistance gene driven by the CMV promoter was blunt-end ligated into the BsaAI site of the pOPRSVI/MCS vector, after 5'-overhangs were filled with Klenow Fragment DNA polymerase I. The resulting vector was termed pOPRSVI/bsd. The MT-3 coding sequence was removed from pcDNA3.1/Hygro (+) via KpnI/NotI digestion and subcloned into the corresponding site in the pOPRSVI/bsd vector as the final MT-3 expression construct. The highest expressing LacI UROtsa clone was transfected with FspI linearized pOPRSVI/bsd-MT-3 and secondary clones were selected with 2.5 µg/ml blasticdiin and subsequently expanded. Each clone was tested for induced expression of MT-3 specific mRNA using RT-PCR on total RNA from control and 2.5 mM IPTG treated cells.

Isolation of total RNA and RT-PCR.
The procedures for the isolation of total RNA and analysis of MT gene expression by RT-PCR have been described previously (Garrett et al., 1999aGo, 2000aGo). Controls for each PCR included a no-template control where water was added instead of the RNA and a no-reverse-transcriptase control where water was added instead of the enzyme. Samples were removed at appropriate intervals between 18 and 40 PCR cycles to ensure that the reaction remained in the linear region. The final PCR products were electrophoresed on 2% agarose gels containing ethidium bromide along with DNA markers. The intensity (integrated optical density, IOD) of the PCR product bands was determined on a Dell workstation configured with Kontron KS 400 image analysis software.

MT protein determination.
The immuno-blot protocol used for the determination of the levels of the MT-1/2 and MT-3 protein in cell lysates has been described previously by this laboratory (Garrett et al., 1999aGo, 2000aGo).

Statistical analysis.
All experiments were performed in triplicate. Statistical analyses were performed using Systat7 software using separate variance t-tests and ANOVA with Tukey post-hoc testing. Unless otherwise stated, the level of significance was 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
UROtsa Cells Stably Transfected with MT-3 under the Control of the CMV Promoter Express MT-3 mRNA but No MT-3 Protein
This laboratory has previously demonstrated using RT-PCR at a total RNA input of 500 ng and 40 reaction cycles that the UROtsa cell line has no basal expression of MT-3 mRNA (Rossi et al., 2001Go). It was also shown in these studies that UROtsa cells could be stably transfected with the MT-3 coding sequence following ligation into the EcoR V site of pcDNA3.1/Hygro (+), placing the MT-3 sequence under unregulated control of the CMV promoter. A blank vector control was also generated using identical methodology. An analysis of several independent clones of these stably MT-3 transfected UROtsa cells demonstrated that each overexpressed MT-3 mRNA when compared to wild type cells or cells containing the blank pcDNA3.1 vector. The MT-3 mRNA was first detected from the overexpressing clones between 20 and 25 cycles of PCR using 500 ng total RNA inputs. The level of MT-3 mRNA expression in the transfected UROtsa cells was similar to that of the g3pdh housekeeping gene and the level of g3pdh expression was not altered by the transfection protocol (data not shown). As shown in Figure 1A, the relative level of MT-3 mRNA expression of five independent clones of MT-3 transfected UROtsa cells was similar to that obtained in previous studies where the MT-3 sequence was transfected into the MT-3 null background of the PC-3 prostate cancer cell line (Dutta et al., 2002Go) and the MCF-7, T-47D, Hs578T, and MDA-MB-231 breast cancer cell lines (Gurel et al., 2003Go).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1. The relative expression of MT-3 mRNA and protein in UROtsa cells, breast cancer cells, and prostate cancer cells stably transfected with the MT-3 coding sequence. Panel (A) shows the relative expression of MT-3 mRNA in the blank vector controls and clones of the MT-3 transfected UROtsa cells compared to the relative expressions of MT-3 found previously for MT-3 transfected MCF-7, T-47D, MDA-MB-231, Hs578T, and PC-3 cell lines (Dutta et al., 2002Go; Gurel et al., 2003Go). There was no statistical difference (p > 0.05) between MT-3 mRNA expression in the UROtsa MT-3 stable transfectants and the stable MT-3 transfectants of the MCF-7, T-47D, MDA-MB-231, Hs578T, and PC-3 cell lines. Panel (B) shows the corresponding expression of MT-3 protein for the above cell lines. All determinations were performed in triplicate. There was a statistical difference (p < 0.001) between MT-3 protein expression in the UROtsa MT-3 stable transfectants and the stable MT-3 transfectants of the MCF-7, T-47D, MDA-MB-231, Hs578T, and PC-3 cell lines.

