ToxSci Advance Access originally published online on September 21, 2005
Toxicological Sciences 2005 88(2):384-399; doi:10.1093/toxsci/kfi326
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Induction of Cytochrome P450 1A5 mRNA, Protein and Enzymatic Activities by Dioxin-Like Compounds, and Congener-Specific Metabolism and Sequestration in the Liver of Wild Jungle Crow (Corvus macrorhynchos) from Tokyo, Japan


* Center for Marine Environmental Studies (CMES), Ehime University, Bunkyo-cho 2-5, Matsuyama 790-8577, Japan; and
Japan Wildlife Research Center, Shitaya 3-10-10, Taito-ku Tokyo 110-8676, Japan
1 To whom correspondence should be addressed at Center for Marine Environmental Studies, Ehime University, Building "Sogo-Kenkyuto"-1, Bunkyo-cho 2-5, Matsuyama 790-8577, Japan. Tel./Fax: +81-89-927-8172. E-mail: iwatah{at}agr.ehime-u.ac.jp.
Received July 13, 2005; accepted September 12, 2005
| ABSTRACT |
|---|
|
|
|---|
This study presents concentrations of polychlorinated dibenzo-p-dioxins (PCDDs), dibenzofurans (PCDFs), and dioxin-like coplanar PCBs (Co-PCBs) in the liver and breast muscle of jungle crows (JCs; Corvus macrorhynchos) collected from Tokyo, Japan. 2,3,7,8-Tetrachlorodibenzo-p-dioxin toxic equivalents (TEQs) derived by WHO bird-TEF were in the range of 23 to 280 pg/g (lipid) in the liver, which are lower or comparable to the lowest-observed-effect-level of CYP induction in chicken, and 5.678 pg/g (lipid) in the pectoral muscle. Cytochrome P450 (CYP) 1A-, 2B-, 2C-, and 3A-like proteins were detected using anti-rat CYP polyclonal antibodies in hepatic microsomal fractions. Significant (p < 0.05) positive correlations between hepatic TEQs and CYP1A or CYP3A-like protein expression levels were noticed, implying induction of these CYP isozymes by TEQs. On the other hand, there was no significant positive correlation between muscle TEQ and any one of analyzed CYP isozyme expression levels. CYP1A- and CYP3A-like protein expression levels represented better correlations with pentoxy- and benzyloxyresorufin-O-dealkylase activities rather than methoxy- and ethoxyresorufin-O-dealkylase activities, indicating unique catalytic functions of these CYPs in JCs. Furthermore, we succeeded in isolating CYP1A5 cDNA from the liver of JC, having an open reading frame of 531 amino acid residues with a predicted molecular mass of 60.3 kDa. JC CYP1A5 mRNA expression measured by real-time RT-PCR had a significant positive correlation with hepatic TEQs, suggesting induction of CYP1A5 at the transcriptional level. Ratios of several Co-PCB congeners to CB-169 in the liver of JCs revealed significant negative correlations with CYP1A protein or CYP1A5 mRNA expression levels, implying metabolism of these congeners by the induced CYP1A. The liver/breast muscle concentration (L/M) ratios of PCDDs/DFs and CB-169 increased with an increase in hepatic CYP1A protein or CYP1A5 mRNA expression levels, suggesting congener-specific hepatic sequestrations by the induced CYP1A. The present study provides insights into the propensity of CYP1A induction to the exposure of dioxin-like chemicals, and unique metabolic and sequestration capacities of CYP1A in JC.
Key Words: jungle crow; dioxin-like compounds; CYP1A5 mRNA; alkoxyresorufin-O-dealkylation activities; metabolism; hepatic sequestration.
| INTRODUCTION |
|---|
|
|
|---|
Contamination by dioxin-related compounds (DRCs) such as polychlorinated-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), and dioxin-like coplanar polychlorinated biphenyls (Co-PCBs) is of a growing concern due to their ubiquity, biomagnification potential, and highly toxic properties in humans and wildlife. Jungle crow (JC; Corvus macrorhynchos) is considered to be an useful bioindicator for monitoring contaminants in urban areas, because this species is residential, occupies the same habitat as humans, and feeds on a variety of food including domestic waste and garbage. JCs accumulate environmental contaminants including DRCs (Watanabe et al., 2005
Cytochrome P450 (CYP) is a monooxygenase enzyme that plays a prominent role in the biotransformation of endogenous and xenobiotic compounds in biological systems. CYP has been recognized as a marker enzyme to evaluate integrated exposure to complex mixtures of contaminants, and molecular, biochemical, and adverse effects in which CYP signaling cascade is involved. One such response, induction of CYP1A subfamily, has been extensively used as a sensitive indicator of exposure and effects of DRCs.
In avian species, chicken CYP1As have been classified as CYP1A4 and 1A5, based on differences in amino acid sequences from mammalian CYP1A1 and 1A2, and phylogenetic analysis, showing that the chicken and mammalian CYP1As form a separate branch in the CYP1A family tree (Gilday et al., 1996
). Avian CYP1As have been so far cloned and sequenced such as CYP1A4/5 in chicken (Gallus gallus) (accession number X99453/X99454 [Gilday et al., 1996
]), CYP1A4/5 in common cormorant (Pharacrocorax carbo) (Kubota et al., in preparation), CYP1A4/5 in herring gull (Larus argentatus) (accession number AY233271/AY330876), and CYP1A5 in turkey (Meleagris gallopavo) (accession number AY964644).
There are striking interspecies differences in CYP1A induction to DRCs exposure even among avian species. Kennedy et al. (1996)
reported substantial differences in the sensitivity of hepatocyte cultures from different avian species for CYP1A induction. EC50 of EROD induction by 2378-T4CDD was in the following order: herring gull (280 pg/ml)
duck (200610 pg/ml)
turkey (200 pg/ml) > pheasant (45 pg/ml) > chicken (4.515 pg/ml). In an ovo study, Sanderson and Bellward (1995)
reported that ED50 values (ng/g liver) of EROD activity were about 12 for chicken, 2030 for cormorant, and 3050 for heron. In view of these large interspecies differences, it is necessary to investigate the relationship of TEQ-CYP1A expression in many other species.
Toxicokinetic behavior of DRCs in organisms is, at least partly, dependent on expression and function of CYP1A, in addition to chemical structure and number of chlorine substitution in each congener. Low chlorinated congeners such as 2378-T4CDD, 2378-T4CDF, 12378-P5CDD, and 33'44'-PCB (CB-77) are easily metabolized by CYP1A1/2 in rat liver microsomes (Hu and Bunce, 1999
; Murk et al., 1994
; Tai et al., 1993
). In avian species, CB-77 is rapidly metabolized by hepatic microsomes of eider ducks exposed to CB-77 or commercial PCB mixture Clophen A50, although wild common tern exposed to PCBs exhibited only limited metabolism of CB-77 (Murk et al., 1994
). In wild common cormorants, concentrations of 2378-T4CDF and CB-77 in the liver exhibited no significant increase with growth, probably due to rapid metabolism (Kubota et al., 2004
).
