ToxSci Advance Access originally published online on December 30, 2005
Toxicological Sciences 2006 90(2):369-376; doi:10.1093/toxsci/kfj089
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The Unique N-Terminal Sequence of Metallothionein-3 Is Required to Regulate the Choice between Apoptotic or Necrotic Cell Death of Human Proximal Tubule Cells Exposed to Cd+2
Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, 501 N. Columbia Road, Grand Forks, North Dakota 58202
1 To whom correspondence should be addressed. Fax: (701) 777-3108. E-mail: dsens{at}medicine.nodak.edu.
Received November 2, 2005; accepted December 27, 2005
| ABSTRACT |
|---|
|
|
|---|
This laboratory has shown that MT-3 expression determines the choice between apoptotic or necrotic cell death in Cd+2-exposed human proximal tubule cells. Human proximal tubule cells that express MT-3 undergo necrosis when exposed to Cd+2, while cells that have no basal expression of MT-3 undergo apoptotic cell death. It was also shown that cells which express MT-3 were more sensitive to Cd+2-induced cell death than those having no basal expression. In the present study, site directed mutagenesis was used to determine if the unique N-terminal sequence of MT-3 was required for these activities regarding toxicity and cell death. The results demonstrated that HK-2 cells stably transfected with MT-3 that had been modified by converting the 2 prolines at amino acid positions 7 and 9 to threonines was no longer active in promoting necrotic cell death at lower levels of Cd+2 exposure. This was shown in comparison to cells containing the wild type MT-3 sequence and blank vector controls as regards the % of DAPI-stained fragmented nuclei, DNA laddering, LDH release, caspase-9, and caspase-3 activation. This study demonstrates that the unique N-terminal sequence of MT-3 is required to elicit an effect on the mechanism of Cd+2-induced death of the proximal tubule cell. This is the identical sequence that has been shown to be responsible for the growth inhibitory activity of MT-3 in the neural system.
Key Words: cadmium; proximal tubule; nephrotoxicity; metallothionein; apoptosis; necrosis.
| INTRODUCTION |
|---|
|
|
|---|
This laboratory has shown that the third isoform of the metallothionein gene family (MT-3) is expressed in the human kidney in situ, including the cells of the proximal tubule (Garrett et al., 1999
The MT-3 isoform was initially thought to be a brain-specific MT family member and its isolation is relatively recent compared to the ubiquitously expressed MT-1 and MT-2 family members (Palmiter et al., 1992
). The MT-3 protein was originally named growth inhibitory factor (GIF), but was subsequently renamed MT-3 when it was shown to possess all the characteristic features of the traditional MTs, including transition metal binding (Tsuji et al., 1992
; Uchida et al., 1991
). Structurally, the MT-3 isoform possesses 7 additional amino acids that are not present in any other member of the MT gene family, a 6 amino acid C-terminal sequence and a Thr in the N-terminal region (Palmiter et al., 1992
; Tsuji et al., 1992
; Uchida et al., 1991
). Functionally, MT-3 has been shown to possess a neuronal cell growth inhibitory activity which is not duplicated by the other human MT classes (Amoureux et al., 1995
; Uchida et al., 1991
). This non-duplication of function occurs despite a 6369% homology in amino acid sequence among MT-3 and the other human MT isoforms (Sewell et al., 1995
). The neuronal growth inhibitory activity of MT-3 has been shown to require the unique N-terminal Thr sequence and not the unique 6 amino acid C-terminal sequence (Sewell et al., 1995
). A major goal of the present study was to determine if the ability of MT-3 to influence the mechanism of cell death in Cd+2-exposed human proximal tubule cells required the unique N-terminal sequence of the MT-3 protein. A second goal was to confirm that the expression of MT-3 promotes a necrotic mechanism of cell death in mortal cultures of human proximal tubule cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and stable transfection of the wild-type and mutated MT-3 coding sequences under the control of the CMV promoter.