 
In contrast to MT-3 mRNA expression, a corresponding analysis of MT-3 protein expression in each of the five MT-3 expressing clones demonstrated a very low level of MT-3 protein expression in the MT-3 transfected UROtsa cells, with expression being at or near the detection limit of the assay (Fig. 1B). This finding was in marked contrast to that found in the previous studies cited above where MT-3 was transfected into the PC-3 and the MCF-7, T-47D, Hs578T, and MDA-MB-231 cell lines. In these studies, all five cell lines demonstrated significant increases in MT-3 protein that correlated with the increased expression of MT-3 mRNA (Fig. 2B). To determine if MT-3 protein expression might be an artifact generated by which MT-3 transfected clones were chosen for analysis, an additional 14 randomly chosen clones of the MT-3 transfected UROtsa cells were assessed for the expression of MT-3 mRNA and protein (Figs. 2A and 2B). It was demonstrated that all 14 clones expressed similar relative amounts of MT-3 mRNA when assessed against the expression of the g3pdh gene (Fig. 2A). In contrast, all 14 clones failed to express appreciable levels of MT-3 protein (Fig. 2B).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. The relative expression of MT-3 mRNA and protein in 14 independent isolates of UROtsa cells stably transfected with the MT-3 coding sequence. Panel (A) shows the expression of MT-3 mRNA relative to that of the g3pdh housekeeping gene for 14 clones of UROtsa cells stably transfected with the MT-3 gene. The relative IODs were calculated from the IOD of the product bands obtained at 500 ng total RNA inputs and 30 cycles and normalized to that of g3pdh at 30 cycles of PCR. The relative expression level for MCF-7 cells transfected with MT-3 is shown for comparison. Panel (B) shows the corresponding expression of MT-3 protein for each of the 14 clones. The protein level for MCF-7 cells transfected with MT-3 is shown for comparison. All determinations were performed in triplicate.

 
UROtsa Cells Stably Transfected with MT-3 under Control of a Regulated Promoter Can Induce MT-3 mRNA Expression, but Not MT-3 Protein
The LacSwitch II system was utilized to isolate stable transfectants of UROtsa cells where the MT-3 coding sequence was under the control of an inducible promoter, in this case the lac promoter system that is inducible by treatment with IPTG. The protocol resulted in the generation of slow growing clones of cells and three of the clones which appeared to have the fastest growth rates were examined in detail for MT-3 mRNA and protein expression. Each of the three clones was noted to produce a low basal level of MT-3 mRNA in the absence of exogenous inducer, a measure of the "leakiness" of the promoter to repression (Fig. 3). The basal expression of MT-3 mRNA was determined using a total RNA input of 500 ng and 40 cycles of PCR. The level of MT-3 protein was determined for each clone under basal conditions and each was found to produce a low, but measurable level of MT-3 protein (Table 1). The levels of MT-3 mRNA and protein were then determined in each of the three clones following a 48 h exposure to 2.5 mM IPTG. Treatment with IPTG was shown to induce the expression of MT-3 mRNA in each of the three clones (Fig. 3). The induced expression of MT-3 mRNA was determined using a total RNA input of 500 ng and 37 cycles of PCR. In contrast to the increased MT-3 mRNA levels, the level of MT-3 protein did not increase following the 48 h treatment with IPTG (Table 1). Extending exposure to IPTG for up to 10 days or raising the IPTG concentration to 5 mM had no effect on MT-3 protein expression (data not shown).



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 3. Expression of MT-3 mRNA in UROtsa cells stably transfected with the Lac switch II inducible mammalian expression system. The basal (–IPTG) and inducible (+IPTG) expression of MT-3 mRNA was determined on three independent clones of UROtsa cells stably transfected with MT-3 using the above vector system. The basal expression of MT-3 was determined using RT-PCR at a total RNA input of 500 ng and 40 cycles of PCR. The inducible expression of MT-3 was determined following a 48 h exposure to 2.5 mM IPTG at a 500 ng total RNA input and 37 cycles of PCR.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1 MT-3 Protein Expression in LacSwitch Clones

 
The growth rates (doubling times) of the three clones and a blank vector control were also determined in the presence and absence of 2.5 mM IPTG from linear regions of each respective growth curve following a 1:20 subculture of the cells (Table 2). The doubling time of the cells carrying the blank vector control was between 26 and 29 h, which is similar to that found previously for the parental UROtsa cell line (Rossi et al., 2001Go). Two of the three MT-3 transfected clones (#1 and #3) exhibited significantly increased doubling times compared to the blank vector control and these were the two clones with the highest basal expression of the MT-3 protein (Tables 1 and 2). The other MT-3 transfected clone (#2) also displayed a significant increase in doubling time compared to the blank vector control; however, the magnitude of the increase was far less when compared to the other two MT-3 clones (Table 2). This clone (#2) also had the lowest basal expression of the MT-3 protein (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 2 Growth Rates of UROtsa MT-3 LacSwitch Clones