PCDDs/DFs accumulate in hepatic tissue to a greater extent than adipose tissue in rats and mice (Chen et al., 2001
; De Vito et al., 1998
; Körner et al., 2002
; Van den Berg et al., 1994
). A recent study using transgenic Cyp1a2 knockout mice demonstrated that CYP1A2 is responsible for the sequestration of 2378-T4CDD and 23478-P5CDF in hepatic tissue (Diliberto et al., 1999
). Another study showed that no difference in 2378-T4CDD sequestration in liver was found between transgenic Cyp1a1(-/-) knockout and Cyp1a1/1a2(+/+) wild-type mice, indicating little contribution of CYP1A1 on the sequestration (Uno et al., 2004
). Our studies showed that liver to other tissues distribution ratio of certain dioxin-like congeners increased with the total TEQs or CYP1A in the livers of wild seals (Iwata et al., 2004
) and cormorants (Kubota et al., 2004
, 2005
). These studies comprehended that the hepatic preference of congeners is dependent upon the CYP1A induced by TEQs. Comparison of the limited data available indicates the possibility of marked species differences in the tissue-distribution of dioxin-like congeners among many other organisms. For example, concentration ratios (liver/muscle or adipose tissue) of most PCDD/DF and non-ortho PCB congeners were higher in seals than those of cormorants.
The present study investigates contamination levels of DRCs in liver and breast muscle of feral JCs from Tokyo, Japan, and whether hepatic CYPs (mRNA, protein and enzymatic activities) are induced by such contamination. To elucidate congener-specific toxicokinetics related to CYP induction, interactions of DRCs with hepatic CYP will be discussed in terms of interspecies comparison.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Sample collection.
Thirteen male JCs were collected from Tokyo, Japan in December 2002 by trapping method and with permission from the Tokyo Metropolitan Government. JCs were euthanized under deep anesthesia with ether. Breast muscle and liver samples were immediately removed after the measurement of biometry. Both tissues were stored in a freezer at 20°C for chemical analysis. Sub-samples of livers were frozen in liquid nitrogen, and stored at 80°C until microsomal preparation for enzyme assay and total RNA extraction.
Chemical analysis.
Chemical analysis of DRCs was carried out following the standard method of the Environmental Agency of Japan with some modifications. About 24 g of liver and 2035 g of muscle samples of JCs were spiked with 13C-substituted PCDDs/DFs and Co-PCBs as internal standards (Wellington Laboratories Inc., Guelph, Ontario, Canada), and extracted with 1.5 molar ethanol-KOH for 1.5 h. The extract was treated with sulfuric acid for clean-up and then added on to a multilayer column which in turn was connected to a graphite carbon column. The multilayer column was packed with anhydrous Na2SO4 (0.5 g), 20% AgNO3/silica gel (4 g), 44% H2SO4/silica gel (6 g), silica gel (0.5 g), 2% KOH/silica gel (1 g), and anhydrous Na2SO4 (0.5 g) from top to bottom. The silica gel (Spherical) and graphite carbon columns (Supelclean ENVI-Carb) were supplied by Kanto Chemical Co., Inc. (Tokyo, Japan) and Supelco (Bellefonte, PA), respectively. The columns were connected together and eluted with hexane (90 ml), and the multilayer silica gel column was removed. The graphite carbon column was eluted with a mixture of 25% dichloromethane in hexane (90 ml) with a normal flow. Both the eluates were pooled and passed through an activated basic alumina column. Mono-ortho Co-PCBs were eluted from the alumina column using 5% dichloromethane in hexane (40 ml) after discarding the first fraction eluted with 20 ml hexane. The graphite column eluted with toluene (90 ml) in reverse flow contained PCDDs/DFs and non-ortho Co-PCBs. For the recovery check, 13C-labeled CB-138 prepared in decane was added into the final solutions of mono-ortho Co-PCBs fraction, and 1234-T4CDF, 123469-H6CDF, 1234689-H7CDF and CB-138 into the PCDDs/DFs and non-ortho Co-PCBs fraction. All the fractions were then micro-concentrated.
Identification and quantification of DRCs were performed using a high-resolution gas chromatograph (HP 5890 or 6890, Hewlett-Packard, Wilmington, DE) coupled with high-resolution mass spectrometric detector (JMS SX-102A, JEOL JMS-700 or JEOL JMS-700D, JEOL, Tokyo, Japan) at a resolution of >10,000 (10% valley). SP-2331 (0.20 µm film thickness, 0.25 mm i.d., 60 m length, Supelco) capillary column was used for quantification of T4- to H6CDDs/DFs (except 123789-H6CDF), and a SPB-50 (0.25 µm film thickness, 0.25 mm i.d., 30 m length, Supelco) column for H7- and O8CDD/DF and 123789-H6CDF. DB-5 MS (0.25 µm film thickness, 0.25 mm i.d., 60 m length, J&W Scientific Inc., Folsom, CA) fused silica capillary column was used for quantification of Co-PCBs. Mass spectrometric detector was operated at an EI energy of 70 eV and ion current of 800 µA. PCDDs/DFs and Co-PCBs were monitored by two most intensive ions of the molecular ion cluster, except for P5CDD by ions of [M]+ and [M+2]+. All the congeners were quantified using isotope dilution method to the corresponding 13C-labeled congeners, if isotope ratio was within 15% of the theoretical value and peak area was more than 10 times to that of noise or procedural blank level. The quantification limits for PCDDs/DFs and non-ortho Co-PCBs were 4.247 and 6.937 pg/g (lipid) in the liver, and 0.544.9 and 1.13.5 pg/g (lipid) in the pectoral muscle. 2378-T4CDD toxic equivalent (TEQ) was calculated using WHO bird-TEF (Van den Berg et al., 1998
).
Cloning of CYP1A5.
Total RNA from livers of JCs was isolated using RNAgent Total RNA Isolation System (Promega, Madison, WI). Poly(A)+ RNA was purified by PolyATract mRNA Isolation Systems (Promega) or oligo (dT) spin columns (mRNA Purification Kit; Amersham Biosciences, Piscataway, NJ). CYP1A from JC was cloned using a RT-PCR and RACE (Rapid Amplification of cDNA Ends) methods. PCR primers were designed from conserved regions of the chicken and herring gull CYP1A5. Primer sequences were: Crow-f, 5'-TGGCAACCCKGCTGACTTCATC-3'; Crow-r, 5'-GAGGAGTGCCKGAACRYCTCCA-3; Crow-3', 5'-GCCCTGTCCTGGAGCCTCAT GTATCTCG-3'; Crow-5', 5'-CGAGATACATGAGGCTCCAGGACAGGGC-3'. PCR amplification was performed using Crow-f/Crow-r under the following conditions: 105 s at 95°C, 30 cycles of 15 s at 95°C, 45 s at 50°C, and 1 min at 72°C. For 3'- and 5'-RACE, double-stranded cDNAs were synthesized using a Marathon cDNA Amplification kit (BD Biosciences, San Jose, CA) with DNA polymerases of Advantage 2 PCR Enzyme System (BD Biosciences) and TaKaRa LA Taq (Takara Bio Inc., Shiga, Japan), respectively. Gene specific primers (Crow-3' and Crow-5' for 3'- and 5'-RACE, respectively) were coupled with adaptor primers for PCR. Amplification of cDNA ends was performed under the following conditions: 30 s at 94°C, 5 cycles of 5 s at 94°C, 3 min at 72°C, 5 cycles of 5 s at 94°C, 3 min at 70°C, and 25 cycles of 5 s at 94°C, 3 min at 68°C. The amplified cDNAs were sequenced using an ABI Prism 310 Genetic Analyzer (Applied Biosystems, Foster City, CA). CYP1A amino acid sequence obtained in this study was aligned using MacVector 7.1.