Stock cultures of HPT and HK-2 cells for use in experimental protocols were grown using serum-free conditions as previously described by this laboratory (Detrisac et al., 1984
The procedure for the stable transfection of the HK-2 cells with the MT-3 coding sequence has been detailed previously (Kim et al., 2002
; Somji et al., 2004
). An identical procedure was also used for the stable transfection of HK-2 cells with a modified MT-3 construct devoid of neuronal growth inhibitory activity (Garrett et al., 2005
). In this construct, the coding sequence of the MT-3 gene was modified by converting the 2 prolines at amino acid positions 7 and 9 to threonines. This was based on the findings by Sewell and coworkers (1995)
which showed that converting the prolines at position 7 and 9 to threonines rendered MT-3 inactive in neuronal survival assays. Briefly, the existing wild type MT-3 coding sequence previously cloned from human proximal tubule cells into the pcDNA3.1/Hygro (+) vector was subcloned into the BamH1/Xba1 site of pAlter-1, a vector which allows for the selection of mutated plasmids. Mutagenesis was performed utilizing the MT-3 mutagenesis oligo:GGAGCCACCAGAAGTGCAGGTGCAGGTCTCA (bold bases designate G to T substitutions). Clones were isolated and verified by sequencing. The mutated MT-3 coding sequence was then subcloned back into pcDNA3.1/Hygro (+) and stably transfected into HK-2 cells as described above for the wild type coding sequence.
siRNA mediated gene silencing.
The siRNA sequences for MT-3 were custom designed by Qiagen (Valencia, CA) and consisted of sense: r(CUU GGA GGA AUG ACA AUA A)dTdT and antisense: r(UUA UUG UCA UUC CUC CAA G)dGdT. These sequences target resides far down the 3 prime untranslated region of the MT-3 mRNA. The sequences for Lamin A/C was also provided by Qiagen and was used as a positive control for the gene silencing technique and as a negative control for MT-3 gene silencing; the sequences were: r(CUG GAC UUC CAG AAG AAC A)dTdT, antisense: r(UGU UCU UCU GGA AGU CCA G)dTdT. Each set of RNAs was resuspended in siRNA suspension buffer (Qiagen) to give a final concentration of 20 µM, mixed with its hybridization pair and annealed by heating at 90°C for 1 min followed by 37°C for 60 min. The siRNAs were transfected into human proximal tubule cells using the Amaxa Nucleofector apparatus with the Basic Nucleofection Kit for Primary Mammalian Epithelial cells (Amaxa, Cologne, Germany). Briefly, confluent cultures of human proximal tubule (HPT) cells were trypsinized, resuspended in PBS containing 5% FBS, and centrifuged to pellet the cells. The pellet was resuspended in suspension medium supplied with the kit to a concentration of 1 x 107 cells per ml. For transfection, 0.1 ml of cell suspension (1 x 106 cells) was placed in the electroporation cuvette along with 3 µg of siRNA and electroporated on the instrument setting of T-13. Previous preliminary experiments indicated that this setting gave optimal transfection efficiency (3050%) based on the fluorescence of fluorescein-labeled RNA or green fluorescent protein transiently expressed from 3 µg of pmaxGFP plasmid DNA. Immediately after the electric pulse, the cells were transferred to a microfuge tube containing 0.5 ml of keratinocyte serum free medium (Invitrogen, Carlsbad, CA) supplemented with EGF (10 ng/ml), hydrocortisone (36 ng/ml), and insulin (5 µg/ ml) that had been preincubated at 37°C and 95% air:5% CO2. After 10 min incubation, the cells were transferred to one well of a 12-well plate containing 1.5 ml of standard HPT growth medium (described above under cell culture). After 24 h, the medium was changed and the cells were allowed to grow back to confluency in the next 7 days with medium changes every three days. The expression of MT-3 was determined on lysates prepared from newly confluent cultures. To determine the effects of MT-3 expression on cell death, newly confluent cultures were exposed to Cd+2 for 48 h and DAPI staining used to quantify apoptotic nuclei.
Real time PCR of MT-3 mRNA.
The method for the preparation of total RNA has been described previously (Garrett et al., 1998
). RT-PCR was performed with the iScript one-step RT-PCR kit with SYBR Green utilizing the iCycler iQ real-time detection system (Bio-Rad Laboratories, Hercules, CA). Amplification was monitored by SYBR Green fluorescence and compared to that of a standard curve of the MT-3 gene cloned into pcDNA3.1/hygro (+) and linearized with Fsp I. The reactions were assembled according to the kit instructions in a total volume of 20 µl with 40 ng of total RNA and 0.2 µM primers. Primer sequences for MT-3 consisted of sense: ACATGGACCCTGAGACCT and antisense: TTGGCACACTTCTCACACT resulting in a product size of 142 bps. Reverse transcription was carried out at 50°C for 10 min, denaturation of the RT enzyme at 95°C for 5 min, and PCR cycling immediately following with denaturation at 95°C for 30 s and annealing at 62°C for 45 s. The level of MT-3 expression was normalized to that of glyceraldehyde-3-phosphate dehydrogenase assessed by the same assay with the primer sequences being sense: TCCTCTGACTTCAACAGCGACAC and antisense: CACCCTGTTGCTGTAGCCAAATTC with a product size of 126 base pairs. The reaction conditions were the same as above except the annealing temperature was 65°C.
Visualization of DAPI-stained cells.
The effect of metal treatment on cell viability and the number of fragmented (apoptotic) nuclei was determined by the visualization and counting of 4',6-diamidino-2-phenylindole (DAPI)-stained nuclei as described previously by this laboratory (Garrett et al., 1998
; Somji et al., 2004
). At the indicated time points, wells containing the monolayers were rinsed with phosphate-buffered saline (PBS), fixed for 15 min in 70% ethanol, rehydrated with 1 ml PBS, and stained with 10 µl DAPI (10 µg/ml in distilled water). For each time point, a minimum of 20 fields per well and 3 wells per data point were examined. The nuclear counts as well as the number of fragmented nuclei were determined for each field. The percentage of fragmented nuclei were determined for each well and the results presented as the mean ± SEM for the triplicate wells.
DNA laddering and LDH release.
DNA laddering was used to confirm the correlation of apoptosis with the presence of fragmented nuclei observed using DAPI staining (Somji et al., 2004
). Briefly, at each time point, adherent and detached cells were collected and combined from each well, centrifuged, and the pellet resuspended in lysis buffer. The cell lysate was centrifuged and the supernatant was incubated with 200 µg/ml proteinase K for 1 h at 50°C. The DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1 v/v/v) and precipitated overnight with absolute ethanol in the presence of 20 µg glycogen. The DNA pellet was washed twice with 70% alcohol, air dried, and dissolved in Tris-EDTA buffer. After treatment with ribonuclease A for 1 h at 50°C, the DNA was loaded onto a 2% (w/v) agarose gel containing ethidium bromide.
LDH release was used to confirm the correlation of an absence of fragmented nuclei on DAPI-stained cells with a necrotic mechanism of cell death. The release of LDH from cells was determined by the Cyto Tox 967 assay kit (Promega) as described previously (Somji et al., 2004
). Briefly, 50 µl of the cell culture supernatant was transferred to a 96 well enzymatic assay plate. Reconstituted substrate mix (50 µl) was added to each sample and the enzymatic reaction was allowed to proceed for 30 min at room temperature in the dark. The assay was stopped by adding 50 µl of the stop solution (1M acetic acid) and the plate was read at 490 nm using an ELISA plate reader.
Determination of caspase-3 and caspase-9 activation.
Cells were rinsed with phosphate buffered saline and harvested in CHAPS cell extract buffer (50 mM PIPES/NaOH, pH 6.5, 2 mM EDTA, 0.1% CHAPS, 5 mM DTT, 20 µg/ml Leupeptin, 10 µg/ml pepstatin, 10 µg/ml aprotinin, and 1 mM PMSF) (Cell Signaling Technology). The harvested cells were freeze thawed three times followed by centrifugation at 14,000 rpm. The pelleted debris was discarded and the supernatant was used for analysis. The concentration of protein in the samples was determined by the BCA protein assay (Pierce Chemical Co.). Ten micrograms of total cellular protein was separated on 12% SDS-containing polyacrylamide gel and electrophoretically transferred to a hybond-P polyvinylidine difluoride membrane (Amersham Biosciences). Membranes were blocked in Tris buffered saline containing 0.1% Tween-20 (TBS-T) and 5% (w/v) non-fat dry milk for 1 h at room temperature. After blocking, the membranes were probed with the appropriate primary antibody (Caspase-3 and Caspase 9, Cell Signaling Technology; Actin, Stressgen) overnight at 4°C in antibody dilution buffer (TBS-T containing 5% non-fat dry milk). Following three washes, the membrane was incubated with the secondary antibody for 1 h at room temperature. The blots were visualized using the Phototope-HRP Western blot detection system (Cell Signaling).
Statistical analysis.
All experiments were performed in triplicate and the results are expressed as the standard error of the mean. Statistical analyses were performed using Systat7 software using separate variance t-tests, ANOVA with Tukey post-hoc testing. Unless otherwise stated, the level of significance was 0.05.
| RESULTS |
|---|
|
|
|---|
Increased Sensitivity of MT-3 Transfected Proximal Tubule Cells to Cd+2-induced Cell Death Is Related to the Neuronal Growth Inhibitory Activity of MT-3
This laboratory has shown that human proximal tubule cells stably transfected to express MT-3 are more susceptible to Cd+2-induced cell death than wild type parental cells or those transfected with a blank vector control (Somji et al., 2004
|
The Mechanism of Cd+2-induced Cell Death in Proximal Tubule Cells Is Regulated by the Unique N-Terminal Threonine Sequence of MT-3
This laboratory also demonstrated that the increase in Cd+2-induced toxicity for MT-3 transfected cells was correlated to an alteration in the mechanism of cell death, being changed from an apoptotic mechanism in cells not expressing the MT-3 gene to a necrotic mechanism in cells expressing the MT-3 gene (Somji et al., 2004
The three sets of cells were exposed to 18 µM Cd+2 for 12 h and the number of apoptotic nuclei determined by DAPI staining. The pattern of DAPI staining disclosed that the HK-2 cell line transfected with the blank vector control and the HK-2 cell line transfected with the mutant MT-3 sequence had frequent profiles of fragmented nuclei (Figs. 2A and 2B). In contrast, the HK-2 cell line stably transfected with the wild type MT-3 coding sequence showed only rare profiles of fragmented nuclei (Fig. 2C). Point counting of 27 fields of each group demonstrated that the HK-2 cell line transfected with the blank vector control had 4.2 ± 0.4% apoptotic nuclei, the HK-2 cell line transfected with wild type MT-3, 1.2 ± 0.2% apoptotic nuclei, and the HK-2 cell line transfected with the mutant MT-3 sequence, 4.5 ± 0.4% apoptotic nuclei (p < 0.05 for blank vector control or mutant MT-3 compared to wild type MT-3). The laboratory has shown previously the HK-2 cells transfected with the blank vector control yields a DNA ladder when exposed to Cd+2, while HK-2 cells transfected with wild type MT-3 show no evidence of a DNA ladder (Somji et al., 2004
). In the present study, when the HK-2 cell line transfected with the mutant MT-3 sequence was exposed to either 9 or 13.5 µM Cd+2 over a 60 h time course there was clear evidence of DNA laddering (Fig. 3). The laddering was most prominent following 36 h of exposure to Cd+2. Caspase-3 and caspase-9 activation was also determined for each cell line when exposed to 13.5 µM Cd+2 over a 24 h time course. The results demonstrated that there was an activation of both caspase-9 and caspase-3 by the HK-2 cells carrying the blank vector control or the mutant MT-3 sequence (Figs. 4A and 4B). In contrast, there was no activation of either caspase-3 or 9 by the HK-2 cells stably transfected with the wild type MT-3 coding sequence (Fig. 4C). The release of LDH into the growth medium was also determined for each of the 3 cell lines when exposed to 18 µM Cd+2 over a 48 h time course (Fig. 5). It was demonstrated that HK-2 cells transfected with the wild type MT-3 sequence had a high level of LDH release while HK-2 cells carrying a blank vector control or the mutated MT-3 sequence had a significantly lower level of LDH release. Taken together, these results show that the unique N-terminal threonine sequence of the MT-3 protein mediates the choice between apoptotic and necrotic cell death of human proximal tubule cells exposed to Cd+2.
|
|
|
|
Human Proximal Tubule Cells with Basal Expression of MT-3 Undergo a Necrotic Mechanism of Cd+2-induced Cell Death
The laboratory's early examinations of Cd+2-induced toxicity in mortal cultures of human proximal tubule (HPT) cells were consistent with the cells undergoing a necrotic mechanism of cell death (Hazen-Martin et al., 1989a
|
| DISCUSSION |
|---|
|
|
|---|
This laboratory has demonstrated that MT-3 expression determines the choice between apoptotic or necrotic cell death in Cd+2-exposed human proximal tubule cells (Somji et al., 2004
Three biological functions have now been reported for the unique N-terminal sequence of MT-3. These include the initial observation of the growth inhibitory activity of MT-3 in the neural system (Sewell et al., 1995
; Uchida et al., 1991
), the recent report of a role in regulating the post-transcriptional expression of basal levels of MT-3 in the human bladder urothelium (Garrett et al., 2005
), and the present report describing a role in regulation of the mechanism of toxicant-induced cell death. Although the mechanism(s) underlying these actions are unknown, there is recent evidence that MT-3 can form complexes with other proteins. The identification of such interactions in various cell types could be an important first step in defining how MT-3 might exert its biological actions. Using an immunological and mass spectrometry approach, five proteins present in a mouse brain extract have been shown to associate with MT-3 (Lahti et al., 2005
). These 5 proteins were heat shock protein 84 (mouse variant of hsp 90), heat shock protein 70, dihydropurimidinase-like protein 2, creatine kinase, and ß-actin. The initial screen identifying these 5 proteins involved the passing of a mouse brain extract over a column containing immobilized anti-mouse MT-3 antibody, subsequent elution, polyacrylamide gel electrophoretic separation and identification by mass spectrometric analysis. Also, independently using antibodies against MT-3, creatine kinase and hsp 84 showed that all three proteins were coimmunoprecipitated from whole mouse brain homogenates with each of the three antibodies. Furthermore, mixing purified samples of MT-3 and creatine kinase also generated a complex that could be immunoprecipitated by anti-MT3 or anti-creatine kinase antibody. This study provides the first evidence that MT-3 can associate in an in situ cellular macromolecular complex.
A second protein-protein interaction for MT-3 has been indirectly identified based on its colocalization with Rab3A in hippocampal neurons and its past implication in a yeast two hybrid system (Kang et al., 2001
; Lee et al., 2003
). In this study, the in vitro interaction of MT-3 and Rab3A was studied using a combination of affinity purification and surface plasmon resonance analysis (Knipp et al., 2005
). In this study it was shown that Zn7MT-3 binds reversibly to Rab3AGDP, but not to Rab3AGTP. The binding was specific as no binding was observed with the metal-free form of MT-3. Mutational studies of Rab3A mapped the interaction site to the effector binding site of the protein. These studies were consistent with a role for this interaction in synaptic vesicle trafficking upstream of vesicle fusion. The above two findings that show MT-3 can participate in macromolecular complexes are in contrast to the MT-1 and MT-2 isoforms where such interactions have not been identified despite considerable effort.
The present study convincingly shows that the unique N-terminal sequence of MT-3 is required for its role in the regulation of cell death, but it provides no information on whether or not the unique C-terminal sequence is also required for this activity. As detailed in the introduction, the MT-3 isoform possesses 7 additional amino acids that are not present in any other member of the MT gene family, a 6 amino acid C-terminal sequence and a Thr in the N-terminal region. While the unique C-terminal sequence has not been shown to have biological function, it does alter the metal binding characteristics of MT-3 (Zhang et al., 2003
). Specifically, it was shown that the C-terminal hexapeptide insert renders the MT-3
-domain looser and lowers the stability of the metal-thiolate cluster. This alteration would render the metal binding site more accessible for exchange mechanisms with other partners (Zhang et al., 2003
). In contrast, the unique N-terminal region which does confer biological activity has been reported to give MT-3 unprecedented conformational flexibility and cluster dynamics that are recognized to be important for protein-protein interactions (Romero-Isart et al., 2002
). Thus, it is possible that the unique C-terminal region of MT-3 mediates Zn+2 exchange with other proteins while the unique N-terminal region mediates protein-protein interactions. This possibility is under investigation and, if true, would further strengthen the concept that MT-3 has very distinct functions not shared by the highly homologous and widely studied MT-1 and MT-2 isoforms. The N-terminal sequence has been shown to give MT-3 its unique property as a growth inhibitory molecule in neural cells, a feature not shared by any other MT isoform (Sewell et al., 1995
; Tsuji et al., 1992
; Uchida et al., 1991
). It is interesting to speculate what the consequence might be if MT-3 expression also conferred these features of apoptosis and necrosis to neural cells, such as those involved in Alzheimer's disease. The MT-3 protein was originally isolated from brain as a growth inhibitory factor (GIF) that was down-regulated in Alzheimer's patients (Tsuji et al., 1992
). Many reports indicate that MT-3 is down-regulated in tissue from Alzheimer's patients (Carrasco et al., 1999
; Naruse et al., 1994
; Yu et al., 2001
), although other studies have not confirmed this result (Amoureux et al., 1997
; Erickson et al., 1994
). The present study shows that MT-3 expression can be pro-necrotic and therefore pro-inflammatory, since upon necrotic cell death intracellular contents would be released into the local environment. Conversely, if MT-3 expression is absent, apoptosis is favored and there would be no inflammatory reaction since intracellular contents would be sequestered in apoptotic bodies and phagocytized by adjacent cells. Based on these findings, one could propose that cells from individuals with Alzheimer's disease that have higher basal levels of MT-3 due to heterogeneity of expression would respond to toxicant-induced cell loss at lower exposure levels through necrosis and subsequent inflammation. Individuals whose cells have lower basal levels of MT-3 would be more resistant to toxicant-induced cell death, and if by apoptosis, would have no local tissue reaction. If this were the case, neuronal cells with higher basal expression of MT-3 would be more susceptible to agent-induced cell death and die earlier in the disease than those having reduced basal expression of MT-3. In this situation MT-3 expression would be a prognostic marker for Alzheimer's disease with the overall reduction in MT-3 expression indicating disease progression and not association with only the presence of disease. Thus, differing stages of the patients might explain why some studies have shown reduced expression of MT-3 in Alzheimer's disease, while others have not confirmed these reductions.
| ACKNOWLEDGMENTS |
|---|
The project described was supported by grant number R01 ES11333 from the National Institutes of Environmental Health Sciences (NIEHS), NIH. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIEHS, NIH.
| REFERENCES |
|---|
|
|
|---|
Amoureux, M. C., Van Gool, D., Herrero, M. T., Dom, R., Colpaert, F. C., and Pauwels, P. J. (1997). Regulation of metallothionein-III (GIF) mRNA in the brain of patients with Alzheimer's disease is not impaired. Mol. Chem. Neuropathol. 32, 101121.[Medline]
Amoureux, M. C., Wurch, T., and Pauwels, P. J. (1995). Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem. Biophys. Res. Comm. 214, 639645.[CrossRef][Web of Science][Medline]
Carrasco, J., Girault, M., Molinero, A., Penkowa, M., Moos, T., and Hidalgo, J. (1999). Metallothionein (MT)-III: Generation of polyclonal antibodies, comparison with MT-I + II in the freeze lesions rat brain and in a bioassay with astrocytes, and analysis of Alzheimer's disease brain. J. Neurotrauma 16, 11151129.[Web of Science][Medline]
Detrisac, C. J., Sens, M. A., Garvin, A. J., Spicer, S. S., and Sens, D. A. (1984). Tissue culture of human kidney epithelial cells of proximal tubule origin. Kidney Int. 25, 383390.[Web of Science][Medline]
Erickson, J. C., Sewell, A. K., Jensen, L. T., Winge, D. R., and Palmiter, R. D. (1994). Enhanced neurotropic activity in Alzheimer's disease cortex is not associated with down-regulation of metallothionein-III (GIF). Brain Res. 649, 297304.[CrossRef][Web of Science][Medline]
Garrett, S. H., Somji, S., Todd, J. H., and Sens, D. A. (1998). Exposure of human proximal tubule cells to Cd+2, Zn+2, and Cu+2 induces metallothionein protein accumulation, but not metallothionein isoform 2 mRNA. Environ. Health Perspect. 106, 587595.[Web of Science][Medline]
Garrett, S. H., Sens, M. A., Todd, J. H., Somji, S., and Sens, D. A. (1999). Expression of MT-3 protein in the human kidney. Toxicol. Lett. 105, 207214.[CrossRef][Web of Science][Medline]
Garrett, S. H., Park, S., Sens, M. A., Somji, S., Singh, R. K., Namburi, V. B. R. K., and Sens, D. A. (2005). Expression of metallothoinein isoform 3 is restricted at the post-transcriptional level in human bladder epithelial cells. Toxicol. Sci. 87, 6674.
Hazen-Martin, D. J., Sens, D. A., Blackburn, J. G., Flath, M. C., and Sens, M. A. (1989b). An electrophysiological and freeze fracture assessment of cadmium nephrotoxicity in vitro. In Vitro 25, 791799.
Hazen-Martin, D. J., Sens, D. A., Blackburn, J. G., and Sens, M. A. (1989a). Cadmium nephrotoxicity in human proximal tubule cell cultures. In Vitro 25, 784790.
Hazen-Martin, D. J., Todd, J. H., Sens, M. A., Khan, W., Bylander, J. E., Smyth, B. J., and Sens, D. A. (1993). Electrical and freeze-fracture analysis of the effects of ionic cadmium on the cell membrane of human proximal tubule cells. Environ. Health Perspect. 101, 510516.[Web of Science][Medline]
Kang, Q. H., Chen, Q. L., Ren, H. W., and Ru, B. G. (2001). Growth inhibitory factor (GIF) directly interacts with G-protein Rab3a. Prog. Biochem. Biophys. 28, 880884.
Kim, D., Garrett, S. H., Sens, M. A., Somji, S., and Sens, D. A. (2002). Metallothionein isoform 3 and proximal tubule vectorial active transport. Kidney Int. 61, 464472.[CrossRef][Web of Science][Medline]
Knipp, M., Meloni, G., Roschitzki, B., and Vasak, M. (2005). Zn7-metallothionein-3 and the synaptic vesicle cycle: Interaction of metallothionein-3 with the small GTPase Rab3A. Biochemistry 44, 31593165.[CrossRef][Medline]
Lahti, D. W., Hoekman, J. D., Tokheim, A. M., Martin, B. L., and Armitage, I. M. (2005). Identification of mouse brain proteins associated with isoform 3 of metallothionein. Protein Sci. 14, 11151157.[CrossRef][Web of Science][Medline]
Lee, J.-Y., Kim, J.-H., Palmiter, R. D., and Koh, J.-Y. (2003). Zinc released from metallothionein -III may contribute to hippocampal CA1 and thalmic neuronal death following acute brain injury. Exp. Neurol. 184, 337347.[CrossRef][Web of Science][Medline]
Naruse, S., Igarashi, S., Furuya, T., Kobayashi, H., Miyatake, T., and Tsuji, S. (1994). Structures of the human and mouse growth inhibitory factor-encoding genes. Gene 144, 283287.[CrossRef][Web of Science][Medline]
Palmiter, R. D., Findley, S. D., Whitmore, T. E., and Durnam, D. M. (1992). MT-III, a brain-specific member of the metallothionein gene family. Proc. Natl. Acad. Sci. U.S.A. 89, 63336337.
Romero-Isart, N., Jensen, L. T., Zerbe, O., Winge, D. R., and Vasak, M. (2002). Engineering of metallothionein-3 neuroinhibitory activity into the inactive isoform metallothionein-1. J. Biol. Chem. 277, 3702337028.
Ryan, M. J., Johnson, G., Kirk, J., Fuerstenberg, S. M., Zager, R. A., and Torok-Storb, B. (1994). HK-2: An immortalized proximal tubule epithelial cell line from normal adult human kidney. Kidney Int. 45, 4857.[Web of Science][Medline]
Sewell, A. K., Jensen, L. T., Erickson, J. C., Palmiter, R. D., and Winge, D. R. (1995). The bioactivity of metallothionein-3 correlates with its novel ß domain sequence rather than metal binding properties. Biochemistry 34, 47404747.[CrossRef][Medline]
Somji, S., Garrett, S. H., Sens, M. A., Gurel, V., and Sens, D. A. (2004). Expression of metallothionein isoform 3 (MT-3) determines the choice between apoptotic or necrotic cell death in Cd+2-exposed human proximal tubule cells. Toxicol. Sci. 80, 358366.
Tsuji, S., Kobayashi, H., Uchida, Y., Ihara, Y., and Miyatake, T. (1992). Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 11, 48434850.[Web of Science][Medline]
Uchida, Y., Takio, K., Titani, K., Ihara, Y., and Tomonaga, M. (1991). The growth inhibitory factor that is deficient in Alzheimer's disease is a 68 amino acid metallothionein-like protein. Neuron 7, 337347.[CrossRef][Web of Science][Medline]
Yu, W. H., Lukiw, W. J., Bergeron, C., Niznik, H. B., and Fraser, P. E. (2001). Metallothionein III is reduced in Alzheimer's disease. Brain Res. 894, 3745.[CrossRef][Web of Science][Medline]
Zhang, Q., Yang, W.-M., Yu, W.-H., Cai, B., Teng, X.-C., Xie, Y., Sun, H.-Z., Zhang, M.-J., and Huang, Z.-X. (2003). The effect of the EAAEAE insert on the property of human metallothionein-3. Protein Engineering 16, 865870.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. S. Bathula, S. H. Garrett, X. D. Zhou, M. A. Sens, D. A. Sens, and S. Somji Cadmium, Vectorial Active Transport, and MT-3-Dependent Regulation of Cadherin Expression in Human Proximal Tubular Cells Toxicol. Sci., April 1, 2008; 102(2): 310 - 318. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