 
Conversion of the Prolines at Positions 7 and 9 of MT-3 to Threonines Allows the Accumulation of MT-3 Mutated Protein in Stably Transfected UROtsa Cells
The two prolines at amino acid positions 7 and 9 have been shown to be essential for the growth inhibitory activity of MT-3 (Sewell et al., 1995Go). This was shown by converting the prolines at positions 7 and 9 to threonines and showing that this mutated MT-3 was no longer active in neuronal survival assays. In the present study, a construct where prolines 7 and 9 of MT-3 were converted to threonines was stably transfected into UROtsa cells to determine if this conversion would have an effect on the accumulation of MT-3 protein. Four clones of UROtsa cells were randomly chosen following antibiotic selection and characterized for the expression of the mutated MT-3 mRNA and protein. Each of the four clones were shown to express mRNA for the mutated construct at levels similar to those shown above for UROtsa cells stably transfected with the non-mutated MT-3 coding sequence (data not shown). An analysis of mutant MT-3 protein expression demonstrated that each of the four clones accumulated the mutated MT-3 protein at levels between 2 and 3 ng mutated MT-3 protein/µg total cell protein (Fig. 4). This is in contrast to parental UROtsa cells, UROtsa cells stably transfected with the blank vector, and UROtsa cells stably transfected with wild type MT-3, which accumulate only background levels of MT-3 protein.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 4. Expression of the mutated MT-3 protein stably transfected into UROtsa cells under control of the CMV promoter. The UROtsa cell line was stably transfected with the pcDNA3.1/Hygro (+) vector containing a mutated form of MT-3 where the prolines at position 7 and 9 had been converted to threonines. This mutated sequence was ligated into the EcoR V site of pcDNA3.1/Hygro (+), placing the sequence under unregulated control of the CMV promoter. Five independent clones of UROtsa cells (Mut4 #1 through 5) were assessed for the expression of the mutant MT-3 protein. Shown for comparison is MT-3 protein expression in the parental UROtsa cell line (UROtsa), a UROtsa clone containing a blank vector control (3.1), and two clones of UROtsa cells stably transfected with the legitimate MT-3 sequence under the control of the CMV promoter (MT-1 #1 and #2). All determinations were in triplicate. The values are the mean ± SEM. All Mut4 values are significantly different compared to the controls (p < 0.001).

 
Cadmium Exposure Does Not Enhance MT-3 Protein Expression in UROtsa Cells Stably Transfected with the MT-3 Gene
In addition to inducing transcription, there is evidence that exposure of cells to Cd+2 can increase the level of the MT-1 and MT-2 protein at the post-transcriptional level by stabilizing the protein against degradation (Vasconcelos et al., 1996Go, 2002Go). For this reason, expression of the MT-3 protein was determined for the UROtsa cell line stably transfected with the MT-3 gene following exposure for 96 h to lethal and sub-lethal levels of Cd+2. The concentrations employed were shown to produce both lethal (5 and 9 µM) and sub-lethal (1 µM) responses over a 16 day time course of exposure to Cd+2 (Fig. 5A). It was shown that both lethal and sub-lethal exposures to Cd+2 had no effect on the expression of the MT-3 protein by the MT-3 transfected cells compared to control at any point in the time course (Fig. 5B). As a control, it was shown that an identical exposure to Cd+2 produced significant increases in the MT-1/2 protein at all concentrations of Cd+2 by 24 h of exposure (Fig. 5C). There was no difference in toxicity to Cd+2 among the UROtsa parental cell line, the UROtsa cells transfected with the blank vector control, or the UROtsa cells stably transfected with the MT-3 sequence (data not shown). Similarly, there was no difference in Cd+2 toxicity among 4 MT-3 transfected UROtsa cell clones (data not shown). The expression of MT-3 protein by parental UROtsa cells exposed to the above concentrations of Cd+2 was identical to that of the MT-3 transfected cells (data not shown).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 5. Effect of Cd+2 exposure on MT-3 protein expression by UROtsa cells stably transfected with the MT-3 gene. Panel (A) shows the cell viability when confluent UROtsa cells stably transfected with the MT-3 coding sequence are exposed to 1.0 ({blacksquare}), 5.0 ({blacktriangleup}), and 9.0 ({blacktriangledown}) µM Cd+2 for 16 days. Cell viability was determined by the MTT assay and all determinations were in triplicate. Values shown are the percentage of the mean cell numbers at each time point divided by the mean cell numbers of the control cells for each triplicate determination. Panel (B) shows the expression of the MT-3 protein when cells are exposed for 96 h to 0 ({blacksquare}), 1.0 ({blacktriangleup}), 5.0 ({blacktriangledown}), and 9.0 (shaded diamond) µM Cd+2. The determinations were performed in triplicate and the results shown are the mean ± SEM. There was no significant difference between Cd+2-exposed cells and the control at any time point (p > 0.05). Panel (C) shows the expression of the MT-1/2 protein when cells are exposed for 96 h to 0 ({blacksquare}), 1.0 ({blacktriangleup}), 5.0 ({blacktriangledown}), and 9.0 (shaded diamond) µM Cd+2. The determinations were performed in triplicate and the results shown are the mean ± SEM. Asterisks denote a significant difference from control (p < 0.05).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The original goal of this study was to determine the effect of MT-3 expression on the structural and functional properties of UROtsa cells, a cell culture model of human urothelial cells. The strategy employed was to stably transfect the MT-3 coding sequence under the control of the CMV promoter into the UROtsa cells, a technique used routinely by this laboratory in the past to overexpress MT-3 mRNA and protein in several different types of cultured cells (Dutta et al., 2002Go; Gurel et al., 2003Go; Kim et al., 2002Go). However, stable transfection of the MT-3 coding sequence into the UROtsa cells did not produce the results expected from the previous studies. The analysis of numerous independent clones from the transfection protocol demonstrated consistently that, while the stable transfection did result in the expected overexpression of MT-3 mRNA, the level of MT-3 protein did not increase significantly over the background levels found in parent cells and cells containing the blank vector control. The most obvious explanation for the above finding would be a technical artifact associated with the transfection protocol. To eliminate this possibility, the sequence of the present vector was compared to that used in previous cell lines where MT-3 transfection resulted in the production of MT-3 mRNA and protein. These studies included the stable transfection of MT-3 into the PC-3 prostate cancer cell line, the MCF-7, Hs578T, T-47D, and MDA-MB-231 breast cancer cell lines and the HK-2 renal proximal tubule cell line where stable transfection with MT-3 resulted in the elevated expression of both MT-3 mRNA and protein (Dutta et al., 2002Go; Gurel et al., 2003Go; Kim et al., 2002Go). No differences were found between the present and past vectors that would prevent the translation of MT-3 mRNA into MT-3 protein. Thus, it can be concluded that the failure of the stable transfectants of UROtsa cells to express MT-3 protein is caused by a specific property of the cellular environment and not a technical artifact associated with the transfection protocol.