Quantitative real-time RT-PCR.
Expression level of CYP1A mRNA was acquired by quantitative real-time RT-PCR, which was performed with TaqMan One-step RT-PCR Master Mix Reagent Kit (Applied Biosystems) using ABI PRISM 7700 Sequence Detector (Applied Biosystems). For checking the quality of total RNA, the bands of 28S and 18S in ribosomal RNAs from all samples were confirmed by gel electrophoresis. Specific primers and probe for CYP1A were designed by Primer Express software version 1 (PE Applied Biosystems Inc., Foster City, CA). The 5'- and 3'-end nucleotides of the probe were labeled with a reporter (FAM) and a quencher dye (TAMRA), respectively. The sequences of the PCR primer pairs and a labeled probe were as follows: CYP1A forward primer, GACATCACCGACTCCCTCATTC; CYP1A reverse primer, CAAAGAGGTCATTCACGAGGTTG; CYP1A probe, CAGTGCCTGGACAAAAAAGTGGAAACGA.
Primers and probe labeled with VIC for the endogenous control ribosomal RNA (rRNA) were purchased from PE Applied Biosystems. Quantitative values were obtained from the threshold PCR cycle number (Ct) at which the increase in signal associated with an exponential growth of PCR products were detected. The relative mRNA levels in each sample were normalized to its ribosomal RNA content.
Reagents for enzymatic activities and immunoblotting.
Reduced nicotinamide adenine dinucleotide phosphate (NADPH), glycerol, dithiothreitol, and potassium chloride (KCl) were purchased from Nacalai Tesque Inc. (Kyoto, Japan). Ethylenediaminetetraacetic acid (EDTA), hydrochloric acid (HCl), and control goat sera were purchased from Wako Pure Chemical Industries Ltd. (Osaka, Japan). Resorufin, methoxyresorufin, ethoxyresorufin, pentoxyresorufin, and benzyloxyresorufin were purchased from Sigma Chemical Co. (St. Louis, MO). Goat anti-rat CYP1A1, CYP2B1, CYP2C6 and rabbit anti-rat CYP3A2 antisera, and horseradish peroxidase (HRP)-labeled anti-rabbit IgG were purchased from Daiichi Pure Chemicals Ltd. (Tokyo, Japan). HRP-labeled anti-goat IgG was purchased from Funakoshi Ltd. (Tokyo, Japan).
Preparation of microsomes.
Hepatic microsomal fractions were prepared according to the method of Guengerich (1982)
. Liver tissue (2.44.4 g) was homogenized in 5 vol of cold homogenization buffer (50 mM Tris-HCl, 0.15 M KCl, pH 7.47.5) with a teflon-glass homogenizer (10 passes), and centrifuged for 10 min at 750 x g. The nuclear pellets were removed, and the supernatant was then centrifuged at 12,000 x g for 10 min. The supernate was further centrifuged at 105,000 x g for 70 min. The supernatant (cytosol) fraction was removed, and microsomal pellets were resuspended in 1 vol of resuspension buffer (50 mM Tris-HCl, 1 mM EDTA, 1 mM dithiothreitol, 20% (v/v) glycerol, pH 7.47.5). Protein concentration in microsomal fraction was determined by the bicinchoninic acid method. Bovine serum albumin was used as a standard (Smith et al., 1985
).
Immunoblotting.
Immunoblotting of liver microsomal fraction was performed as previously described (Iwata et al., 2002
) with some modifications. Protein (40 µg per lane) in microsomal fraction was resolved by electrophoresis on a sodium dodecyl sulfate polyacrylamide gel (520% concentration gradient; ATTO Co., Tokyo, Japan), and electrophoretically transferred to a polyvinylidene fluoride (PVDF) membrane. The membranes were reacted with the polyclonal antibodies against rat CYP1A1, CYP2B1, CYP2C6, or CYP3A2, and then conjugated with a secondary antibody, anti-goat or -rabbit IgG-HRP. Detection of the proteins cross-reacted with antibody was performed using highly sensitive ECL Western blotting detection system (Amersham Biosciences). The signal intensities of the bands were measured using a ChemiDoc system (Bio-Rad Laboratories, Hercules, CA). Levels of CYP proteins in individual animals were expressed as a relative value to staining intensity from the antibody cross-reactive protein in one specimen.
Alkoxyresorufin-O-dealkylase activity assay.
Methoxyresofurin-O-demethylase (MROD), ethoxyresorufin-O-deethylase (EROD), pentoxyresorufin-O-depenthylase (PROD), and benzyloxyresorufin-O-debenzylase (BROD) activities were measured with 2.0 µM substrate and 1.33 mM NADPH concentrations using a spectrofluorometer (Spectra Fluor Plus, Tecan Group Ltd., Maennedorf, Switzerland) by a modification of the method described by Iwata et al. (2002)
. Approximately 1.0 mg/ml of microsomal protein was used for the assay. Reactions were initiated by adding NADPH solution, and the reaction mixture was incubated for 5 min at 37°C. Resorufin formed by the reaction was detected by excitation wavelength 535 nm and the emission wavelength 595 nm.
Antibody inhibition of PROD activity.
The hepatic microsomal sample in which relatively high PROD activity was recorded was used for inhibition test. The microsomes were preincubated with polyclonal antibodies against rat CYP1A1, 2B1, 2C6, 3A2, or control sera for 30 min at room temperature prior to the initiation of reaction by adding NADPH. 0, 10, 30, and 50 µl of antisera were added to 50, 40, 20, and 0 µl of control serum, respectively and PROD assay was performed in the same method as described.
Statistical analysis.
