ToxSci Advance Access originally published online on January 4, 2006
Toxicological Sciences 2006 90(2):317-325; doi:10.1093/toxsci/kfj091
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Diethanolamine and Phenobarbital Produce an Altered Pattern of Methylation in GC-Rich Regions of DNA in B6C3F1 Mouse Hepatocytes Similar to That Resulting from Choline Deficiency
* Department of Pharmacology and Toxicology, Michigan State University, East Lansing, Michigan 48824; and Department of Pharmacology and Toxicology, Indiana University School of Medicine, Indianapolis, Indiana 46202
1 To whom correspondence should be addressed at Michigan State University, B-440 Life Sciences Bldg., East Lansing, MI 48824. Fax: (517) 353-8915. E-mail: goodman3{at}msu.edu.
Received November 22, 2005; accepted December 28, 2005
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSUPPLEMENTARY DATAREFERENCES |
|---|
DNA methylation is an epigenetic mechanism regulating transcription, which when disrupted, can alter gene expression and contribute to carcinogenesis. Diethanolamine (DEA), a non-genotoxic alkanolamine, produces liver tumors in mice. Studies suggest DEA inhibits choline uptake and causes biochemical changes consistent with choline deficiency (CD). Rodents fed methyl-deficient diets exhibit altered methylation of hepatic DNA and an increase in liver tumors, e.g., CD causes liver tumors in B6C3F1 mice. We hypothesize that DEA-induced CD leads to altered methylation patterns which facilitates tumorigenesis. B6C3F1 hepatocytes in primary culture were grown in the presence of either 4.5 mM DEA, 3 mM Phenobarbital (PB), or CD media for 48 h. These concentrations induced comparable increases in DNA synthesis. PB, a nongenotoxic rodent liver carcinogen known to alter methylation in mouse liver, was included as a positive control. Global, average, DNA methylation status was not affected. The methylation status of GC-rich regions of DNA, which are often associated with promoter regions, were assessed via methylation-sensitive restriction digestion and arbitrarily primed PCR with capillary electrophoretic separation and detection of PCR products. DEA, PB, and CD treatments resulted in 54, 63, and 54 regions of altered methylation (RAMs), respectively, and the majority were hypomethylations. A high proportion of RAMs (72%) were identical when DEA was compared to CD. Similarly, 70% were identical between PB and CD. Altered patterns of methylation in GC-rich regions induced by DEA and PB resemble that of CD and indicate that altered DNA methylation is an epigenetic mechanism involved in the facilitation of mouse liver tumorigenesis.
Key Words: DNA methylation; diethanolamine; choline deficiency; phenobarbital; GC-rich regions.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSUPPLEMENTARY DATAREFERENCES |
|---|
Diethanolamine (DEA), an alkanolamine, is used in industrial applications such as textile processing, industrial gas purification, and preparation of agricultural chemicals. In addition, fatty acid condensates synthesized from DEA are found in numerous consumer products such as cosmetics, soaps, and detergents (Knaak et al., 1997
). Widespread human exposure to DEA prompted the National Toxicology Program (NTP) to examine its carcinogenic potential. Dermal applications of DEA in 95% ethanol for two years led to significant increases in the incidence and multiplicity of liver tumors in male and female B6C3F1 mice, but not F344 rats. Recently, DEA-induced increases in liver cell proliferation were observed in vitro. Importantly, this effect was specific to F344 rats and B6C3F1 mice and not observed with human hepatocytes (Kamendulis and Klaunig, 2005). Based on in vitro genetic toxicity studies DEA and/or its metabolites are not mutagenic (NTP, 1999), suggesting that it induces a tumorigenic response via a secondary, non-genotoxic mechanism(s).
Similar in structure to ethanolamine and choline, two essential precursors for the synthesis of phospholipids, DEA is incorporated into hepatic phospholipids, perhaps disrupting regulation of choline and 1-carbon metabolism. Furthermore, DEA can inhibit the uptake of choline leading to intracellular deficiency, even if there is an adequate amount of choline in the diet (Lehman-McKeeman and Gamsky, 1999). Deficiencies in the major dietary sources of methyl groups, specifically, choline and methionine, lead to hepatocarcinogenesis in rodents (Henning and Swendseid, 1996; Poirier, 1994). Choline deficiency (CD) causes hepatocyte proliferation and apoptosis (Albright et al., 1996, Ziesel, 1996). In particular, CD in rodents, including B6C3F1 mice, in the absence of known carcinogens, increases liver tumor development (Newberne et al., 1982, Newberne and Rodgers, 1986).
Diets lacking in choline and methionine result in altered levels of S-adenosyl methionine (SAM), and S-adenosyl homocysteine (SAH). SAM is the main methyl donor for a variety of methylation reactions including DNA methylation (Ziesel, 1996). In effect, methyl deficiency decreases SAM and increases SAH shifting the proportionality towards SAH which is a feedback inhibitor of DNA methyltransferases and, therefore, the SAM/SAH ratio is a determinant of the extent of methylation (Shivapurkar and Poirier, 1983). In B6C3F1 mice, dermal application of DEA resulted in decreased levels of SAM, increased levels of SAH, and a reduction in phosphocholine, the intracellular storage form of choline, which are all consistent with previous reports of biochemical changes associated with CD which leads to methyl deficiency (Lehman-McKeeman et al., 2002). Indeed, deficiencies in methionine and choline have been shown to lead to global, average hypomethylation of DNA in the livers of B6C3F1 mice (Counts et al., 1996).
It has been hypothesized that alteration of the epigenome, specifically DNA methylation, is a mechanism underlying DEA-induced tumorigenesis in B6C3F1 mouse liver (Kamendulis and Klaunig, 2005; Lehman-McKeeman and Gamsky, 1999). Methylation of cytosines to produce 5-methyl cytosine is a well characterized, heritable, epigenetic mark (Feinberg, 2001). The majority of 5-methyl cytosine occurs at cytosines 5' to guanine. These CpG dinucleotides are not evenly distributed throughout the genome (Bird, 2002), but are concentrated in GC-rich promoter regions of genes and transposable elements typically being located within CpG islands which are stretches of DNA, at least 200 bp in length that possess a 50% or greater GC content and a higher proportion of CpG dinucleotides than expected (Gardiner-Garden and Frommer, 1987). Decreases in methylation are associated with increases in gene transcription while increases in methylation are associated with decreases in gene transcription (Jones and Laird, 1999).
Phenobarbital (PB) is a non-genotoxic promoter of rodent liver tumors (Whysner et al., 1996). Increased cell proliferation and altered DNA methylation are likely involved in tumor promotion (Goodman and Watson, 2002). Following PB administration increases in DNA synthesis occur in B6C3F1 liver, indicating enhanced cell proliferation, as early as 1–2 weeks (Klaunig, 1993). Additionally, PB induces more global hypomethylation in the liver tumor-prone B6C3F1 mouse, as compared to the relatively resistant C57BL/6, mouse (Counts et al., 1996). A more critical look at this has shown that PB induces hypermethylation in selected GC-rich regions of DNA in addition to global hypomethylation demonstrating a non-random disruption of the epigenome (Watson and Goodman, 2002).
Using B6C3F1 mouse hepatocytes in primary culture, we have examined GC-rich regions of the genome for changes in methylation in response to treatment with DEA, choline deficient media, or PB. The hypothesis being tested is that DEA-induced CD leads to altered methylation patterns which facilitate mouse liver tumorigenesis. The effects of DEA and PB on DNA methylation status was ascertained and compared with changes produced by CD. Specifically, we have assessed global (average) methylation and evaluated the methylation status of GC-rich regions of the genome using an arbitrarily primed PCR approach.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSUPPLEMENTARY DATAREFERENCES |
|---|
Mouse hepatocytes.
Male B6C3F1 mice, 6–8 weeks old, obtained from Harlan Sprague-Dawley were housed in a facility at Indiana University School of Medicine (IUSM) and cared for in accordance with the University's animal use and care guidelines. Hepatocytes were isolated by a two-step in situ collagenase perfusion (Klaunig et al., 1981
), cultured, and treated with 4.5 mM DEA, 0.0898 mg/l choline, or 3 mM PB for 48 h at IUSM. Isolated hepatocytes from each of three animals per dosing group were divided and cultured in two plates. DNA was obtained from 8–10 x 106 cells using TRIzol Reagent, following the manufacturer's guidelines.
DNA synthesis.
Replicative DNA synthesis was measured according to the method of James and Roberts (1996). BrdU (20 mM final concentration) was added to cell cultures during the last 16 h of culture. Cells, 1 x 106 hepatocytes/60 mm culture dish, were washed and fixed with methanol. Incorporated BrdU was localized using an anti-BrdU antibody followed by a peroxidase linked secondary antibody and a DAB substrate. Replicative DNA synthesis was measured by scoring the percentage of BrdU positive nuclei in a minimum of 1000 hepatocytes. Statistical significance was determined via a Randomized Complete Block Design ANOVA, post-hoc test, Tukey's, p < 0.05.
SssI global (average) methylation assay.
This assay allows for methylation at the 5' position of cytosine at every unmethylated CpG site in DNA via the enzyme SssI methylase using [Methyl-3H] S-adenosyl methionine (SAM) as the methyl donor, as described previously (Counts et al., 1996). Global DNA methylation can be determined by the amount of 3H-methyl groups incorporated into DNA, since there is an inverse relationship between incorporation of radioactivity and the degree of methylation. Each DNA sample was incubated with 0.75µg of DNA per 5 replicates with 2.25 units SssI Methylase, 1.5µCi [3H-methyl] SAM and reaction buffer (10 mM Tris, 120 mM NaCl, 10 mM EDTA, 1 mM DTT, pH 7.9) to volume. Reactions were spotted onto DE81 ion exchange filters and washed with 25 ml 0.5M phosphate buffer, 2 ml 70% ethanol and 2 ml 100% ethanol and allowed to dry before scintillation counting. All results are expressed as cpm/µg DNA.
Arbitrarily Primed PCR and Capillary Electrophoresis
A comparison of data obtained from DNA isolated from control and treated tissue permits the simultaneous detection of treatment-related increased methylation (hypermethylation, more methylation in a region that was methylated in control), decreased methylation (hypomethylation, less methylation in a region that was methylated in control), and new methylations (methylation in regions that were not methylated in control). Therefore, the procedure we have developed provides an in depth picture of treatment related altered methylation is provided.
Restriction digests.
DNA samples are subjected to double digests with restriction enzymes: (1) a methylation insensitive enzyme, and (2) a methylation sensitive enzyme. RsaI is the methylation insensitive enzyme which is used initially to cut DNA into fragments in order to facilitate complete digestion by the second enzyme, a methylation-sensitive restriction enzyme. The methylation sensitive enzymes used in this study were MspI and HpaII. Both recognize 5'CCGG 3' sites, and cut between the cytosine and guanine. MspI will not restrict DNA if the external cytosine is methylated, while HpaII will not restrict DNA if the internal cytosine is methylated. Both RsaI/MspI and RsaI/HpaII double digests were employed.
Arbitrarily primed PCR (AP-PCR) and capillary electrophoresis.
PCR is performed on restriction digests using a single arbitrary primer 5' AACCCTCACCCTAACCCCGG 3' (Gonzalgo et al., 1997), that was modified by having it fluorescently labeled at the 5' end with HEX (purchased from Integrated DNA Technologies). This primer was designed to bind well to GC-rich regions and the 5'CCGG 3' sequence at its 3' end increases the probability of primer annealing to the HpaII and MspI restriction site. This allows for detection of methylation at the site of primer annealing and between sites of primer annealing. Each PCR product is viewed as representing a GC-rich region of the genome. PCR products were purified, using a sephadex G50 superfine matrix, and separated via capillary electrophoresis, using an ABI 3700 Genetic Analyzer (Genomics Technology Support Facility [GTSF] at Michigan State University). Base pair markers are run simultaneously with the samples in order to accurately size the PCR products. The results represented as size of PCR products, in base pairs, and their corresponding peak areas are analyzed using the Excel program. A consensus, average, peak area for each PCR product reporting in control and treated groups is prepared, and the consensus control and treated peak areas at a specific PCR product are compared. This permits us to detect treatment-related: (1) hypomethylations which include both 100% decreases and decreases which are statistically significant when compared to control, (2) hypermethylations which are increases which are statistically significant when compared to control, and (3) new methylations which are indicated by the formation of a PCR product following treatment which was not formed under control conditions. Significance is determined via a Student's t-test, p < 0.05. Analysis of the data includes the following assumptions: (1) each separate PCR product of a defined size represents a distinct region of the genome, (2) a region can include one or more recognition sequences for the specific methylation-sensitive restriction enzyme employed located between the annealing sites of the up- and down-stream primers; thus, the amount of each PCR product formed can be viewed as representing an "average" of the methylation status of the particular recognition sequences located between the up- and down-stream primers, and (3) changes in the amount of each PCR product represents the altered methylation status of a particular GC-rich region of DNA. A detailed account of the AP-PCR, capillary electrophoresis method, including the data analysis steps are provided as Supplementary Data.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSUPPLEMENTARY DATAREFERENCES |
|---|
In order to provide an equivalent baseline from which we could compare the effects of DEA, PB, or CD on the methylation status of DNA in B6C3F1 hepatocytes, we selected concentrations (4.5 mM, 3 mM, and 0.098 mg/l for DEA, PB, and CD media, respectively) that produced equivalent increases in DNA synthesis during the 48 h culture period (Table 1). DEA or PB treatment as well as culture in CD media did not affect global, average methylation status (Fig. 1).
|
|
Analysis of GC-rich regions of DNA provided a more detailed picture of altered methylation patterns than simply evaluating global, average methylation. DEA treatment resulted in 43 regions of hypomethylation, which composed 80% of the total aberrant regions detected within GC-rich areas of DNA (Fig. 2A). Of these, 26 (60%) exhibited a 100% decrease (i.e., a complete loss of methylation) at those regions. The large degree of significant decreases in methylation (both partial and complete hypomethylation) was approximately equal in number at both the external and internal cytosine of 5'-CCGG-3' regions based upon the results of the RsaI/MspI and RsaI/HpaII digests. In comparison, relatively few regions of methylation increased with only 1 hypermethylation and 10 new regions of methylation (Figs. 2A and 2D). Here increases were mainly detected via the RsaI/HpaII digest indicating a preference for altered methylation of the internal cytosine within the recognition sequence.
|
PB produced a pattern of altered methylation similar to DEA. The largest proportion of altered regions, 75%, were hypomethylations (Fig. 2B) with 49% of the total decreases exhibiting a complete loss of methylation. Increases in methylation included 3 regions of hypermethylation and 13 regions of new methylation (Figs. 2B and 2C). Similar to the results obtained from DEA treatment, there was a bias towards increased methylation at the internal cytosine within the 5'CCGG 3' recognition sequence.
DNA isolated from hepatocytes maintained in CD media exhibited the greatest number of regions where 5'Me-C content was either partially or completely decreased (Fig. 2C). Methylation was lost completely in 37 of the 49 (76%) total hypomethylated regions. Very few increases in methylation were observed; 1 site of hypermethylation was identified via the RsaI/HpaII digest and 4 regions of new methylation were identified via the RsaI/MspI digest (Figs. 2C and 2D) indicating that of the small number of increases, most occurred at the external cytosine in contrast to increases induced by DEA or PB which occurred mainly at the internal cytosine. The predominate alteration in methylation patterns was a decrease in methylation at multiple regions within GC-rich regions. PB produced the greatest degree of altered methylation with 63 total altered regions. DEA and CD treatment were strikingly similar with 54 total altered regions (Table 2).
|
Due to the overall similarity in patterns of altered methylation among the different treatments, a more refined approach to analyzing and comparing the data was employed. Changes occurring at identical PCR product sizes between two treatments were considered common regions of altered methylation. Figure 3 depicts the 39 regions of altered methylation in common between DEA and CD treatments. The magnitudes of change at only 2 regions of the 39 total regions were statistically different (Fig. 3 and Table 3). Of the 44 common regions of altered methylation between PB and CD treatments, only 5 regions differed statistically in magnitude (Fig. 4 and Table 3). The patterns of altered methylation produced by DEA and PB were 72 and 70% similar, respectively, to that of CD demonstrating the high degree of similarity (Table 3). Unique changes elicited by DEA and PB were few in numbers (Table 4).
|
|
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSUPPLEMENTARY DATAREFERENCES |
|---|
We have developed and applied a novel procedure for analyzing altered methylation in GC-rich regions of the genome, including CpG islands. Simple in design, this technique employs methylation sensitive restriction digestion of DNA, arbitrarily primed PCR amplification, and electrophoretic separation of PCR products to provide a detailed, quantitative overview of the extent of treatment-related disruption of methylation throughout the genome. Comparably, the strength and utility of our technique lies in its ability to simultaneously identify increases, decreases, and new methylations within multiple, distinct regions of the genome. This provides a sensitive, quantitative method which reproducibly detects the extent of treatment-related altered patterns of methylation.
There are a variety of techniques for analyzing changes in methylation within a particular gene. Methylation specific PCR, including variations such as MethyLight and HM Methyl Light can be effectively employed for these applications (Cottrell and Laird, 2003). Other procedures include combined bisulfite restriction analysis (COBRA) which assesses the methylation status of particular CpG sites (Xiong and Laird, 1997) and the enzymatic regional methylation assay for determining changes in methylation between two primers designed for a targeted region (Galm et al., 2002). These are excellent methods for evaluating specific genes. However, their utility is limited when one wants to discern the extent to which a particular treatment might disrupt normal methylation patterns, e.g., in this situation a gene-by-gene approach would be too cumbersome.
The methylation-sensitive amplified fragment length polymorphism (AFLP) technique allows for comparative genome wide scanning of methylation status via fingerprinting techniques and has recently been adapted to a DNA microarray hybridization technique (Yamamoto and Yamamoto, 2004). This procedure requires a custom microarray panel and a complex approach to data analysis. Global, average methylation analysis via SssI methyltransferase (Balaghi and Wagner, 1993) is straightforward, but limited in scope; increases in methylation in one portion of the genome may balance out decreases in other areas. The combined AP-PCR capillary electrophoresis technique described in this article affords the ability to assess altered DNA methylation (increases, decreases, and new methylations) in multiple GC-rich regions of the genome simultaneously and quantitatively. Furthermore, it is highly appropriate under situations when the research question being asked is, "Does a particular treatment cause disruption of normal patterns of DNA methylation and to what extent does this occur?" With this methodology we have assessed DEA, CD, and PB induced alteration of methylation in B6C3F1 mouse hepatocytes.
The ability of DEA to alter methylation in vitro in B6C3F1 mouse hepatocytes was investigated as a proposed non-genotoxic mode of action of the compound's ability to cause carcinogenesis in mouse liver. Since high rates of DNA synthesis might compromise the capacity to maintain normal methylation patterns leading to mis-regulated gene expression patterns doses were selected based on induction of comparable increases in cell proliferation. Therefore, we were able to directly compare and analyze changes in methylation employing a common baseline.
Several factors work in concert to sustain normal methylation levels. These include the maintenance (Dnmt 1) and de novo DNA methyltransferases (Dnmt3a and 3b), demethylases and the availability of both SAM and methyl groups. For example, Dnmt1 is the maintenance methyltransferase responsible for methylating newly synthesized daughter strands of DNA; this ensures the heritability of the methylation pattern (Hermann et al., 2004). Altered patterns of methylation, specifically hypomethylation, may arise when the activity of Dnmt1 does not increase with enhanced rates of DNA synthesis. Alternatively, the same effect could be observed if SAM does not provide a sufficient supply of methyl groups, (i.e., methyl deficiency depletes the availability of methyl groups), to maintain the up regulated Dnmt1 activity. DNA methylation patterns are also under the influence of demethylases (e.g., MBD2) which can decrease the level of 5-methyl cytosine when cells are not synthesizing DNA (Detich et al., 2003). Thus, indicating that DNA methylation is reversible. Importantly, SAM directly inhibits MBD2 and, therefore, diminished formation of SAM during a state of methyl deficiency could relieve the inhibition of demethylase activity and facilitate hypomethylation of DNA (Detich et al., 2003). As hypothesized, DEA, by inducing cellular choline depletion, contributes to perturbation of 1-carbon metabolism, leading to decreased availability of methyl groups, impaired formation of SAM, and disruption of normal DNA methylation patterns.
Assessment of global (average) methylation status and methylation of GC-rich regions of DNA were performed. Global, average levels of methylation following treatment with DEA, CD media, and PB were comparable to control (Fig. 1). In a previous study global hypomethylation of hepatic DNA was observed following treatment of B6C3F1 mice with PB in vivo (Counts et al., 1996). These data are not necessarily incompatible with the current observation because total liver DNA was examined following treatment for 1 week, or more, as compared to a 48 h in vitro exposure of isolated hepatocytes. The current data could indicate that (1) global methylation levels are unaffected by DEA, CD, and PB or (2) approximately equal levels of methylation increases and decreases are occurring simultaneously in multiple regions of the genome. In light of the fact that the SssI procedure for evaluating global methylation assesses the methylation status of all cytosines 5' to guanines (whether or not they are located in GC-rich regions of DNA), the second possibility underlies the importance of specifically examining GC-rich regions for a more detailed picture of overall altered methylation.
Within GC-rich regions of DNA, hypomethylation was the predominant alteration induced by DEA, PB, and CD. Hypomethylation in the promoter regions of genes is associated with increased gene expression (Jones and Baylin, 2002). Critical losses of methylation in the promoter regions of oncogenes such as c-jun and c-myc, CDNK3 (cyclin-dependent kinase inhibitor 3), and c-Ha-ras, have been demonstrated (Niculescu et al., 2004; Tao et al., 2000). Hypomethylation associated overexpression of c-jun and c-myc was observed in livers promoted with dichloroacetic and trichloroacetic acid, both of which are considered non-genotoxic carcinogens (Tao et al., 2000). Human neuroblastoma cells cultured in CD media showed loss of methylation in the promoter region of the CDNK3 gene, an important regulator of cell cycle progression, and up-regulation of expression. In addition, genetic instability via activation of transposable elements (Roman-Gomez et al., 2005), elevated mutation rates (Chen et al., 1998), and chromosomal instability (Eden et al., 2003) have all been associated with hypomethylated DNA. Methyl deficiency in rats induced irreversible global DNA hypomethylation in rat liver which supported a role for loss of methylation during the cancer initiation and or promotion stages of hepatocarcinogenesis (Progribny et al., 2005). These studies emphasize and support our view that DNA hypomethylation is a mechanism involved in tumor promotion (Counts and Goodman, 1995) and the data presented in the current article support the hypothesis that DEA, CD and PB treatment act by this mechanism to produce mouse liver tumors.
Altered methylation status of cytosines within the CpG dinucleotide is most commonly investigated; however, methylation of CpNpG and non-CpG sites also exists. In particular, the role of altered methylation at CpCpG sites has not been thoroughly investigated. There are three possible states of methylation of the CpCpG sites analyzed. These include (1) mCpCpG, methylation of the external cytosine, (2) CpmCpG, methylation of the internal cytosine, and (3) mCpmCpG, methylation of both the internal and external cytosine. Our results show that loss of methylation status at both mCpG and mCpCpG sites occurs with approximately equal frequency suggesting that factors affecting the methylation status of mCpG sites also act on mCpCpG sites. Studies evaluating non-CpG methylation have mainly focused on CpA, CpT, and CpC methylation. However, one particular study proposed a biological role for methylation of both cytosines within CpCpG sites. Methylation of both cytosines within CpCpG sites has been reported to prevent binding of Sp1, an important transcription factor, to its target cis element thereby contributing to abnormal regulation of gene expression (Clark et al., 1997; Inoue and Oishi, 2005). Effects due to methylation of only the external cytosine were not reported. This stresses the importance of a broad and critical analysis of both CpG and non-CpG methylation during the promotion stage of tumorigenesis.
We have demonstrated remarkable similarities between the DEA, CD, and PB treatment related disruption of methylation patterns in B6C3F1 mouse hepatocytes grown in vitro during a short 48 h exposure. This indicates that a common mechanism is shared by all three treatments. The extreme similarity between patterns of altered methylation in GC-rich regions due to DEA and CD supports the notion that DEA indirectly depletes the pool of methyl groups needed for methylation of cytosine by inhibiting choline uptake into cells (Lehman-McKeeman and Gamsky, 1999). The resulting hypomethylation mimics that of dietary CD. Dietary PB has been shown to cause global hypomethylation (Counts et al., 1996), and hypermethylation, along with some decreased methylation, in GC-rich regions of DNA (Watson and Goodman, 2002) in the livers of B6C3F1 mice after 2 and 4 weeks of administration. Therefore, continued exposure to the promoting stimuli may lead to progressive changes in methylation including hypomethylations, hypermethylations (treatment-related increases in methylation in RAMs that were methylated in control), and new methylations (treatment-related methylation of RAMs that were not methylated in control), which accrue in a stepwise manner to contribute to tumorigenesis. This is consistent with the view that a variety of alterations in methylation contribute to carcinogenesis (Counts and Goodman, 1995), and that there are progressive alterations of methylation during the transformation process (Watson et al., 2003). Hence, altered methylation, initially hypomethylation, is a likely epigenetic, non-genotoxic mode of action underlying the abilities of DEA, PB, and CD to promote the development of mouse liver tumors.
|
SUPPLEMENTARY DATA |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSUPPLEMENTARY DATAREFERENCES |
|---|
Supplementary data are available online at http://toxsci.oxfordjournals.org/. Supplementary Data contains a detailed description of the materials and methods for the arbitrarily primed PCR and capillary electrophoretic approach employed assessing methylation status in GC-rich regions throughout the genome. In addition, data organization and analysis, including statistical calculations performed using the Excel program, are explained in detail.
|
ACKNOWLEDGMENTS |
|---|
A.N.B. was a predoctoral fellow supported by NIH-NIEHS Training Grant No. T32-ES-07255. Research support form the American Chemistry Council is acknowledged gratefully.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSUPPLEMENTARY DATAREFERENCES |
|---|
Albright, C. D., Liu, R., Bethea, T. C., Da Costa, K. A., Salganik, R. I., and Zeisel, S. H. (1996). Choline deficiency induces apoptosis in SV40-immortalized CWSV-1 rat hepatocytes in culture. J. FASEB 10, 510–516.[Abstract]
Balaghi, M., and Wagner, C. (1993). DNA methylation in folate deficiency: Use of CpG methylase. Biochem. Biophys. Res. Commun. 193, 1184–1190.[CrossRef][Web of Science][Medline]
Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes Dev. 16, 6–21.
Chen, R. Z., Pettersson, U., Beard, C., Jackson-Grusby, L., and Jaenisch, R. (1998). DNA hypomethylation leads to elevated mutation rates. Nature 395, 89–93.[CrossRef][Medline]
Clark, S. J., Harrison, J., and Molloy, P. L. (1997). Sp1 binding is inhibited by (m)Cp(m)CpG methylation. Gene 195, 67–71.[CrossRef][Web of Science][Medline]
Cottrell, S. E., and Laird, P. W. (2003). Sensitive detection of DNA methylation. Ann. N.Y. Acad. Sci. 983, 120–130.[CrossRef][Web of Science][Medline]
Counts, J. L., and Goodman, J. I. (2004). Hypomethylation of DNA: An epigenetic mechanism involved in tumor promotion. Mol. Carcinogen. 11, 185–188.
Counts, J. L., and Goodman, J. I. (1995). Alterations in DNA methylation may play a variety of roles in carcinogenesis. Cell 83, 13–15.[CrossRef][Web of Science][Medline]
Counts, J. L., Sarmiento, J. I., Harbison, M. L., Downing, J. C., McClain, R. M., and Goodman, J. I. (1996). Cell proliferation and global methylation status changes in mouse liver after phenobarbital and/or choline-devoid, methionine-deficient diet administration. Carcinogenesis 17, 1251–1257.
Detich, N., Hamm, S., Just, G., Knowx, J. D., and Szyf, M. (2003). The methyl donor S-adenosylmethionine inhibits active demethylation of DNA. J. Biol. Chem. 278, 20812–20820.
Eden, A., Gaudet, F., Waghmare, A., and Jaenisch, R. (2003). Chromosomal instability and tumors promoted by DNA hypomethylation. Science 300, 455.
Feinberg, A. P. (2001). Cancer epigenetics takes center stage. Proc. Natl. Acad. Sci. U.S.A. 98, 392–394.
Galm, O., Rountree, M. R., Bachman, K. E., Jair, K. W., Baylin, S. B. and Herman, J. G. (2002). Enzymatic regional methylation assay: A novel method to quantify regional CpG methylation density. Genome Res. 12, 153–157.
Gardiner-Garden, M., and Frommer, M. (1987). CpG islands in vertebrate genomes. J. Mol. Bio. 196, 261–282.[CrossRef][Web of Science][Medline]
Gonzalgo, M. L., Liang, G., Spruck, C. H. III, Zingg, J.-M., Rideout, W. M. III, and Jones, P. A. (1997). Identification and characterization of differentially methylated regions of genomic DNA by methylation-sensitive arbitrarily primed PCR. Cancer Res. 57, 594–599.
Goodman, J. I., and Watson, R. E. (2002). Altered DNA methylation: A secondary mechanism involved in carcinogenesis. Annu. Rev. Pharmacol. Toxicol. 42, 501–525.[CrossRef][Web of Science][Medline]
Henning, S. M., and Swendseid, M. E. (1996). The role of folate, choline, and methionine in carcinogenesis induced by methyl-deficient diets. Adv. Exp. Med. Biol. 399, 143–155.[Medline]
Hermann, A., Gowher, H., and Jeltsch, A. (2004). Biochemistry and biology of mammalian DNA methyltransferases. Cell Mol. Life Sci. 61, 2571–2587.[CrossRef][Web of Science][Medline]
Inoue, S., and Oishi, M. (2005). Effects of methylation of non-CpG sequence in the promoter region on the expression of human synaptotagmin XI (syt11). Gene 348, 123–134.[CrossRef][Web of Science][Medline]
James, N. H., and Roberts, R. A. (1996). Species differences in response to peroxisome proliferators correlate in vitro with induction of DNA synthesis rather than suppression of apoptosis. Carcinogenesis 17, 1623–1632.
Jones, P. A., and Baylin, S. B. (2002). The fundamental role of epigenetic events in cancer. Nature Rev. Genet. 3, 415–428.[Web of Science][Medline]
Jones, P. A., and Laird, P. W. (1999). Cancer epigenetics comes of age Nature Genet. 21, 163–167.[CrossRef][Web of Science][Medline]
Kamendulis, L. M., and Klaunig, J. E. (2005). Species differences in the induction of hepatocellular DNA synthesis by diethanolamine. Toxicol. Sci. 87, 328–336.
Klaunig, J. E. (1993). Selective induction of DNA synthesis in mouse preneoplastic and neoplastic hepatic lesions after exposure to phenobarbital. Environ. Health Persp. 101(Suppl. 5), 235–239.[CrossRef][Web of Science][Medline]
Klaunig, J. E., Goldblatt, P. J., Hinton, D. E., Lipsky, M. M., Chacko, J., and Trump, B. F. (1981). Mouse liver cell culture. I. Hepatocyte isolation. In Vitro 17, 913–925.[Web of Science][Medline]
Knaak, J. B., Leung, H.-W., Stott, W. T., Busch, J., and Biski, J. (1997). Toxicology of mono- di- and triethanolamine. Rev. Environ. Contam. Toxicol. 146, 1–86.
Lehman-McKeeman, L. D., and Gamsky, E. A. (1999). Diethanolamine inhibits choline uptake and phosphatidylcholine synthesis in Chinese Hamster Ovary cells. Biochem. Biophys. Res. Commun. 262, 600–604.[CrossRef][Web of Science][Medline]
Lehman-McKeeman, L. D., Gamsky, E. A., Hicks, S. M., Vassallo, J. D., Mar, M.-H., and Zeisel, S. H. (2002). Diethanolamine induces hepatic choline deficiency in mice. Toxicol. Sci. 67, 38–45.
National Toxicology Program (1999). Toxicology and carcinogenesis studies of diethanolamine in F344/N and B6C3F1 mice (Dermal Studies). NTP TR 478. U.S. Department of Health and Human Services, National Institutes of Health.
Newberne, P. M., deCamagro, J. L. V., and Clark, A. J. (1982). Choline deficiency, partial hepatectomy, and liver tumors in rats and mice. Toxicol. Path. 10, 95–106.
Newberne, P. M., and Rodgers, A. E. (1986). Labile methyl groups and the promotion of cancer. Annu. Rev. Nutr. 6, 407–432.[CrossRef][Web of Science][Medline]
Niculescu, M. D., Yamamuro, Y., and Zeisel, S. H. (2004). Choline availability modulates human neuroblastoma cell proliferation and alters the methylation of the promoter region of the cyclin-dependent kinase inhibitor 3 gene. J. Neurochem. 89, 1252–1259.[CrossRef][Web of Science][Medline]
Pogribny, I. P., Ross, S. A., Wise, C., Pogribna, M., Jones, E. A., Tryndyak, V. P., James, S. J., Dragan, Y. P., Poirier, L. A. (2005). Irreversible global DNA hypomethylation as a key step in hepatocarcinogenesis induced by dietary methyl deficiency. Mutat. Res. Sept 3. E-pub ahead of print.
Poirier, L. A. (1994). Methyl group deficiency in hepatocarcinogenesis. Drug Metab. Rev. 26, 185–199.[Web of Science][Medline]
Roman-Gomez, J., Jimenez-Velasco, A., Agirre, X., Cervantes, F., Sanchez, J., Garate, L., Barrios, M., Castillejo, J. A., Navarro, G., Colomer, D., et al. (2005). Promoter hypomethylation of the LINE-1 retrotransposable elements activates sense/antisense transcription and marks the progression of chronic myeloid leukemia. Oncogene Sept 17. E-pub ahead of print.
Shivapurkar, N., and Poirier, L. A. (1983). Tissue levels of S-adenosylmethionine and S-adenosylhomocysteine in rats fed methyl-deficient, amino acid-defined diets for one to five weeks. Carcinogenesis 4, 1051–1057.
Tao, L., Yang, S., Xie, M., Kramer, P. M., and Pereira, M. A. (2000). Hypomethylation and overexpression of c-jun and c-myc protoncogenes and increased DNA methyltransferase activity in dichloroacetic and trichloroacetic acid-promoted mouse liver tumors. Cancer Lett. 158, 185–193.[CrossRef][Web of Science][Medline]
Watson, R. E., and Goodman, J. I. (2002). Effects of phenobarbital on DNA methylation in GC-rich regions of hepatic DNA from mice that exhibit different levels of susceptibility to liver tumorigenesis. Toxicol. Sci. 68, 51–58.
Watson, R. E., Curtin, G. M., Doolittle, D. J., and Goodman, J. I. (2003). Progressive alterations in global and GC-rich DNA methylation during tumorigenesis. Toxicol. Sci. 75, 289–299.
Whysner, J., Ross, P. M., and Williams, G. M. (1996). Phenobarbital mechanistic data and risk assessment: Enzyme induction, enhanced cell proliferation, and tumor promotion. Pharmacol Ther. 71, 153–191.[CrossRef][Web of Science][Medline]
Xiong, Z., and Laird, P. W. (1997). COBRA: A sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 25, 2532–2534.
Yamamoto, F., and Yamamoto, M. (2004). A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses. Mol. Gen. Genomics 271, 678–686.[Web of Science][Medline]
Ziesel, S. H. (1996). Choline: A nutrient that is involved in the regulation of cell proliferation, cell death and transformation. Adv. Exp. Med. Biol. 399, 131–141.[Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  D. Desaulniers, G.-h. Xiao, H. Lian, Y.-L. Feng, J. Zhu, J. Nakai, and W. J. Bowers Effects of Mixtures of Polychlorinated Biphenyls, Methylmercury, and Organochlorine Pesticides on Hepatic DNA Methylation in Prepubertal Female Sprague-Dawley Rats International Journal of Toxicology, July 1, 2009; 28(4): 294 - 307. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Phillips and J. I. Goodman Multiple Genes Exhibit Phenobarbital-Induced Constitutive Active/Androstane Receptor-Mediated DNA Methylation Changes during Liver Tumorigenesis and in Liver Tumors Toxicol. Sci., April 1, 2009; 108(2): 273 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Phillips and J. I. Goodman Identification of Genes that May Play Critical Roles in Phenobarbital (PB)-Induced Liver Tumorigenesis due to Altered DNA Methylation Toxicol. Sci., July 1, 2008; 104(1): 86 - 99. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Niculescu, R. Wu, Z. Guo, K. A. da Costa, and S. H. Zeisel Diethanolamine Alters Proliferation and Choline Metabolism in Mouse Neural Precursor Cells Toxicol. Sci., April 1, 2007; 96(2): 321 - 326. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. N. Bachman, J. M. Phillips, and J. I. Goodman Phenobarbital Induces Progressive Patterns of GC-Rich and Gene-Specific Altered DNA Methylation in the Liver of Tumor-Prone B6C3F1 Mice Toxicol. Sci., June 1, 2006; 91(2): 393 - 405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. N. Bachman, G. M. Curtin, D. J. Doolittle, and J. I. Goodman Altered Methylation in Gene-Specific and GC-Rich Regions of DNA Is Progressive and Nonrandom during Promotion of Skin Tumorigenesis Toxicol. Sci., June 1, 2006; 91(2): 406 - 418. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||