This laboratory has previously shown that the UROtsa cell line has basal expression of MT-1 and MT-2 isoform-specific mRNAs and MT-1/2 protein, and that exposure to Cd+2 increases the expression of MT-1 and MT-2 isoform-specific mRNAs and the MT-1/2 protein (Sens et al., 2003Go). This finding indicates that, in contrast to the MT-3 protein, the MT-1/2 protein can accumulate in UROtsa cells. This is important information since there is a 63 to 69% sequence homology between MT-3 and the other MT family members (Sewell et al., 1995Go). An examination of the sequence between MT-3 and the other MT family members indicates two significant differences in sequence that are present in MT-3 but not the other family members. The first difference is that MT-3 isoform has a unique C-terminal 7 amino acid sequence not found in any of the other MT family members (Palmiter et al., 1992Go; Tsuji et al., 1992Go; Uchida et al., 1991Go). This sequence has allowed this laboratory (Garrett et al., 1999bGo) and others (Uchida et al., 1991Go) to generate an MT-3 antibody that recognizes only the MT-3 isoform. This C-terminal sequence has also been shown to have functional significance for the MT-3 molecule. This was convincingly shown by a study which produced a series of variants by site-directed mutagenesis around the EAAEAE hexapeptide (Zhang et al., 2003Go). It was demonstrated that this sequence was essential to the unique properties displayed by MT-3 as regards metal binding compared to the other MT isoforms. Specifically, it was shown that this hexapeptide insert renders the MT-3 {alpha}-domain looser and lowers the stability of the metal-thiolate cluster, rendering the binding site more accessible for exchange mechanisms with other partners (Zhang et al., 2003Go). The other unique amino acid of MT-3 is the single amino acid addition (Thr) at position 5 in the N-terminal region. This amino acid insert has been shown to partially mediate the neuronal cell growth inhibitory activity (Romero-Isart et al., 2002Go) which is not duplicated b the other human MT classes (Amoureux et al., 1995Go; Sewell et al., 1995Go; Uchida et al., 1991Go). Mutating the conserved C (6)-P-C-P (9) MT-3 motif to the common MT consensus sequence C (6)-S-C-A (9) abolished the biological activity of the protein (Sewell et al., 1995Go). As such, both threonine 5 and prolines 7 and 9 are required for growth inhibitory activity (Romero-Isart et al., 2002Go) and even changing one proline to a serine or alanine in the presence of threonine 5 is enough to abolish growth inhibitory activity (Hasler et al., 2000Go). It was demonstrated in the present study that this unique N-terminal sequence of MT-3 was the epitope preventing accumulation of the MT-3 protein in the UROtsa cells. Converting this N-terminal sequence to one resembling that found in the MT-1 and MT-2 family members allowed the accumulation of this mutant form of the MT-3 protein in UROtsa cells that had been stably transformed by the mutated MT-3 sequence under control of the CMV promoter. Thus, the epitope of MT-3 that confers neuronal growth inhibitory activity also regulates the post-transcriptional inhibition of MT-3 protein expression in the urothelial cell. A simple explanation for the above results comes from studies on the MT-1 and MT-2 isoforms that show in addition to transcriptional control, there is a component of post-transcriptional control that depends on the metal saturation state of the MT proteins (Choudhuri et al., 1992Go; Feldman et al., 1978Go; Lehman and Poisner, 1984Go; Moffatt and Denizeau, 1997Go; Monia et al., 1986Go; Vasconcelos et al., 1996Go, 2002Go). In these studies, it was shown that the MT protein was susceptible to degradation when devoid of metal, and stabilized against degradation upon metal binding and saturation. These studies suggested that the failure of the transfected UROtsa cells to accumulate MT-3 protein in the presence of elevated MT-3 mRNA might operate through a similar mechanism. If so, then exposure of the UROtsa cell MT-3 transfectants to Cd+2 should reverse this effect and allow MT-3 protein accumulation. This hypothesis was tested and it was shown that Cd+2 had no effect on MT-3 protein accumulation by UROtsa cells transfected with the MT-3 gene. This shows that metal saturation of the MT-3 protein is not a mechanism to explain the post-transcriptional restriction of MT-3 protein accumulation in the transfected cells.