Measurement of alkoxyresorufin-O-dealkylation activities, immunoblotting and antibody inhibition test were done in duplicate. Quantification of mRNA was conducted in triplicate. Mean values were used for following statistical analyses. Correlation analyses were carried out by Spearman's rank correlation test. Mann-Whitney U-test was applied for detecting statistical differences among groups. These statistical analyses were performed using StatView ver. 5.0 (SAS Institute Inc., Cary, NC). For samples with values below quantification limit, half of the respective limit was substituted to calculate mean concentrations, SDs, total PCDDs/DFs/Co-PCBs values and TEQs. Relationships between ratios of congener concentrations in the liver to those in the breast muscle and CYP1A5 mRNA or CYP1A-like protein levels were examined when individual congeners were detected both in the liver and pectoral muscle in more than five specimens. The value of p < 0.05 was regarded as statistically significant.
| RESULTS |
|---|
|
|
|---|
Concentrations and Liver-Muscle Concentration Ratios
The concentrations of PCDDs/DFs in the liver and breast muscle of JCs were from 100 to 1900, and from 21 to 180 pg/g (lipid), respectively (Table 1). Concentrations of total Co-PCBs in the liver and muscle of JCs were 16130 and 18220 ng/g (lipid), respectively. Total TEQ concentrations in the liver and muscle of JCs were 23280 pg/g (lipid) (1.112 pg/g [wet]) and 5.678 pg/g (lipid) (0.153.5 pg/g [wet]), respectively. The TEQs in the livers were mostly lower than those of other bird species from North American, Asian, and European countries (Giesy et al., 1994
|
Congener profiles of PCDD/DF concentrations revealed that 12378-P5CDD, 123478-H6CDD, 123678-H6CDD, and O8CDD were equally predominant in the muscle, and O8CDD was notably accumulated in the liver (Fig. 1). In the case of non-ortho Co-PCBs, CB-169 was more predominant in liver (5995%) than muscle (3569%). Among mono-ortho congeners, CB-118 (3061% in muscle, 3160% in liver) and CB-156 (1837% in muscle, 1838% in liver) were predominant congeners.
|
Comparison of lipid-normalized congener concentrations between liver and breast muscle showed that concentrations of 123478-H6CDD, 123678-H6CDD, 1234678-H7CDD, O8CDD, 23478-P5CDF, 123478-H6CDF, 123678-H6CDF, CB-169, and CB-123 were significantly higher in the liver than those in the breast muscle (p < 0.05). In contrast, no statistical difference in concentration between liver and muscle was found for CB-77 and mono-ortho Co-PCBs except CB-123 (Fig. 1). Table 2 shows mean and range of lipid-normalized concentration ratios of DRCs between liver and breast muscle (L/M ratios) in JCs. The ratios tended to increase with the number of chlorine substitution of PCDD/DF and non-ortho Co-PCB congeners, but no such a trend has been observed for mono-ortho Co-PCBs. In addition, Figure 2 exhibits comparison between the ratios in JCs and those in cormorants (Kubota et al., 2004
|
|
As for congener profiles of TEQs, sum of 12378-P5CDD and 23478-P5CDF accounted for 3376% and 2670% to total TEQs in the liver and muscle of JCs, respectively. CB126, which is a dominant congener in many avian species (Senthilkumar et al., 2002a
Isolation of CYP1A5 in JC
Full-length open reading frame of CYP1A cDNA of JC was 1596 bp (531 aa). 173 bp of 5'-UTR and 130 bp of 3'-UTR with a polyA tail were also cloned. The predicted molecular mass was 60.3 kDa (Fig. 3). In the alignment of the amino acid sequence, JC CYP1A cloned was most closely related to the cormorant CYP1A5 (81%; Kubota et al., in preparation) and shared 74, 73, and 66% of overall amino acid identities with chicken CYP1A5, cormorant CYP1A4 and chicken CYP1A4, respectively. This new full-length CYP from JC has been designated as JC CYP1A5 by Dr. D. Nelson (University of Tennessee), and has been submitted to GenBank with Accession No. AB220967.
|
CYP Isozymes Responsible for AROD Activities
Alkoxyresorufin-O-dealkylation (AROD) activities in the liver microsomes of JCs were characterized by high MROD (350 ± 160 [mean ± SD] pmol/min/mg prot.) and EROD (130 ± 40 pmon/min/mg prot.) activities followed by PROD (3.6 ± 1.0 pmol/min/mg prot.) or BROD (6.5 ± 3.4 pmol/min/mg prot.) activities.
CYP1A-, 2B-, 2C-, and 3A-like proteins were immunochemically detected using anti-rat CYP polyclonal antibodies in hepatic microsomes of JCs. Figure 4 represents the results of Western blot analyses. Regarding CYP1A-like proteins, two bands with higher (HMW) and lower molecular weights (LMW) were recognized. Table 3 shows rho values of Spearman's rank correlations among expression levels of CYP1A5 mRNA, CYP1A-, 2B-, 2C-, and 3A-like proteins and AROD activities in liver microsomes of JC. CYP1A5 mRNA expression levels had a significant positive correlation with protein level of HMW CYP1A and not with LMW CYP1A. As for other CYP proteins, anti-rat polyclonal antisera of other CYP isozymes emerged as a single band. Table 3 presents that PROD and BROD activities had higher positive correlations with HMW CYP1A and 3A-like proteins than other AROD activities and CYP isozyme protein levels, implying the involvement of these CYP isozymes in PROD or BROD activities.
|
|
An antibody inhibition test of PROD activity was conducted using anti-rat CYP1A1, 2B1, 2C6, and 3A2 antisera to further specify the CYP isozyme responsible for the catalytic activity (Fig. 5). Magnitude of inhibition of PROD activity was in the following order: anti-rat CYP1A1 > 3A2 > 2B1 > 2C6 at lower dose of antibody, and anti-rat CYP3A2 > 1A1 > 2B1 > 2C6 at the highest dose of antibody. Anti-rat CYP3A2 and CYP1A1 antisera inhibited PROD activity by 43 and 44% at 30 µl serum, and by 84 and 34% at 50 µl serum, respectively. Although anti-rat CYP3A2 antisera showed dose-dependent inhibition of PROD activity, the inhibition rate by anti-rat CYP1A1 antisera was constant at any dose of the serum.
|
CYP Induction by TEQs
Relationships between TEQ of each congener and CYP1A5 mRNA, CYP protein contents or AROD activities were shown in Table 4. Hepatic total TEQs in JCs exhibited significant positive correlations with CYP1A5 mRNA, HMW CYP1A- or CYP3A-like protein expression levels, and PROD and BROD activities, whereas MROD and EROD activities, and CYP2B/2C-like protein expression levels revealed no significant positive correlations with hepatic TEQ concentrations. Some of these relationships were also shown in Figure 6.
|
|
Individual TEQs (wet) derived from all the PCDDs/DFs, CB-169, CB156, CB-157, and CB189 had significant (p < 0.05) positive correlation with CYP1A5 mRNA or HMW CYP1A-like protein contents (Table 4). We conducted the correlation analysis using TEQ expressed on lipid weight basis (data not shown) also, which showed a similar result in the case of TEQ on wet weight basis. Table 5 shows relationships between expression levels of CYP1A5 mRNA, CYP1A-, 2B-, 2C-, or 3A-like proteins, M-, E-, P-, or BROD activity in livers and TEQ (wet) of each congener in muscle of JCs. In contrast to TEQs in the livers, TEQ of most congeners in the muscle showed no significant positive correlation with hepatic CYP1A5 mRNA and HMW CYP1A protein contents.