The mechanism underlying the post-transcriptional inhibition of MT-3 protein expression is unknown. However, this is also true for the mechanism underlying the growth inhibitory activity of the MT-3 protein. From studies on the growth inhibitory activity, it is known that the threonine at position 5 and the conserved 6CPCP9 motif unique to MT-3 is essential for its growth inhibitory activity. Structural studies have shown that the MT-3 protein, similar to that of MT-1/2, possesses two protein domains each encompassing a metal-thiolate cluster, a three metal cluster in the ß-domain and a four metal cluster in the C terminal {alpha}-domain (Faller et al., 1999Go; Oz et al., 2001Go). However, the MT-3 protein was shown to have markedly increased structural flexibility and cluster dynamic compared with the MT-1/2 protein (Oz et al., 2001Go). Mutation of the distinct 6CPCP9 motif of MT-3 to 6CSCA9 found in MT-2 abolished the inhibitory activity of the protein without altering its metal binding affinity, but did significantly affect the dynamics of the ß-domain (Hasler et al., 2000Go; Sewell et al., 1995Go). It has recently been shown that conversion of the MT-2 sequence to the 6CPCP9 motif confers the unique structural and growth inhibitory properties associated with the MT-3 protein (Romero-Isart et al., 2002Go). These findings have led to the proposal that the bioactivity of MT-3 is a result of the distinct sequence motif and structure dynamics unique to this isoform (Hasler et al., 2000Go). It is likely that these findings will also impact on any mechanism developed to explain the post-transcriptional inhibition of MT-3 protein expression.

The presumptive reason that the MT-3 protein could not be stably expressed in UROtsa cells is that expression would be incompatible with some aspect of cell homeostasis. The failed attempt in the present study to place MT-3 expression under the control of a regulated promoter provides indirect evidence to suggest the adverse effect might be related to an inhibition of cell growth. The finding that the inherent leakiness of the regulated promoter allowed a low basal expression of MT-3 protein may have selected for the lowest level of MT-3 protein expression compatible with UROtsa cell survival. This would explain why attempts to induce MT-3 expression resulted in enhanced MT-3 mRNA levels but no MT-3 protein. The clones that did result from the selection process displayed low basal expression of MT-3 protein which also correlated to a highly reduced growth rate compared to wild type cells and cells containing the blank vector control. Thus, this study may have defined the highest level of expression of MT-3 protein that can be tolerated by the UROtsa cells and also implicated MT-3 expression in the inhibition of epithelial cell growth. A role for MT-3 in the control of cell growth is in agreement with the original findings in the neural system that MT-3 possessed a growth inhibitory activity (Tsuji et al., 1992Go; Uchida et al., 1991Go). This observation was extended by this laboratory to include the growth inhibition of prostate and breast cancer cells (Dutta et al., 2002Go; Gurel et al., 2003Go). That the activity of MT-3 may go beyond cell growth inhibition to include other processes associated with cell growth control is suggested by studies which show an involvement of MT-3 expression in the choice between apoptotic versus necrotic cell death (Somji et al., 2004Go) and in the differentiation of the proximal tubule cell (Kim et al., 2002Go).

The finding that a cell culture model of human urothelium can restrict the expression of MT-3 protein at the post-transcriptional level of regulation has a potential impact on the observation that MT-3 is not expressed in normal in situ urothelium, but is overexpressed in transitional cell carcinoma of the bladder (Sens et al., 2000Go). This finding provides evidence that MT-3 protein overexpression in human bladder cancer could be the result of a two-step process: the first being the activation of transcription of the MT-3 gene and the second, effective translation of this mRNA into MT-3 protein.


    ACKNOWLEDGMENTS
 
The project described was supported by grant number RO1 ES/CA11333 from the National Institute of Environmental Health Sciences and grant number R01 CA/ES94997 from the National Cancer Institute (NCI), NIH. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NCI and NIEHS, NIH.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Amoureux, M.-C., Wurch, T., and Pauwels, P. J. (1995). Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem. Biophys. Res. Comm. 214, 639–645.[CrossRef][ISI][Medline]

Andrews, G. K. (2000). Regulation of metallothionein gene expression by oxidative stress and metal ions. Biochem. Pharmacol. 59, 95–104.[CrossRef][ISI][Medline]

Bahnson, R. R., Becich, M., Ernstoff, M. S., Sandlow, J., Cohen, M. B., and Williams, R. D. (1994). Absence of immunohistochemical metallothionein staining in bladder tumor specimens predicts response to neoadjuvant cisplatin, methotrexate and vinblastine chemotherapy. J. Urol. 152, 2272–2275.[ISI][Medline]

Bahnson, R. R., Banner, B. F., Ernstoff, M. S., Lazo, J. S., Cherian, M. G., Banerjee, D., and Chin, J. L. (1991). Immunohistochemical localization of metallothionein in transitional cell carcinoma of the bladder. J. Urol. 146, 1518–1520.[ISI][Medline]

Bier, B., Douglas-Jones, A., Totsch, M., Dockhorn-Dworniczak, B., Bocker, W., Jasani, B., and Schmid, K. W. (1994). Immunohistochemical demonstration of metallothionein in normal human breast tissue and benign and malignant lesions. Breast Cancer Res. Treat. 30, 213–221.[CrossRef][ISI][Medline]

Cherian, M. G., Jayasurya, A., and Bah, B. H. (2003). Metallothionein in human tumors and potential roles in carcinogenesis. Mutat. Res. 533, 201–209.[Medline]

Choudhuri, S., McKim, J. M., and Klaassen, C. D. (1992). Role of hepatic lysosomes in the degradation of metallothionein. Toxicol. Appl. Pharmacol. 115, 64–71.[CrossRef][ISI][Medline]

Cousins, R. J. (1983). Metallothionein-aspects related to copper and zinc metabolism. J. Inherit. Metab. Dis. 6, 15–21.[Medline]

Douglas-Jones, A. G., Schmid, K. W., Bier, B., Horgan, K., Lyons, K., Dallimore, N. D., Moneypenny, I. J., and Jasani, B. (1995). Metallothionein expression in duct carcinoma in situ of the breast. Human Pathol. 26, 217–222.[CrossRef][ISI][Medline]

Dutta, R., Sens, D. A., Somji, S., Sens, M. A., and Garrett, S. H. (2002). Metallothionein isoform 3 expression inhibits cell growth and increases drug resistance of PC-3 prostate cancer cells. Prostate 52, 89–97.[CrossRef][ISI][Medline]

Faller, P., Hasler, D. W., Zerbe, O., Klauser, S., Winge, D. R., and Vasak, M. (1999). Evidence for a dynamic structure of human neuronal growth inhibitory factor and for major rearrangements of its metal-thiolate cluseters. Biochemistry 38, 10158–10167.[CrossRef][Medline]

Feldman, S. L., Failla, M. L., and Cousins, R. J. (1978). Degradation of rat liver metallothioneins in vitro. Biochem. Biophys. Acta 544, 638–646.[Medline]

Fresno, M., Wu, W., Rodriguez, J. M., and Nadji, M. (1993). Localization of metallothionein in breast carcinomas. An immunohistochemical study. Virchows Arch. A Pathol. Anat. Histopathol. 423, 215–219.[CrossRef][ISI][Medline]

Garrett, S. H., Sens, M. A., Shukla, D., Flores, L., Somji, S., Todd, J. H., and Sens, D. A. (2000a). Metallothionein isoform 1 and 2 gene expression in the human prostate: Down-regulation of MT-1X in advance prostate cancer. Prostate 43, 125–135.[CrossRef][ISI][Medline]

Garrett, S. H., Somji, S., Todd, J. H., Sens, D. A., Lamm, D. H., and Sens, M. A. (2000b). Metallothionein isoform gene expression in four human bladder cancer cell lines. In: Metallothionein IV (C. Klaassen, Ed.), pp. 607–614. Birkhauser Verlay, Basal, Switzerland.

Garrett, S. H., Sens, M. A., Shukla, E., Nestor, S., Somji, S., Todd, J. H., and Sens, D. A. (1999a). Metallothionein isoform 3 expression in the human prostate and cancer-derived cell lines. Prostate 41, 196–202.[CrossRef][ISI][Medline]

Garrett, S. H., Sens, M. A., Todd, J. H., Somji, S., and Sens, D. A. (1999b). Expression of MT-3 protein in the human kidney. Toxicol. Lett. 105, 207–214.[CrossRef][ISI][Medline]

Goering, P. L., and Klaassen, C. D. (1983). Altered subcellular distribution of cadmium following cadmium pretreatment: Possible mechanism of tolerance to cadmium-induced lethality. Toxicol. Appl. Pharmacol. 70, 195–203.[CrossRef][ISI][Medline]

Goulding, H., Jasani, B., Pereira, H., Reid, A., Galea, M., Bell, J. A., Elston, C. W., Robertson, J. F., Blamey, R. W., Nicholson, R. A., Schmid, K. W., and Ellis, I. O. (1995). Metallothionein expression in human breast cancer. Br. J. Cancer 72, 968–972.[ISI][Medline]

Guiffrè, G., Barresi, G., Sturniolo, G. C., Sarnelli, R., D'Inca, R., and Tuccari, G. (1996). Immunohistochemical expression of metallothionein in normal human colorectal mucosa, in adenomas and in adenocarcinomas and their associated metastases. Histopathology 29, 347–354.[ISI][Medline]

Gurel, V., Sens, D. A., Somji, S., Garrett, S. H., Nath, J., and Sens, M. A. (2003). Stable transfection and overexpression of metallothionein isoform 3 inhibits the growth of MCF-7 and Hs578T cells but not that of T-47D or MDA-MB-231 cells. Breast Cancer Res. Treat. 80, 181–191.[CrossRef][ISI][Medline]

Haerslev, T., Jacobsen, K., Nedergaard, L., and Zedeler, K. (1994). Immunohistochemical detection of metallothionein in primary breast carcinomas and their axillary lymph node metastases. Path. Res. Pract. 190, 675–681.[Medline]

Hamer, D. H. (1986). Metallothionein. Ann. Rev. Biochem. 55, 913–951.[ISI][Medline]

Hasler, D. W., Jensen, L. T., Zerbe, O., Winge, D. R., and Vasak, M. (2000). Effect of the two conserved prolines of human growth inhibitory factor (metallothionein-3) on its biological activity and structure fluctuation: comparison with a mutant protein. Biochemistry 39, 14567–14575.[CrossRef][Medline]

International Agency for Research on Cancer (1993). Beryllium, cadmium, mercury, and exposure in the glass manufacturing industry. In International Agency for Research on Cancer Monographs on the Evaluation of the Carcinogenic Risks to Humans, Vol. 58. IARC, Lyon, France.