|
Hepatic Metabolism and Sequestration of Dioxin-Like Congeners by Induced CYP1A
To investigate the metabolic potential of each congener by hepatic CYP of JCs, correlation analyses were conducted between expression levels of CYP1A5 mRNA, CYP1A-, 2B-, 2C-, or 3A-like protein, M-, E-, P-, or BROD activities and concentration ratios of each congener to CB-169 which was shown to be resistant to CYP metabolism (Guruge and Tanabe, 1997
|
Table 7 shows relationships between the L/M ratios of each congener and expression levels of CYP1A5 mRNA or HMW CYP1A-like proteins. The L/M ratios of individual PCDD/DF congeners and CB-169 increased with an increase in hepatic CYP1A5 mRNA or HMW CYP1A protein expression levels (Table 7). The L/M ratios for higher chlorinated congeners were greater than those for lower chlorinated congeners. In contrast, no elevation was found in the L/M ratios for CB-77 and mono-ortho Co-PCBs, which were nearly equal to 1.0 in all specimens.
|
| DISCUSSION |
|---|
|
|
|---|
In this study, concentrations of DRCs in the liver and muscle of JCs were analyzed. The TEQs in the livers were mostly lower than those of other bird species so far reported. Lower TEQs and higher contributions of PCDDs/DFs to total TEQs in JCs are consistent with observations in terrestrial birds from the Great Lakes (Jones et al., 1993
L/M ratios in each specimen increased with the number of chlorine substitution of PCDD/DF and non-ortho Co-PCB congeners (Table 2, Fig. 2). Several laboratory studies have demonstrated that PCDDs/DFs and non-ortho Co-PCBs are sequestered in the rodent liver following their subchronic exposures (Chen et al., 2001
; De Vito et al., 1998
; Körner et al., 2002
; Van den Berg et al., 1994
). A recent study revealed that CYP1A2 is a target binding protein responsible for hepatic sequestration of 2378-T4CDD and related compounds (Diliberto et al., 1999
). Regarding wildlife, our studies also exhibited that distribution ratios of certain dioxin-like congeners between liver and other tissues increased with the total TEQs in the livers of seals (Iwata et al., 2004
) and cormorants (Kubota et al., 2004
), suggesting that the hepatic preference of congeners is dependent on CYP1A induced by TEQs. Considering these reports, CYP1A induced by TEQs may be involved in the hepatic sequestration of PCDDs/DFs and CB-169 in JCs. In addition, comparison of the L/M ratios in JCs with our previous data on cormorants (Kubota et al., 2004
) revealed that all the L/M ratios of PCDD/DF and non-ortho Co-PCB congeners analyzed were higher in JCs than those of cormorants (Fig. 2), implying higher sequestration capacity of JC liver than that of cormorant.
JC CYP1A5 cDNA was cloned and sequenced in this study. Highly conserved amino acid motif (FxxGxxxCxG) with the heme-binding cysteine was maintained in JC (Fig. 3). Amino acid residues (FGAGFDT) in which threonine is located in the center of
-helix I (Edwards et al., 1989
) at the oxygen-binding pocket, and is part of proton delivery network (Imai et al., 1989
; Yeom et al., 1995
) were also conserved. The proline-rich region (PPGP), which plays a key role in protein folding, was observed in the JC CYP1A5. A hydrophobic N-terminal sequence that anchors the protein to endoplasmic reticulum membrane was longer than that of mammalian or fish CYP1A enzymes, and similar in length to that of chicken (Gilday et al., 1996
).
The hepatic CYP1A-, 2B-, 2C-, and 3A-like proteins of JCs were immunochemically detected using anti-rat CYP polyclonal antibodies in hepatic microsomal fractions. Regarding CYP1A-like proteins, two bands with higher (HMW) and lower molecular weight (LMW) were recognized (Fig. 4). This implies the presence of CYP1A5- and CYP1A4-like proteins as previously suggested in chicken (Gilday et al., 1996
). CYP1A5 mRNA expression levels acquired by quantitative real-time RT-PCR had a significant positive correlation with protein level of HMW CYP1A (Table 3) but no correlation with LMW protein, implying that HMW CYP1A protein is CYP1A5.
JC livers showed high MROD and EROD activities followed by PROD and BROD activities. Such a catalytic profile was similar to that in herring gull (Verbrugge et al., 2001
). Not only EROD but PROD activity was also found to increase by treatment with ß-naphthoflavone (BNF) or 3-methylcholanthrene (3-MC) in mallard ducks (Leffin and Riviere, 1992
), black-crowned night heron (Rattner et al., 1993
), and herring gull (Verbrugge et al., 2001
). In addition, induction of BROD activity by BNF was observed in black-crowned night heron (Rattner et al., 1993
) and chicken (Verbrugge et al., 2001
). Correlation analysis suggested that TEQ induce hepatic PROD activities in avian species (Bosveld et al., 1995
, 2000
; Guruge and Tanabe, 1997
; Kubota et al., 2005
). Together with these results, our data revealing higher positive correlations between PROD or BROD activities and expression levels of CYP1A5 mRNA or HMW CYP1A (Table 3) clearly suggests that avian CYP1A is responsible for PROD and BROD activities, and the substrate specificity is different between birds and mammals; PROD and BROD activities are specifically catalyzed by phenobarbital-induced CYP2B in rat, not by 3-MC-induced CYP1A (Burke et al., 1994
). The antibody inhibition test of PROD activity indicate that CYP3A and CYP1A may be responsible for PROD activity in JCs, but CYP2B and CYP2C isozymes may be less potential. Interestingly, MROD activities had a significant positive correlation with the expressions of CYP2C-like protein. However, to our knowledge, there is no supporting information on the involvement of CYP2C in MROD activity.
Considering the effective levels of biochemical responses in other avian species, the TEQs in JC livers were found to be lower than the ED50 (12 ng/g liver) of hepatic EROD induction in chicken (Sanderson and Bellward, 1995
), and comparable with lowest-observed-effect-level (LOEL) of aryl hydrocarbon hydroxylase (AHH) induction (10 pg/g egg) in chicken embryo (Poland and Glover, 1973
) and EC50 (4.515 pg/ml) of EROD induction in chicken hepatocyte cultures (Kennedy et al., 1996
). Although total TEQ in the liver of JCs (5.9 ± 4.0 pg/g [wet]) were comparable or lower than the estimated LOEL of CYP1A induction in chicken embryo, hepatic CYP1A induction by TEQ was suggested in JC (Table 4 and Fig. 6). These results imply that JC may be as sensitive to TEQ exposure as chicken. On the other hand, the previous life history of these birds is unknown. Differences in habitat and food consumption may have an impact on background CYP1A expression level. Additional unknown compounds may alter hepatic CYP level and thus lead to a significant, but low correlation (p < 0.05). The significant positive correlation of CYP3A with TEQ may be due to the parallel accumulation pattern of TEQ and CYP3A inducers.
Individual TEQs derived from PCDDs/DFs, CB-169, CB156, and CB189 had significant positive correlation with HMW CYP1A protein contents (Table 4). Almost the same trend was found in CYP1A5 mRNA. Relatively higher R and lower P values of PCDDs/DFs than those of mono-ortho Co-PCBs indicate that PCDDs/DFs are mainly involved in the induction of CYP1A(5). CB-77 showed no significant positive correlation with expression levels of CYP1A5 mRNA and HMW CYP1A, which is probably due to rapid biotransformation of this congener. An in vitro study using hepatic microsomes prepared from two avian species exposed to PCBs demonstrated that the metabolism of CB-77 depends on CYP1A induction (Murk et al., 1994
). No significant positive correlation between TEQ of most congeners in the muscle and hepatic CYP1A5 mRNA or HMW CYP1A protein contents (Table 5) suggest that concentrations of DRCs in extra-hepatic tissues are less reflected by hepatic CYP1A expression levels.
Concentration ratios of several Co-PCB congeners to CB-169 revealed significant negative correlations with CYP1A5 mRNA and HMW CYP1A protein levels (Table 6). This implies high potential of CYP1A(5) to metabolize these congeners in JC. The ratios of CB-77 especially had a strong negative correlation (p < 0.01) with HMW CYP1A protein contents, suggesting rapid metabolism of CB-77 by the induced CYP1A in JC. This may be somewhat surprising since CYP1A, which is induced by low levels of DRCs, might be responsible for the metabolism of some congeners. Murk et al. (1994)
reported that CB-77 is rapidly metabolized by hepatic microsomes of eider ducks exposed to 50 mg/kg body weight of CB-77, although the exposed concentration was very high. Metabolism of CB-77 has also been proposed in wild cormorant (Guruge et al., 1997
, 2000
; Kubota et al., 2004
, 2005
; Senthilkumar et al., 2005
), common tern (Bosveld et al., 2000
), and bald eagle (Senthilkumar et al., 2002b
) with high TEQs.
The L/M ratios of multiple PCDD/DF congeners and CB-169 increased with an increase in hepatic CYP1A5 mRNA or HMW CYP1A protein expression levels (Table 7). The slopes for higher chlorinated congeners revealed a tendency to be greater than those for lower chlorinated congeners, whereas no elevation was found in the L/M ratios for CB-77 and mono-ortho Co-PCBs. These results suggest congener-specific hepatic sequestrations by the induced CYP1A(5) in JCs. In rats and mice, dose-dependent increases in liver retention have been reported for several congeners, including 2378-substituted PCDDs/DFs, CB-126, and CB-169 (Chen et al., 2001
; De Vito et al., 1998
; Körner et al., 2002
; Van den Berg et al., 1994
). A previous study on the toxicokinetics of mono-ortho Co-PCBs in mice showed no dose-dependent hepatic sequestration for several mono-ortho Co-PCBs (De Vito et al., 1998
). A study using CYP1A2 knockout mice provided direct evidence that CYP1A2 is responsible for the sequestration of 2378-T4CDD and 23478-P5CDF in hepatic tissue (Diliberto et al., 1999
). A more recent study demonstrated no altered 2378-T4CDD accumulation in Cyp1a1(-/-) knockout mice liver (Uno et al., 2004
). These reports suggest that hepatic sequestration is caused by CYP1A2, and not by CYP1A1, in mammalian species. The present study indicated that CYP1A5 might be involved in hepatic sequestration of certain DRCs in JC. Comparing the amino acid sequences of chicken CYP1A4/5 isoforms with those of mammalian CYP1A isoforms, neither chicken CYP1A4 nor CYP1A5 appears to be directly orthologous to CYP1A1 or CYP1A2 (Gilday et al., 1996
). On the other hand, the CYP1A5 is involved mainly in arachidonic acid epoxygenation (Nakai et al., 1992
; Rifkind et al., 1994
), which is preferentially catalyzed by mammalian CYP1A2 (Jacobs et al., 1989
; Lambrecht et al., 1992
). Furthermore, Handly-Goldstone and Stegeman (in press)
suggested that avian and mammalian CYP1A paralog pairs might have resulted from a single gene duplication event, and that concerted evolution has obscured orthologous relationships. Since the phylogenetic analysis of substrate recognition sites 24 of CYP1A revealed that there is no evidence that CYP1As have undergone conversion, they proposed that chicken CYP1A4 and CYP1A5 are orthologous to mammalian CYP1A1s and CYP1A2s, respectively. Considering that avian CYP1A4s and CYP1A5s may be orthologous to mammalian CYP1A1s and CYP1A2s, respectively, it is consistent that JC CYP1A5 is involved in hepatic sequestration of DRCs. In addition, we could find significantly greater hepatic sequestrations of PCDD/DF and some Co-PCB congeners in JCs than those in cormorant (Fig. 2). Further research is necessary to characterize species- and isoform-specific function of avian CYP1As, particularly in terms of metabolism and hepatic sequestration toward DRCs.
| NOTES |
|---|
The nucleotide sequence of JC CYP1A5 has been deposited in the DDBJ/EMBL/GenBank database under accession number AB220967.
| ACKNOWLEDGMENTS |
|---|
We thank Prof. An. Subramanian, Ehime University, for critical reading of this manuscript. Financial assistance was provided by "Survey on the State of Dioxin Accumulation in Wildlife" from the Ministry of the Environment, Japan. This study was also supported by Grants-in-Aid for Scientific Research (A) (nos. 17208030 and 16201014) and (B) (no. 13480170), and for Exploratory Research (no. 13027101), and by "21st Century COE Program" from the Ministry of Education, Culture, Sports, Science and Technology, Japan. Conflict of interest: none declared.
| REFERENCES |
|---|
|
|
|---|
Bosveld, A. T. C., Grandener, J., Murk, A. J., Brouwer, A., Van Kampen, M., Evers, E. H. G., and Van den Berg, M. (1995). Effects of PCDDs, PCDFs and PCBs in common tern (Sterna hirundo) breeding in estuarine and coastal colonies in the Netherlands and Belgium. Environ. Toxicol. Chem. 14, 99115.
Bosveld, A. T. C., Nieboer, R., De Bont, A., Mennen, J., Murk, A. J., Feyk, L. A., Giesy, J. P., and Van den Berg, M. (2000). Biochemical and developmental effects of dietary exposure to polychlorinated biphenyls 126 and 153 in common tern chicks (Sterna hirundo). Environ. Toxicol. Chem. 19, 719730.[CrossRef]
Burke, M. D., Thompson, S., Weaver, R. J., Wolf, C. R., and Mayer, R. T. (1994). Cytochrome P450 specificities of alkoxyresorufin O-dealkylation in human and rat liver. Biochem. Pharmacol. 48, 923936.[CrossRef][Web of Science][Medline]
Chen, C. Y., Hamm, J. T., Hass, J. R., and Birnbaum, L. S. (2001). Distribution of polychlorinated dibenzo-p-dioxins, dibenzofurans, and non-ortho polychlorinated biphenyls in pregnant Long Evans rats and the transfer to offspring. Toxicol. Appl. Pharmacol. 173, 6588.[CrossRef][Web of Science][Medline]
DeVito, M. J., Ross, D. G., Dupuy, A. E., Jr., Ferrario, J., McDaniel, D., and Birnbaum, L. S. (1998). Dose-response relationships for disposition and hepatic sequestration of polyhalogenated dibenzo-p-dioxins, dibenzofurans, and biphenyls following subchronic treatment in mice. Toxicol. Sci. 46, 223234.
Diliberto, J. J., Burgin, D. E., and Birnbaum, L. S. (1999). Effects of CYP1A2 on disposition of 2,3,7,8-tetrachlorodibenzo-p-dioxin, 2,3,4,7,8-pentachlorodibenzofuran, and 2,2',4,4',5,5'-hexachlorobiphenyl in CYP1A2 knockout and parental (C57BL/6N and 129/Sv) strains of mice. Toxicol. Appl. Pharmacol. 159, 5264.[CrossRef][Web of Science][Medline]
Edwards, R. J., Murray, B. P., Boobis, A. R., and Davies, D. S. (1989). Identification and location of
-helices in mammalian cytochrome P450. Biochemistry 28, 37623770.[CrossRef][Medline]
Giesy, J. P., Ludwig, J. P., and Tillitt, D. E. (1994). Deformites in birds of the great lakes region. Environ. Sci. Technol. 28, 128A135A.
Gilday, D., Gannon, M., Yutzey, K., Bader, D., and Rifkind, A. B. (1996). Molecular cloning and expression of two novel avian cytochrome P450 1A enzymes induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin. J. Bio. Chem. 271, 3305433059.
Guengerich, F. P. (1982). Microsomal enzymes involved in toxicology: Analysis and separation. In Principles and Methods of Toxicology (A. W. Hayes, Ed.), pp. 609634. Raven Press, New York.
Guruge, K. S., and Tanabe, S. (1997). Congener specific accumulation and toxic assessment of polychlorinated biphenyls in common cormorants, Phalacrocorax carbo, from Lake Biwa, Japan. Environ. Pollut. 96, 425433.[CrossRef][Medline]
Guruge, K. S., Tanabe, S., and Fukuda, M. (2000). Toxic assessment of PCBs by the 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalent in common cormorant (Phalacrocorax carbo) from Japan. Arch. Environ. Contam. Toxicol. 38, 509521.[CrossRef][Web of Science][Medline]
Handly-Goldstone, H. M., and Stegeman, J. J. (in press). Evidence of a single gene duplication and gene conversion in tetrapod CYP1As. J. Mol. Evol.
Hu, K., and Bunce, N. J. (1999). Metabolism of polychlorinated dibenzo-p-dioxins by rat liver microsomes. J. Biochem. Mol. Tox. 13, 307315.
Imai, M., Shimada, H., Watanabe, Y., Matsushima-Hibiya, Y., Makino, R., Koga, H., Horiuchi, T., and Ishimura, Y. (1989). Uncoupling of the cytochrome P-450cam monooxygenase reaction by a single mutation, threonine-252 to alanine or valine: A possible role of the hydroxyl amino acid in oxygen activation. Proc. Natl. Acad. Sci. U.S.A. 86, 78237827.
Iwata, H., Watanabe, M., Okajima, Y., Tanabe, S., Amano, M., Miyazaki, N., and Petrov, E. A. (2004). Toxicokinetics of PCDD, PCDF, and coplanar PCB congeners in Baikal seals, Pusa sibirica: Age-related accumulation, maternal transfer, and hepatic sequestration. Environ. Sci. Technol. 38, 35053513.[Medline]
Iwata, H., Yoshinari, K., Negishi, M., and Stegeman, J. J. (2002). Species-specific responses of constitutively active receptor (CAR) CYP2B coupling: Lack of CYP2B inducer-responsive nuclear translocation of CAR in marine teleost, scup (Stenotomus chrysops). Comp. Biochem. Physiol. 131C, 501510.
Jacobs, J. M., Sinclair, P. R., Bement, W. J., Lambrecht, R. W., Sinclair, J. F., and Goldstein, J. A. (1989). Oxidation of uroporphyrinogen by methylcholanthrene-induced cytochrome P-450d. Essential role of cytochrome P-450d. Biochem. J. 258, 247253.[Web of Science][Medline]
Jones, P. D., Giesy, J. P., Newsted, J. L., Verbrugge, D. A., Beaver, D. L., Ankley, G. T., Tillitt, D. E., Lodge, K. B., and Niemi, G. J. (1993). 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents in tissues of birds at Green Bay, Wisconsin, USA. Arch. Environ. Contam. Toxicol. 24, 345354.
Kennedy, S. W., Lorenzen, A., Jones, S. P., Hahn, M. E., and Stegeman, J. J. (1996). Cytochrome P4501A induction in avian hepatocyte cultures: A promising approach for predicting the sensitivity of avian species to toxic effects of halogenated aromatic hydrocarbons. Toxicol. Appl. Pharmacol. 141, 214230.[Web of Science][Medline]
Koistinen, J., Koivusaari, J., Nuuja, I., Vuorinen, P. J., Paasivirta, J., and Giesy, J. P. (1997). 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents in extracts of Baltic white-tailed sea eagles. Environ. Toxicol. Chem. 16, 15331544.[CrossRef]
Körner, W., Golor, G., Schulz, T., Wiesmüller, T., Hagenmaier, H., and Neubert, D. (2002). Tissue concentrations and induction of a hepatic monooxygenase in male Wister rats after repeated doses of defined polychlorinated dibenzo-p-dioxin and dibenzofuran (PCDDs and PCDFs) mixtures. Arch. Toxicol. 75, 653664.[CrossRef][Web of Science][Medline]
Kubota, A., Iwata, H., Tanabe, S., Yoneda, K., and Tobata, S. (2004). Levels and toxicokinetic behaviors of PCDD, PCDF, and coplanar PCB congeners in common cormorants from Lake Biwa, Japan. Environ. Sci. Technol. 38, 38533859.[Medline]
Kubota, A., Iwata, H., Tanabe, S., Yoneda, K., and Tobata, S. (2005). Hepatic CYP1A induction by dioxin-like compounds, and congener-specific metabolism and sequestration in wild common cormorants from Lake Biwa, Japan. Environ. Sci. Technol. 39, 36113619.[Medline]
Lambrecht, R. W., Sinclair, P. R., Gorman, N., and Sinclair, J. F. (1992). Uroporphyrinogen oxidation catalyzed by reconstituted cytochrome P4501A2. Arch. Biochem. Biophys. 294, 504510.[CrossRef][Web of Science][Medline]
Leffin, M., and Riviere, J. L. (1992). Effects of some inducers on hepatic and extrahepatic drug metabolism in the mallard duck (Anas platyrhynchos). Comp. Biochem. Phys. 102C, 471476.[CrossRef]
Murk, A., Morse, D., Boon, J., and Brouwer, A. (1994). In vitro metabolism of 3,3',4,4'-tetrachlorobiphenyl in relation to ethoxyresorufin-O-deethylase activity in liver microsomes of some wildlife species and rat. Eur. J. Pharmacol. 270, 253261.[Web of Science][Medline]
Nakai, K., Ward, A. M., Gannon, M., and Rifkind, A. B. (1992). ß-naphthoflavone induction of a cytochrome P-450 arachidonic acid epoxygenase in chick embryo liver distinct from the aryl hydrocarbon hydroxylase and from phenobarbital-induced arachidonate epoxygenase. J. Biol. Chem. 267, 1950319512.
Poland, A., and Glover, E. (1973). Chlorinated dibenzo-p-dioxins: Potent inducers of
-aminolevulinic acid synthetase and aryl hydrocarbon hydroxylase. Mol. Pharmacol. 9, 736747.
Rattner, B. A., Melancon, M. J., Custer, T. W., Hothem, R. L., King, K. A., LeCaptain, L. J., Spann, J. W., Woodin, B. R., and Stegeman, J. J. (1993). Biomonitoring environmental contamination with pipping black-crowned night heron embryos: Induction of cytochrome P450. Environ. Toxicol. Chem. 12, 17191732.
Rifkind, A. B., Kanetoshi, A., Orlinick, J., Capdevila, J. H., and Lee, C. (1994). Purification and biochemical characterization of two major cytochrome P-450 isoforms induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in chick embryo liver. J. Biol. Chem. 269, 33873396.
Sanderson, J. T., and Bellward, G. D. (1995). Hepatic microsomal ethoxyresorufin O-deethylase-inducing potency in ovo and cytosolic Ah receptor binding affinity of 2,3,7,8-tetrachlorodibenzo-p-dioxin: Comparison of four avian species. Toxicol. Appl. Pharmacol. 132, 131145.[CrossRef][Web of Science][Medline]
Senthilkumar, K., Iseki, N., Hayama, S., Nakanishi, J., and Masunaga, S. (2002a). Polychlorinated dibenzo-p-dioxins, dibenzofurans, and dioxin-like polychlorinated biphenyls in livers of birds from Japan. Arch. Environ. Contam. Toxicol. 42, 244255.[CrossRef][Web of Science][Medline]
Senthilkumar, K., Kannan, K., Giesy, J. P., and Masunaga, S. (2002b). Distribution and elimination of polychlorinated dibenzo-p-dioxins, dibenzofurans, biphenyls, and p,p'-DDE in tissues of bald eagles from the upper peninsula of Michigan. Environ. Sci. Technol. 36, 27892796.[Medline]
Senthilkumar, K., Watanabe, K., Takemori, H., Iseki, N., Masunaga, S., and Takasuga, T. (2005). Analysis of UNEP priority POPs using HRGC-HRMS and their contamination profiles in livers and eggs of great cormorants (Phalacrocorax carbo) from Japan. Arch. Environ. Contam. Toxicol. 48, 538551.[CrossRef][Web of Science][Medline]
Smith, P. K., Krohn, R. I., and Hermanson, G. T. (1985). Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 7685.[CrossRef][Web of Science][Medline]
Tai, H. L., McReynolds, J. H., Goldstein, J. A., Eugster, H. P., Sengstag, C., Alworth, W. L., and Olson, J. R. (1993). Cytochrome P4501A1 mediates the metabolism of 2,3,7,8-tetrachlorodibenzofuran in the rat and human. Toxicol. Appl. Pharmacol. 123, 3442.[CrossRef][Web of Science][Medline]
Uno, S., Dalton, T. P., Sinclair, P. R., Gorman, N., Wang, B., Smith, A. D., Miller, M. L., Shertzer, H. G., and Nebert, D. W. (2004). Cyp1a1(-/-) male mice: Protection against high-dose TCDD-induced lethality and wasting syndrome, and resistance to intrahepatocyte lipid accumulation and uroporphyria. Toxicol. Appl. Pharmacol. 196, 410421.[CrossRef][Web of Science][Medline]
Van den Berg, M., Birnbaum, L., Bosveld, A. T. C., Brunström, B., Cook, P., Feeley, M., Giesy, J. P., Hanberg, A., Hasegawa, R., Kennedy, S. W., et al. (1998). Toxic equivalency factors (TEFs) for PCBs, PCDDs, PCDFs for humans and wildlife. Environ. Health Perspect. 106, 775792.[Web of Science][Medline]
Van den Berg, M., De Jongh, J., Poiger, H., and Olson, J. R. (1994). The toxicokinetics and metabolism of polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) and their relevance for toxicity. Crit. Rev. Toxicol. 24, 174.[Web of Science][Medline]
Verbrugge, L. A., Giesy, J. P., Verbrugge, D. A., Woodin, B. R., and Stegeman, J. J. (2001). Catalytic and immunochemical properties of hepatic cytochrome P450 1A in three avian species treated with ß-naphthoflavone or isosafrole. Comp. Biochem. Phys. 130C, 6783.[CrossRef]
Wan, Y., Hu, J., Yang, M., An, L., An, W., Jin, X., Hattori, T., and Itoh, M. (2005). Characterization of trophic transfer for polychlorinated dibenzo-p-dioxins, dibenzofurans, non- and mono-ortho polychlorinated biphenyls in the marine food web of Bohai Bay, North China. Environ. Sci. Technol. 39, 24172425.[Medline]
Watanabe, M. X., Iwata, H., Watanabe, M., Tanabe, S., Subramanian, An., Yoneda, K., and Hashimoto, T. (2005). Bioaccumulation of organochlorines in crows from Indian open waste dumping site: Evidence for direct transfer of dioxin-like congeners from the contaminated soil. Environ. Sci. Technol. 39, 44214430.[Medline]
Yeom, H., Sligar, S. G., Li, H., Poulos, T. L., and Fulco, A. J. (1995). The role of thr268 in oxygen activation of cytochrome P450BM-3. Biochemistry 34, 1473314740.[CrossRef][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Hirakawa, H. Iwata, Y. Takeshita, E.-Y. Kim, T. Sakamoto, Y. Okajima, M. Amano, N. Miyazaki, E. A. Petrov, and S. Tanabe Molecular Characterization of Cytochrome P450 1A1, 1A2, and 1B1, and Effects of Polychlorinated Dibenzo-p-dioxin, Dibenzofuran, and Biphenyl Congeners on Their Hepatic Expression in Baikal Seal (Pusa sibirica) Toxicol. Sci., June 1, 2007; 97(2): 318 - 335. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kubota, H. Iwata, H. M. H. Goldstone, E.-Y. Kim, J. J. Stegeman, and S. Tanabe Cytochrome P450 1A4 and 1A5 in Common Cormorant (Phalacrocorax carbo): Evolutionary Relationships and Functional Implications Associated with Dioxin and Related Compounds Toxicol. Sci., August 1, 2006; 92(2): 394 - 408. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