Jasani, B., and Schmid, K. W. (1997). Significance of metallothionein overexpression in human tumours. Histopathology 31, 211–214.[CrossRef][ISI][Medline]

Kägi, J. H. R. (1993). Evolution, structure and chemical activity of class I metallothioneins: An overview. In Metallothionein III. Biological Roles and Medical Implications (K.T. Suzuki, N. Imura, and M. Kimura, Eds.), pp. 29–56. Birkhauser Verlag, Berlin.

Kägi, J. H. R., and Hunziker, P. (1989). Mammalian metallothionein. Biol. Trace Element Res. 21, 111–118.[ISI][Medline]

Kelly, S. L., Basu, A., Teicher, B. A., Hacker, M. P., Hamer, D. H., and Lazo, J. S. (1988). Overexpression of metallothionein confers resistance to anticancer drugs. Science 241, 1813–1815.[Abstract/Free Full Text]

Kim, D., Garrett, S. H., Sens, M. A., Somji, S., and Sens, D. A. (2002). Metallothionein isoform 3 and proximal tubule vectorial active transport. Kidney Int. 61, 464–472.[CrossRef][ISI][Medline]

Kotoh, S., Naito, S., Sakamoto, N., Goto, K., and Kumazawa, J. (1994). Metallothionein expression is correlated with cisplatin resistance in transitional cell carcinoma of the urinary tract. J. Urol. 152, 1267–1270.[ISI][Medline]

Lehman, L. D., and Poisner, A. M. (1984). Induction of metallothionein synthesis in cultured human trophoblasts by cadmium and zinc. J. Toxicol. Environ. Health 14, 419–432.[ISI][Medline]

Lim, K., Evans, A., Adams, M., Fish, R., Dhundee, J., Dallimore, N., and Jasani, B. (1996). Association of immunohistochemical detectable metallothionein (IDMT) expression with malignant transformation in cervical cancer. J. Pathol. 178, 48.[CrossRef][ISI][Medline]

Moffatt, P., and Denizeau, F. (1997). Metallothionein in physiological and physiopathological processes. Drug Metabol. Rev. 29, 261–307.[ISI][Medline]

Monia, B. P., Buff, T. R., Ecker, D. J., Mirabelli, C. K., and Crooke, S. T. (1986). Metallothionein turnover in mammalian cells. J. Biol. Chem. 261, 10957–10959.[Abstract/Free Full Text]

Öfner, D., Maier, H., Riedmann, B., Bammer, T., Rumer, A., Winde, G., Böcker, W., Jasani, B., and Schmid, K. W. (1994). Immunohistochemical metallothionein expression in colorectal adenocarcinoma: correlation with tumor stage and patient survival. Virchows Arch. [A] 425, 491–497.

Ohishio, G., Imamura, T., Okada, N., Wang, Z., Yamaki, K., Kyoguku, T., Suwa, H., Yamabe, H., and Imamura, M. (1996). Immunohistochemical study of metallothionein in pancreatic carcinomas. J. Cancer Res. Oncol. 122, 351–355.

Oyama, T., Take, H., Hikino, T., Iino, Y., and Nakajima, T. (1996). Immunohistochemical expression of metallothionein in invasive breast cancer in relation to proliferative activity, histology and prognosis. Oncology 53, 112–117.[ISI][Medline]

Oz, G., Zangger, K., and Armitage, I. M. (2001). Three-dimensional structure and dynamics of a brain specific growth inhibitory factor: Metallothionein-3. Biochemistry 40, 11433–11441.[CrossRef][Medline]

Palmiter, R. D., Findley, S. D., Whitmore, T. E., and Durnam, D. M. (1992). MT-III, a brain-specific member of the metallothionein gene family. Proc. Natl. Acad. Sci. U.S.A. 89, 6333–6337.[Abstract/Free Full Text]

Romero-Isart, N., Jensen, L. T., Zerbe, O., Winge, D. R., and Vasak, M. (2002). Engineering of metallothionein-3 neuroinhibitory activity into the inactive isoform metallothionein-1. J. Biol. Chem. 277, 37023–37028.[Abstract/Free Full Text]

Rossi, M. R., Masters, J. R. W., Park, S., Todd, J. H., Garrett, S. H., Sens, M. A., Somji, S., Nath, J., and Sens, D. A. (2001). The immortalized UROtsa cell line as a potential cell culture model of human urothelium. Environ. Health Perspect. 109, 801–808.[ISI][Medline]

Rossi, M. R., Somji, S., Garrett, S. H., Sens, M. A., Nath, J., and Sens D. A. (2002). Expression of hsp 27, hsp 60, hsc 70 and hsp 70 stress response genes in cultured human urothelial cells (UROtsa) exposed to lethal and sublethal concentrations of sodium arsenite. Environ. Health Perspect. 110, 1225–1232.[ISI][Medline]

Sauerbrey, A., Zintl, F., and Volm, M. (1994). Expression of metallothionein in initial and relapsed childhood acute lymphoblastic leukemia. Ann. Hematol. 69, 111–115.[CrossRef][ISI][Medline]

Schmid, K. W., Ellis, I. O., Gee, J. M. W., Darke, B. M., Lees, W. E., Kay, J., Cryer, A., Stark, J. M., Hittmair, A., Ofner, D., Dunser, M., Margreiter, R., Daxenbichler, G., Nicholson, R. I., Bier, B., Bocker, W., and Jasani, B. (1993). Presence and possible significance of immunocytochemically demonstratable metallothionein over-expression in primary invasive ductal carcinoma of the breast. Virchows Arch. A Pathol. Anat. Histopathol. 422, 153–159.[CrossRef][ISI][Medline]

Sens, M. A., Somji, S., Lamm, D. L., Garrett, S. G., Slovinsky, F., Todd, J. H., and Sens, D. A. (2000). Metallothionein Isoform 3 as a potential biomarker for human bladder cancer. Environ. Health Perspect. 108, 413–418.[ISI][Medline]

Sens, D. A., Park, S., Gurel, V., Sens, M. A., Garrett, S. H., and Somji, S. (2004). Inorganic cadmium- and arsenite-induced malignant transformation of human bladder urothelial cells. Toxicol. Sci. 79, 56–63.[Abstract/Free Full Text]

Sens, D., Rossi, M., Park, S., Gurel, V., Nath, J., Garrett, S., Sens, M. A., and Somji, S. (2003). Metallothionein isoform 1 and 2 gene expression in a human urothelial cell line (UROtsa) exposed to CdCl2 and NaAsO2. J. Toxicol. Environ. Health A 66, 2031–2046.[ISI][Medline]

Sewell, A. K., Jensen, L. T., Erickson, J. C., Palmiter, R. D., and Winge, D. R. (1995). Bioactivity of metallothionein-3 correlates with its novel ß domain sequence rather than metal binding properties. Biochemistry 34, 4740–4747.[CrossRef][Medline]

Siemiatycki, J., Dewar, R., Nadon, L., and Gerin, M. (1994). Occupational risk factors for bladder cancer: Results from a case control study in Montreal, Quebec, Canada. Am. J. Epidemiol. 140, 1061–1080.[Abstract/Free Full Text]

Somji, S., Garrett, S. H., Sens, M. A., Gurel, V., and Sens, D. A. (2004). Expression of metallothionein isoform 3 (MT-3) determines the choice between apoptotic or necrotic cell death in Cd+2-exposed human proximal tubule cells. Toxicol. Sci. 80, 358–366.[Abstract/Free Full Text]

Theocharis, S. E., Margeli, A. P., Klijanlenko, J. T., and Kouraklis, G. P. (2004). Metallothionein expression in human neoplasia. Histopathology 45, 103–118.[CrossRef][ISI][Medline]

Tsuji, S., Kobayashi, H., Uchida, Y., Ihara, Y., and Miyataka, T. (1992). Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 11, 4843–4850.[ISI][Medline]

Uchida, Y., Takio, K., Titani, K., Ihara, Y., and Tomonaga, M. (1991). The growth inhibitory factor that is deficient in Alzheimer's disease is a 68 amino acid metallothionein-like protein. Neuron 7, 337–347.[CrossRef][ISI][Medline]

Vasconcelos, M. H., Tam, S. C., Hesketh, J., Reid, M., and Beattie, J. H. (2002). Metal- and tissue-dependent relationship between metallothionein mRNA and protein. Toxicol. Appl. Pharmacol. 182, 91–97.[CrossRef][ISI][Medline]

Vasconcelos, M. H., Tam, S. C., Beattie, J. H., and Hesketh, J. (1996). Evidence for differences in the post-transcriptional regulation of rat metallothionein isoforms. Biochem. J. 315, 665–671.[Medline]

Waalkes, M. P. (2000). Cadmium carcinogenesis in review. J. Inorg. Biochem. 79, 241–244.[CrossRef][ISI][Medline]

Zelger, B., Hittmair, A., Schir, M., Ofner, C., Ofner, D., Fritsch, P. O., Becker, W., Jasani, B., and Schmid, K. W. (1993). Immunohistochemically demonstrated metallothionein expression in malignant melanoma. Histopathology 23, 257–264.[ISI][Medline]

Zelger, B., Sidroff, A., Hopfl, R., Ofner, D., Jasani, B., and Schmid, K. W. (1994). Metallothionein expression in nonmelanoma skin cancer. Appl. Histochem. 2, 254–260.

Zhang, Q., Yang, W.-M., Yu, W.-H., Cai, B., Teng, X.-C., Xie, Y., Sun, H.-Z., Zhang, M.-J., and Huang, Z.-X. (2003). The effect of the EAAEAE insert on the property of human metallothionein-3. Protein Engineering 16, 865–870.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Toxicol SciHome page
X. D. Zhou, M. A. Sens, S. H. Garrett, S. Somji, S. Park, V. Gurel, and D. A. Sens
Enhanced Expression of Metallothionein Isoform 3 Protein in Tumor Heterotransplants Derived from As+3- and Cd+2-Transformed Human Urothelial Cells
Toxicol. Sci., October 1, 2006; 93(2): 322 - 330.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. Somji, S. H. Garrett, M. A. Sens, and D. A. Sens
The Unique N-Terminal Sequence of Metallothionein-3 Is Required to Regulate the Choice between Apoptotic or Necrotic Cell Death of Human Proximal Tubule Cells Exposed to Cd+2
Toxicol. Sci., April 1, 2006; 90(2): 369 - 376.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract