ToxSci Advance Access originally published online on February 22, 2006
Toxicological Sciences 2006 91(1):265-274; doi:10.1093/toxsci/kfj138
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Suppressive Effect of 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Vascular Remodeling That Takes Place in the Normal Labyrinth Zone of Rat Placenta during Late Gestation


,2
* Molecular and Cellular Toxicology Section, Environmental Health Sciences Division, National Institute for Environmental Studies, Onogawa, Tsukuba 305-8506, Japan;
Department of Hygiene-Chemistry, Faculty of Pharmaceutical Sciences, Tokyo University of Science, Yamazaki, Noda 278-8510, Japan; and
Division of Environmental Health Sciences, Center for Disease Biology and Integrative Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-0033, Japan
2 To whom correspondence should be addressed at Division of Environmental Health Sciences, Center for Disease Biology and Integrative Medicine, Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. Fax: +81-3-5841-1434. E-mail: ctohyama{at}m.u-tokyo.ac.jp.
Received December 9, 2005; accepted February 13, 2006
| ABSTRACT |
|---|
|
|
|---|
The maintenance of the placental vasculature is essential for sustaining normal fetal growth. On the basis of our previous observation that fetal death was accompanied by placental hypoxia upon exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (R. Ishimura et al., 2002a, Toxicol. Appl. Pharmacol. 185, 197206), we here investigated the effects of TCDD on the placenta, focusing on the development of the labyrinth zone. Holtzman rats were administered a single oral dose of 1.6 µg of TCDD/kg body weight or an equivalent volume of vehicle (control) on gestation day (GD) 15, and placental tissues were analyzed on GD20. Immunohistochemical staining showed that the exposure to TCDD decreased the size of maternal blood sinusoids and caused the constriction of fetal capillaries in the placenta. In contrast, we found that vascular remodeling occurred in the labyrinth zone of normal rat placenta; that is, the vascular development in the normal labyrinth zone during the late gestation (from GD16 to GD20) showed dilated maternal blood sinusoids and fetal capillaries accompanied by a decrease in thickness and the apoptosis of trophoblasts. The present results demonstrate that this remodeling is suppressed by TCDD, which is further supported by the decreased expression level of Tie2 mRNA, the gene which is associated with vascular remodeling, and also by the decrease in the number of apoptotic trophoblasts in TCDD-exposed rats. The present study provided a new finding on the development of the vasculature in the labyrinth zone during the late gestation under normal conditions and showed the inhibition of vascular remodeling in TCDD-exposed rats.
Key Words: apoptosis; placenta; rat; Tie2; TCDD; trophoblasts; vascular remodeling.
| INTRODUCTION |
|---|
|
|
|---|
The placenta plays an important role in the transport of oxygen and nutrients from the maternal blood circulation to the fetal blood circulation. An impairment of placental blood vessel formation during the early phase of gestation causes fetal death (Rossant and Cross, 2001
Vascular development in the fetus has been well documented. Fetal blood vessels are formed mainly by vasculogenesis and angiogenesis (Breier, 2000
; Hanahan, 1997
). In vasculogenesis, the proliferation of multipotential mesenchymal progenitor cells that assemble into tubes with tight connections between cells to accommodate blood leads to the formation of a primitive vascular network, in which the adhesion of endothelial cells and periendothelial support cells is at the immature stage. Angiogenesis is a part of the remodeling of an existing vascular network. During this remodeling, periendothelial support cells are recruited to encase endothelial tubes, providing maintenance and modulatory functions to blood vessels. The establishment and remodeling of blood vessels are controlled by paracrine signals (Breier, 2000
; Hanahan, 1997
). Vascular endothelial growth factor (VEGF) and its receptors, fetal liver kinase-1 (Flk1) and fms-like tyrosine kinase-1 (Flt1), are associated with vasculogenesis and named the VEGF/VEGFR system. Angiopoietin-1 (Ang1), Ang2, and their receptor Tie2 are involved in vascular remodeling that is named the Ang/Tie2 system. The involvement of Tie2 in vascular remodeling is supported by studies using Tie2 knockout mice, which showed the lack of intimate encapsulation of periendothelial support cells around vessels even though the vessels are normal in number (Dumont et al., 1994
; Hanahan, 1997
; Sato et al., 1995
).
The rodent placenta consists of two morphologically distinct zones, the junctional zone and labyrinth zone (Davies and Glasser, 1968
). The labyrinth zone, in which nutrients and oxygen are exchanged between maternal and fetal blood circulations, is mainly composed of endothelial cells of fetal capillaries and trophoblasts that are derived from the fetus. As the labyrinth zone is devoid of maternal endothelial cells, maternal blood has a direct contact with trophoblasts that form "maternal blood sinusoids" (Davies and Glasser, 1968
). Although an adequate orchestration of cell proliferation, differentiation, and apoptosis is considered to be essential for the normal development of vasculature in the labyrinth zone, it is largely unknown how vasculature in the labyrinth zone develops in the placenta, partly due to the complex anatomical structure of the labyrinth zone. Thus, in the present study, we first studied the development of vasculature in the normal labyrinth zone of the rat placenta for comparison in the assessment of the effects of environmental factors.
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), which is produced unintentionally as an unwanted contaminant during many kinds of industrial processes as well as uncontrolled combustion (Hutzinger et al., 1985
), is the most toxic congener among dioxins and related compounds present in the environment. The toxicity mechanism of dioxins is thought to depend on their binding and activation of arylhydrocarbon receptor (AhR), which modulates the expression of several hundred genes (Tijet et al., 2006
), followed by a wide spectrum of developmental adverse effects in laboratory animals and possibly in humans (Birnbaum, 1995
; Lindstrom et al., 1995
; Martinez et al., 2003
). Among the developmental adverse effects, intrauterine fetal death has been shown in various animal species, including monkey, hamster, rat, and mouse (Couture et al., 1990
; Guo et al., 1999
; McNulty, 1985
; Olson and McGarrigle, 1992
). However, the precise mechanism underlying fetal death caused by dioxins is largely unknown. Thus, we attempted to clarify this mechanism by studying the effects of TCDD on placental functions in a series of experiments. Pregnant Holtzman rats exposed to 1.6 µg of TCDD/kg body weight on gestation day (GD) 15 showed an increased percentage of fetal death (approximately 13% of fetuses) on GD20 (Ishimura et al., 2002b
), with alterations of glucose metabolism and placental morphology. Because the alteration of glucose metabolism in the placenta has been implicated in the hypoxic state caused by the decrease in uterine blood flow (Chartrel et al., 1990
; Eriksson and Jansson, 1984
; Gewolb et al., 1986
; Prager et al., 1974
), we examined this association in TCDD-exposed rats, compared the state between placentas of TCDD-exposed rats and uterine-arteryligated placentas, and found that the placentas of TCDD-exposed rats are in a hypoxic state (Ishimura et al., 2002a
). These studies suggested the possibility that placental blood flow decreases in the placentas of TCDD-exposed rats during the late gestation caused by histological alterations. Unexpectedly, little information has been documented on the development of vasculature in the placenta of the rat during the late gestation. Thus, there were two objectives of the present study. The first objective was to clarify the normal vasculature development in the labyrinth zone of nonTCDD-exposed rats during the late gestation, and the second objective was to compare observations with those of TCDD-exposed rats. We here show that vascular remodeling, characterized by the dilation of both maternal blood sinusoids and fetal capillaries, occurs in the labyrinth zone of the placenta of nonTCDD-exposed rats and that TCDD exposure specifically suppresses this vascular remodeling.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents.
TCDD (purity: >99.5%) was obtained from Cambridge Isotope Laboratory (Andover, MA). Nonane, corn oil, and 3,3'-diaminobenzidine tetrahydrochloride (DAB) were purchased from Sigma (St. Louis, MO). Trizol, SuperScript II Reverse Transcriptase, and the oligo(dT)1218 primer were from Life Technologies (Rockville, MD). TaKaRa Ex Taq polymerase was purchased from Takara Shuzo (Otsu, Japan). The primers for the semiquantitative RT-PCR were purchased from Hokkaido System Science Co. (Tsukuba, Japan). The pGEM-T Easy vector was obtained from Promega Corp. (Madison, WI). Unless otherwise indicated, all other chemicals and reagents were purchased from Wako Pure Chemical Industries (Osaka, Japan).
Animals.
Male and female Holtzman rats were purchased from Harlan Sprague-Dawley, Inc. (Indianapolis, IN). The animals were maintained in a controlled environment at a temperature of 24 ± 1°C, a humidity of 45 ± 5%, and a 12-h light/12-h dark cycle and given free access to a solid diet (certified diet MF: Oriental Yeast Co., Tokyo, Japan) and distilled water. Female rats were mated when they were 9 weeks old. Female rats in proestrus were allowed to mate 1:1 with males overnight, and the day that vaginal plugs were observed, usually the following morning, was designated as GD0. Pregnant rats were housed individually in clear plastic cages with heat-treated wood chips as bedding. All animal experiments were performed according to the guidelines for animal welfare at the National Institute for Environmental Studies (NIES).
TCDD treatment.
The pregnant rats were administered TCDD as described previously (Ishimura et al., 2002b
; Ohsako et al., 2001
). TCDD dissolved in nonane at a concentration of 20 µg/ml was further diluted with corn oil so that the intended dose of TCDD would be delivered in a final volume of 2.5 ml/kg body weight. The experiments, from TCDD administration to necropsy, were performed in the hazardous chemicalregulated area at NIES. On GD15 the pregnant rats were given a single oral dose of 1.6 µg of TCDD/kg body weight or an equivalent volume of 3.2% nonane in corn oil solution (control). The control group and the TCDD-exposed group consisted of five pregnant rats each. Dams were killed for sample collection on GD20 between 1:00 and 2:00 P.M. In this experimental protocol, approximately 13% of fetuses die on GD20 following TCDD exposure as reported previously (Ishimura et al., 2002b
). The placentas were removed from the uterus, immediately frozen in liquid nitrogen, and maintained at 80°C until analysis. Placental tissue for immunohistochemistry was fixed in Histochoice (Amresco, Solon, OH) and embedded in paraffin.
Preparation of horizontal sections and endothelial tissue staining.
Horizontal sections of the placenta were prepared and placed on silane-coated slides. The middle part of the placenta between the bottom and the top was used for the preparation of horizontal sections. In detail, (1) we cut out fixed placentas just above the midline with a blade. (2) The placental tissue was embedded in paraffin so that the cutting area is faced to a surface of paraffin block. (3) We cut out and collect the first several sections that contain the midline level of placenta. Thus, we believe that the present result could be considered to represent the effect of TCDD on the particular placental tissue. These sections were subjected to either hematoxylin and eosin staining, or endothelial staining using BS-1 lectin that identifies fetal capillaries as described previously (Laitinen, 1987
). The sections were deparaffinized in xylene and rehydrated in a graded series of ethanol concentration and in phosphate-buffered saline, pH 7.2 (PBS). The sections were incubated with 0.3% H2O2 for 10 min at room temperature to remove endogenous peroxidases and then washed in PBS. The sections were incubated in 0.1M Tris-HCl buffer, pH 7.8, containing 0.1% trypsin and 1 mg/ml CaCl2 for 10 min at 37°C. The sections were blocked with 1% bovine serum albumin (Sigma) in PBS for 10 min and with avidin and biotin (Vector, Burlingame, CA) for 15 min each and then washed in PBS. The sections were washed and incubated with 100 mg/ml biotin-labeled BS-1 lectin (cat #L3759, Sigma) for 1 h at room temperature and then washed with PBS. The sections were incubated with streptavidin conjugated with horseradish peroxidase (1:400 dilution) (Zymed, San Francisco, CA) for 1 h at room temperature and then washed with PBS. Specific binding was detected using DAB solution. The sections were then counterstained with hematoxylin, dehydrated, and mounted with DPX (BDH Laboratory Supplies, Poole, U.K.).
Image analysis of maternal blood sinusoids and fetal capillaries.
Images of maternal blood sinusoids and fetal capillaries in stained endothelial sections were obtained by scanning sections under an Olympus microscope connected to a digital camera (Tokyo, Japan). The areas of maternal blood sinusoids and fetal capillaries were manually selected and extracted from the horizontal sectional image on a computer, and morphometry was performed using Scion Image (Scion Co., Frederick, MD). All the placentas examined were prepared from live fetus otherwise described in the text. Six placentas each from the control group and the TCDD-exposed group were randomly selected from four dams, and for each section, the average of three randomly selected areas was obtained. Finally, the value of six placentas of each group is shown as mean ± SE.
Assessment of apoptotic cell number.
Apoptotic cells were detected by terminal deoxynucleotidyl transferase dUTP nick-end labeling using a commercially available kit (ApopTag S7101, Serological Co., Norcross, GA). After deparaffinization and rehydration, horizontal sections were subjected to digestion with proteinase K for 15 min. Endogenous peroxidase was removed by treatment with 2% hydrogen peroxide. The 3' hydroxyl ends of broken DNA strands were enzymatically labeled with digoxigenin nucleotides. DNA fragments were then allowed to bind to an anti-digoxigenin antibody conjugated with peroxidase. Tissue sections, during the preparation of which terminal deoxynucleotidyl transferase was replaced with PBS, were used as negative control. The sections were counterstained with methyl green. All the placentas examined were prepared from live fetuses. We used three dams for each group and collected at least one placenta at random from each dam. Then, the number of apoptotic cells on either GD16, GD18, or GD20 for the control group and the TCDD-exposed group was an average of at least three placentas and is shown as mean ± SE.
Semiquantitative RT-PCR.
The expression of VEGF, Flk1, Flt1, Ang1, Ang2, and Tie2 mRNAs was analyzed by the semiquantitative RT-PCR method as described previously (Ishimura et al., 2002b
). Total RNA of each placenta was purified from whole placenta using Trizol, and RNA samples (4 µg) were reverse transcribed for 50 min at 42°C in a 20-µl reaction volume with 200 units of SuperScript II reverse transcriptase and 0.5 µg of oligo(dT)1218 primer. The volume of the reaction mixture for mRNA amplification was 25 µl and contained 0.5 µl of reverse transcriptase reaction products, 1 unit of TaKaRa Ex Taq polymerase, 1x Ex Taq buffer, 0.2 mM of each dNTP, and 2 µM of each primer. The VEGF primers (forward, GCAGATCATGCGGATCAAAC; reverse, ACGCTCCAGGATTTAAACCG) yielded a 183-nucleotide product. The Flk1 primers (forward, CACGTGAAGGATTTCCAGGG; reverse, ACCCCTGATCACATGGAAGG) yielded a 192-nucleotide product. The Flt1 primers (forward, AAGCAATCCCCACAGCAATG; reverse, GCGAGCAGATTTCTCCGTTG) yielded a 295-nucleotide product. The Ang1 primers (forward, CACACGTGGAGACGGATTTC; reverse, GCAGTTGGATTTCAAGACGG) yielded a 276-nucleotide product. The Ang2 primers (forward, CTGACCATGATGTCATCGCC; reverse, TCAGCTGGGAGACAAACTCG) yielded a 316-nucleotide product. The Tie2 primers (forward, TGGAATGACTTGCATCACCG; reverse, ATCCTCTTGATGGCAGCGTC) yielded a 306-nucleotide product. The cyclophilin primers (forward, TCTGAGCACTGGGGAGAAAG; reverse, AGGGGAATGAGGAAAATATGG), which were used to control for variation in RT-PCR efficiency, yielded a 524-nucleotide product. PCR was initially performed using different cycles, and data obtained in the logarithmic phase in 25, 29, 29, 32, 29, 26, and 20 cycles were adopted for VEGF, Flk1, Flt1, Ang1, Ang2, Tie2, and cyclophilin, respectively. The cycling parameters were as follows: 94°C for 30 s, appropriate annealing temperature for 30 s, and 72°C for 1 min; the annealing temperatures were 55°C for Flt1 and cyclophilin, 56°C for VEGF, 59°C for Flk1, and 61°C for Ang1, Ang2, and Tie2. The PCR products were separated using 2% agarose gel. The amounts of RT-PCR products for VEGF, Flk1, Flt1, Ang1, Ang2, and Tie2 were quantified by normalization relative to a PCR product of cyclophilin using Image J software (National Institutes of Health, Bethesda, MD). We determined the reproducibility using at least three placentas each from both control and TCDD-exposed groups on each day of assessment. The PCR products corresponding to VEGF, Flk1, Flt1, Ang1, Ang2, Tie2, and cyclophilin were subcloned into the pGEM-T Easy vector and sequenced by the dideoxynucleotide chain termination method using an ABI Prism BigDye terminator cycle sequencing kit (PE-Biosystems, Foster City, CA).
Statistical analysis.
Student's t-test was applied to perform statistical evaluation for morphometric measurements, band intensity in the semiquantitative RT-PCR analysis, and the number of apoptotic cells.
| RESULTS |
|---|
|
|
|---|
Abnormal Histology of Placental Labyrinth Zone of TCDD-Exposed Group on GD20
In our earlier paper (Ishimura et al., 2002b
|
Image Analysis of Labyrinth Zone
Based on the immunohistochemical staining with BS-1 lectin, images of the maternal blood sinusoids and the fetal capillaries in the stained sections from both the control and TCDD-exposed groups were obtained. The current study was conducted to use four TCDD-exposed mice (tentatively named as Ta, Tb, Tc, and Td) that showed different numbers of fetal death (0, 0, 43, and 10%, respectively), and we tentatively named a placenta as Ta-P1 that was derived from Ta dam. We collected several placentas of live fetuses at random from each dam for histological observations. All the placentas from different dams of the TCDD-exposed group showed abnormal vasculature: maternal blood sinusoids and fetal capillaries appeared to become fragmentary, whereas those in the control group were round (Fig. 2). The placentas from an identical dam such as Ta-P1 and Ta-P2 or Tb-P1 and Tb-P2 also showed the similar type of abnormal vasculature (Fig. 2). In addition, the blank area on the image in which trophoblasts are present was larger in the TCDD-exposed group than in the control group because the size of trophoblasts in the former group was enlarged compared to those in the latter (representative area is indicated by an arrow in Tc-P1 of Fig. 2).
|
We examined fetal death by three criteria: i.e., motionlessness, color change, and skin edema. But, it is nearly impossible to distinguish relatively healthy fetuses from dying fetuses, although we could easily identify dead fetuses at the time of autopsy. When we examined placental pathology in TCDD-exposed live and dead fetuses, all the tissues from live (including dying) and dead fetuses examined had constricted maternal blood sinusoids and fetal capillaries. Thus, we believe that there was no difference in the placental morphology among the live (including dying) and dead fetuses. Autopsies of placental vasculature from dead fetuses on GD20 showed that the pathological observations on constricted maternal blood sinusoids and fetal capillaries were similar to those found in the placentas from live fetuses (data not shown).
The image analysis revealed that the cross-sectional area and perimeter of the placental maternal blood sinusoids (as expressed per mm2) in the TCDD-exposed group were approximately 74 and 132% of those in the control group, respectively (Table 1), supporting the histological observation of fragmentized placental maternal blood sinusoids in the TCDD-exposed group. The area of placental fetal capillaries (per mm2) in the TCDD-exposed group also decreased to approximately 84% of that in the control group. The decrease in placental fetal capillary area despite the increased number of fetal capillaries per square millimeter in the TCDD-exposed group was due to the decrease in the average area of one capillary (Table 1).
|
Vascular Remodeling of Placenta in Control Group during Late Gestation
To obtain fundamental knowledge on the development of maternal blood sinusoids and fetal capillaries under physiological conditions, we immunohistochemically examined the placental tissue of control rats from GD16 to GD20. On GD16, the diameter of fetal capillaries was small but increased gradually until GD20 (Fig. 3). Similarly, the maternal blood sinusoids occupied a small area in a cross section on GD16, but they gradually expanded covering most of the horizontal section of the placenta on GD20. These dilations of both maternal blood sinusoids and fetal capillaries were compensated by the decrease in the thickness of trophoblasts from GD16 to GD20 (Figs. 3b, 3e, and 3h: circle, and Figs. 3c, 3f, and 3i: open space). These results suggest that vascular remodeling occurs in the normal labyrinth zone from GD16 to GD20 characterized by the increase in the diameter of both the maternal blood sinusoids and fetal capillaries, as well as the decrease in the thickness of trophoblasts, and that this vascular remodeling is severely suppressed by TCDD.
|
Expression Profile of Genes Associated with Blood Vessel Formation in Placenta of Control Group and TCDD-Exposed Group
The above-mentioned immunohistological study suggested that vascular remodeling occurs during the late gestation. To substantiate these findings, we attempted to investigate the expression of genes associated with blood vessel formation. The placentas of the control group on GD16, GD18, and GD20 were subjected to semiquantitative RT-PCR analysis. Regarding the VEGF/VEGFR system, the expression levels of VEGF and Flt1 mRNAs increased and that of Flk1 mRNA remained constant (Fig. 4). As for the Ang/Tie2 system, the expression levels of Ang1 and Tie2 mRNAs dramatically increased (Fig. 4).
|
Next, we compared the expression profile of genes associated with blood vessel formation in the placenta on GD20 between the control and TCDD-exposed groups. The expression levels of genes involved in the VEGF/VEGFR system including those encoding VEGF, Flk1, and Flt1 did not show significant differences between the control and TCDD-exposed groups (Fig. 5). Regarding the Ang/Tie2 system, no difference in the expression levels of Ang1 and Ang2 mRNAs was found between the control and TCDD-exposed groups. On the other hand, the expression level of Tie2 mRNA was lower in the TCDD-exposed group than in the control group (Fig. 5). As Tie2 is closely associated with vascular remodeling, this decreased expression level of Tie2 mRNA is consistent with the histological observations (Fig. 1).
|
Decreased Apoptotic Cell Number in TCDD-Exposed Group
In the human placenta, the apoptosis of trophoblasts is thought to be partly responsible for vascular development (Straszewski-Chavez et al., 2005
|
Next, we compared the apoptotic cell number in the placenta between the control and TCDD-exposed groups. Interestingly, the number of apoptotic cells in the TCDD-exposed group was less than one-half of that in the control group during the gestation, and the decrease in the number of apoptotic cells was observed from GD16 to GD20 (Fig. 6). This indicates that the apoptotic signaling of trophoblasts was disrupted following TCDD exposure.
| DISCUSSION |
|---|
|
|
|---|
In the present study, we demonstrated for the first time that vascular remodeling, characterized by the dilation of both maternal blood sinusoids and fetal capillaries, occurred in the normal labyrinth zone of the rat placenta during the late gestation and that in utero exposure to TCDD suppressed this vascular remodeling, which results in fetal death perhaps caused by a decrease in the supply of oxygen and nutrients to the fetus.
Vascular Remodeling Occurs in Normal Placenta during Late Gestation
The placenta of rodents resembles that of primates anatomically and physiologically, and the placentas of rodents and primates are categorized as the hemochorial placenta. It is thought that knowledge obtained from the study of the placenta of rodents might provide relevant information leading to the understanding of the physiological functions of the human placenta. Cross and coworkers reported vascular development in the deciduas, junctional zone, and labyrinth zone of the mouse placenta during the entire period of gestation (Adamson et al., 2002
; Cross et al., 2002
). In the mouse placenta, the maternal blood sinusoids tend to be thinner during the late gestation (Adamson et al., 2002
), whereas in the rat placenta, the maternal blood sinusoids dilate during the late gestation (Fig. 3), suggesting a difference in the mechanism of vascular remodeling between these two animal species. Due to a lack of information on the histological changes of the vasculature of the rat placenta, in the present study we examined how the vasculature of both maternal blood sinusoids and fetal capillaries in the labyrinth zone changes during the late gestation.
In the placenta from the control group on GD16 when both maternal blood sinusoids and fetal capillaries were constricted, the trophoblasts were large and the trophoblastic layer of the interhemal membrane was thick. However, as gestation proceeded from GD16 to GD20, both maternal blood sinusoids and fetal capillaries became dilated, and the trophoblasts became smaller, with an increased expression level of Tie2 mRNA. It was reported that Tie2 is expressed in fetal capillary endothelial cells and is involved in vascular remodeling in the human placenta (Goldman-Wohl et al., 2000
). These results suggest that trophoblasts play a role as periendothelial support cells and accelerate the adhesion of trophoblasts to the fetal capillary by modifying cell shape, with an increased expression level of Tie2 mRNA in fetal capillary endothelial cells. Because a growing fetus requires increased amounts of oxygen and nutrients through the placenta (Cross et al., 2003
), the morphological modification of trophoblasts, which consequently shortens the distance and increases the contact area between the maternal blood sinusoids and the fetal capillaries in the labyrinth zone, is considered to support fetal life.
The present results also showed that many trophoblasts were found to be eliminated by apoptosis in the control group. The observations of an increase in the number of apoptotic cells during the late gestation and a slight decrease on GD20 in the labyrinth zone are consistent with a previous report (Waddell et al., 2000
). Furthermore, the number of apoptotic trophoblasts in the human placenta was reported to increase during the late gestation (Straszewski-Chavez et al., 2005
), suggesting that the apoptosis of trophoblasts during the late gestation is a fundamental process irrespective of animal species. The present study provided physiological evidence that trophoblasts have dual functions for the dilation of both maternal blood sinusoids and fetal capillaries during late gestation; one is the morphological change of surviving trophoblasts with a decrease in size and the other is the elimination of redundant cells by apoptosis.
It was reported that placental cells stop cell divisions around GD16, despite the observation of a very high growth rate of the fetus during this time (Butterstein and Leathem, 1974
; Winick and Noble, 1966
) and of marked changes in the secretion profile of placental protein hormones and the composition of placental membrane proteins at this stage (Ishimura et al., 1995
; Soares et al., 1998
). Therefore, it is considered that GD16 is a critical period during which the functional properties of the rat placenta are altered. Concerning the vasculature in the labyrinth zone, it seems likely that vascular remodeling rather than angiogenesis is a more significant event after GD16.
The Suppression of Vascular Remodeling by TCDD Exposure during the Late Gestation is Responsible for the Abnormal Vasculature in the Placenta
In the present study, the suppression of vascular dilation was observed in both the maternal blood sinusoids and fetal capillaries in the labyrinth zone on GD20 following exposure to TCDD on GD15. The histology of placental tissues of the TCDD-exposed group on GD20 resembled that on GD16 rather than that of the control group on GD20 in the following points: the trophoblasts were larger and did not decrease in thickness, and the trophoblastic layer of the interhemal membrane was thicker in the TCDD-exposed group than in the control group. In addition, in the TCDD-exposed group the expression level of Tie2 mRNA significantly decreased, suggesting that the adhesion between trophoblasts and fetal capillary endothelial cells was not facilitated. These observations indicate that TCDD exposure simply suppressed vascular remodeling rather than stimulated some unexpected growth signaling.
A decreased number of apoptosis of trophoblasts observed during GD16 and GD20 (Fig. 6), which implies the existence of redundant trophoblasts, is considered as the main cause of the suppression of vascular remodeling in the placenta of the TCDD-exposed group. It is noteworthy that in the preeclampsia of the human placenta, the apoptosis of interstitial trophoblasts within the placental bed is inhibited (Kadyrov et al., 2003
). These redundant cells are speculated to occupy space, which thus perturb maternal blood sinusoids and fetal capillaries expansion. Therefore, the decreased number of apoptotic trophoblasts may be an intrinsic factor that results in the suppressed vascular remodeling in the labyrinth zone of the TCDD-exposed group.
A decrease in a number of apoptotic trophoblasts on GD16 was a rapid response since it was observed one day after the TCDD exposure. It might be worth studying how a lower dose of TCDD affects this rapid response.
Difference in Susceptibilities to TCDD Insult between Vasculogenesis and Vascular Remodeling
Despite the altered expression level of Tie2 mRNA, the expression level of mRNAs of the VEGF/VEGFR system associated with vasculogenesis did not change following in utero exposure to TCDD. In a separate experiment, we administered pregnant Sprague-Dawley rats TCDD at a total of 2.0 µg TCDD/kg (from GD8, GD9, and GD10 at a dose of 1.0, 0.5, and 0.5 µg/kg, respectively), during which vasculogenesis is known to be very active, and we failed to find any abnormal pathology in the placenta as well as no fetal death on GD12 (Ishimura, Kawakami, Ohsako, Nohara, and Tohyama, unpublished data). The exposure of Holtzman, Long-Evans, or Sprague-Dawley rats to TCDD before fertilization or at the early stage of gestation results in fetal death at the late stage of gestation but not in the early stage of gestation (Huuskonen et al., 1994
; Murray et al., 1979
; Olson and McGarrigle, 1992
; Sparschu et al., 1971
). In addition, in the zebra fish, TCDD exposure causes alteration in blood flow as well as vascular remodeling but not in vasculogenesis (Bello et al., 2004
; Dong et al., 2002
). Therefore, it is conceivable that vascular remodeling is more sensitive to TCDD exposure than vasculogenesis. In addition, AhR knockout mice exhibited a notable phenotype, a closure of ductus venosus in the fetus, suggesting that AhR is involved in the hepatic vasculogenesis (Lahvis et al., 2000
). On the other hand, lack of aryl hydrocarbon receptor nuclear translocator, a transcription factor that specifically binds to make a heterodimer with AhR, results in a defect of placental vasculature (Abbott and Buckalew, 2000
; Kozak et al., 1997
) as well as abnormal angiogenesis in tissues such as yolk sac (Maltepe et al., 1997
). Therefore, both the AhR and ARNT intrinsically play important roles on vasculogenesis and angiogenesis, which might be disrupted by TCDD. How TCDD affects vasculogenesis and angiogenesis in fetal tissues, such as liver and heart, remain to be studied.
Relationship between Abnormal Placental Vasculature and Increased Risk of Fetal Death Caused by TCDD
All the placental tissues had abnormalities in vascular remodeling irrespective of mortality of the fetus among dams. We speculated that the abnormal vascular remodeling, possibly together with the involvement of other yet unidentified factors, gives rise to fetal death upon exposure to TCDD. A possible factor is increased demands for oxygen and nutrients in the growing fetus, particularly during the late gestation. This notion is supported by the observation that fetal death occurs on GD20 but not on GD16, which was the next day of TCDD administration (Ishimura et al., 2002b
).
| CONCLUSION |
|---|
|
|
|---|
To explore the mechanism of increased risk of TCDD-induced fetal death in the rat, we investigated the abnormal vasculature in the placental labyrinth zone of the TCDD-exposed group. Based on the experimental strategy to analyze the placentas from live fetuses, it is beyond the ability to find a sole factor that determines the fetal death. However, we found conspicuous abnormalities in the TCDD-exposed placenta that should increase the risk of fetal death. The vascular remodeling characterized by the dilation of both maternal blood sinusoids and fetal capillaries was suppressed by TCDD exposure, whereas in the normal placenta, vascular remodeling occurred together with the modification and elimination of redundant trophoblasts during the late gestation. In the labyrinth zone of the TCDD-exposed group, the decrease in the number of apoptotic cells is considered to be responsible for the suppressed vascular remodeling.
| NOTES |
|---|
1 Present address: The Jackson Laboratory, Bar Harbor, ME 04609.
| ACKNOWLEDGMENTS |
|---|
The authors thank Mrs. Shigeko Sakamoto for excellent technical assistance. This research was supported in part by the Special Coordination Fund for Promoting Science and Technology from the Ministry of Education, Culture, Sports, Science and Technology (to R.I.) and CREST, JST (to C.T.).
| REFERENCES |
|---|
|
|
|---|
Abbott, B. D., and Buckalew, A. R. (2000). Placental defects in ARNT-knockout conceptus correlate with localized decreases in VEGF-R2, Ang-1, and Tie-2. Dev. Dyn. 219, 526538.[CrossRef][ISI][Medline]
Adamson, S. L., Lu, Y., Whiteley, K. J., Holmyard, D., Hemberger, M., Pfarrer, C., and Cross, J. C. (2002). Interactions between trophoblast cells and the maternal and fetal circulation in the mouse placenta. Dev. Biol. 250, 358373.[CrossRef][ISI][Medline]
Bello, S. M., Heideman, W., and Peterson, R. E. (2004). 2,3,7,8-Tetrachlorodibenzo-p-dioxin inhibits regression of the common cardinal vein in developing zebrafish. Toxicol. Sci. 78, 258266.
Birnbaum, L. S. (1995). Developmental effects of dioxins and related endocrine-disrupting chemicals. Toxicol. Lett. 8283, 743750.[CrossRef]
Breier, G. (2000). Angiogenesis in embryonic developmentA review. Placenta 21(Suppl. A), S11S15.
Butterstein, G. M., and Leathem, J. H. (1974). Placental growth modification during pregnancy in the rat. Endocrinology 95, 645649.[ISI][Medline]
Chartrel, N. C., Clabaut, M. T., Boismare, F. A., and Schrub, J. C. (1990). Uteroplacental hemodynamic disturbances in establishment of fetal growth retardation in streptozocin-induced diabetic rats. Diabetes 39, 743746.[Abstract]
Couture, L. A., Abbott, B. D., and Birnbaum, L. S. (1990). A critical review of the developmental toxicity and teratogenicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin: Recent advances toward understanding the mechanism. Teratology 42, 619627.[CrossRef][ISI][Medline]
Cross, J. C., Hemberger, M., Lu, Y., Nozaki, T., Whiteley, K., Masutani, M., and Adamson, S. L. (2002). Trophoblast functions, angiogenesis and remodeling of the maternal vasculature in the placenta. Mol. Cell Endocrinol. 187, 207212.[CrossRef][ISI][Medline]
Cross, J. C., Simmons, D. G., and Watson, E. D. (2003). Chorioallantoic morphogenesis and formation of the placental villous tree. Ann. N. Y. Acad. Sci. 995, 8493.
Davies, J., and Glasser, S. R. (1968). Histological and fine structural observations on the placenta of the rat. Acta Anat. 69, 542608.[ISI][Medline]
Dong, W., Teraoka, H., Yamazaki, K., Tsukiyama, S., Imani, S., Imagawa, T., Stegeman, J. J., Peterson, R. E., and Hiraga, T. (2002). 2,3,7,8-Tetrachlorodibenzo-p-dioxin toxicity in the zebrafish embryo: Local circulation failure in the dorsal midbrain is associated with increased apoptosis. Toxicol. Sci. 69, 191201.
Dumont, D. J., Gradwohl, G., Fong, G. H., Puri, M. C., Gertsenstein, M., Auerbach, A., and Breitman, M. L. (1994). Dominant-negative and targeted null mutations in the endothelial receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev. 8, 18971909.
Eriksson, U. J., and Jansson, L. (1984). Diabetes in pregnancy: Decreased placental blood flow and disturbed fetal development in the rat. Pediatr. Res. 18, 735738.[ISI][Medline]
Gewolb, I. H., Merdian, W., Warshaw, J. B., and Enders, A. C. (1986). Fine structural abnormalities of the placenta in diabetic rats. Diabetes 35, 12541261.[Abstract]
Goldman-Wohl, D. S., Ariel, I., Greenfield, C., Lavy, Y., and Yagel, S. (2000). Tie-2 and angiopoietin-2 expression at the fetal-maternal interface: A receptor ligand model for vascular remodelling. Mol. Hum. Reprod. 6, 8187.
Guo, Y., Hendrickx, A. G., Overstreet, J. W., Dieter, J., Stewart, D., Tarantal, A. F., Laughlin, L., and Lasley, B. L. (1999). Endocrine biomarkers of early fetal loss in cynomolgus macaques (Macaca fascicularis) following exposure to dioxin. Biol. Reprod. 60, 707713.
Hanahan, D. (1997). Signaling vascular morphogenesis and maintenance. Science 277, 4850.
Hutzinger, O., Choudhry, G. G., Chittim, B. G., and Johnston, L. E. (1985). Formation of polychlorinated dibenzofurans and dioxins during combustion, electrical equipment fires and PCB incineration. Environ. Health Perspect. 60, 39.[ISI][Medline]
Huuskonen, H., Unkila, M., Pohjanvirta, R., and Tuomisto, J. (1994). Developmental toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in the most TCDD-resistant and -susceptible rat strains. Toxicol. Appl. Pharmacol. 124, 174180.[CrossRef][ISI][Medline]
Ishimura, R., Noda, K., Hattori, N., Shiota, K., and Ogawa, T. (1995). Analysis of rat placental plasma membrane proteins by two-dimensional gel electrophoresis. Mol. Cell Endocrinol. 115, 149159.[CrossRef][ISI][Medline]
Ishimura, R., Ohsako, S., Kawakami, T., Sakaue, M., Aoki, Y., and Tohyama, C. (2002a). Altered protein profile and possible hypoxia in the placenta of 2,3,7,8-tetrachlorodibenzo-p-dioxin-exposed rats. Toxicol. Appl. Pharmacol. 185, 197206.[CrossRef][ISI][Medline]
Ishimura, R., Ohsako, S., Miyabara, Y., Sakaue, M., Kawakami, T., Aoki, Y., Yonemoto, J., and Tohyama, C. (2002b). Increased glycogen content and glucose transporter 3 mRNA level in the placenta of Holtzman rats after exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol. Appl. Pharmacol. 178, 161171.[CrossRef][ISI][Medline]
Kadyrov, M., Schmitz, C., Black, S., Kaufmann, P., and Huppertz, B. (2003). Pre-eclampsia and maternal anaemia display reduced apoptosis and opposite invasive phenotypes of extravillous trophoblast. Placenta 24, 540548.[CrossRef][ISI][Medline]
Kanaka-Gantenbein, C., Mastorakos, G., and Chrousos, G. P. (2003). Endocrine-related causes and consequences of intrauterine growth retardation. Ann. N. Y. Acad. Sci. 997, 150157.
Khera, K. S. (1987). Maternal toxicity of drugs and metabolic disordersA possible etiologic factor in the intrauterine death and congenital malformation: A critique on human data. Crit. Rev. Toxicol. 17, 345375.[Medline]
Kozak, K. R., Abbott, B., and Hankinson, O. (1997). ARNT-deficient mice and placental differentiation. Dev. Biol. 191, 297305.[CrossRef][ISI][Medline]
Lahvis, G. P., Lindell, S. L., Thomas, R. S., McCuskey, R. S., Murphy, C., Glover, E., Bentz, M., Southard, J., and Bradfield, C. A. (2000). Portosystemic shunting and persistent fetal vascular structures in aryl hydrocarbon receptor-deficient mice. Proc. Natl. Acad. Sci. U.S.A. 97, 1044210447.
Laitinen, L. (1987). Griffonia simplicifolia lectins bind specifically to endothelial cells and some epithelial cells in mouse tissues. Histochem. J. 19, 225234.[CrossRef][ISI][Medline]
Lindstrom, G., Hooper, K., Petreas, M., Stephens, R., and Gilman, A. (1995). Workshop on perinatal exposure to dioxin-like compounds. I. Summary. Environ. Health Perspect. 103(Suppl. 2), 135142.
Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A., and Simon, M. C. (1997). Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature 386, 403407.[CrossRef][Medline]
Martinez, J. M., DeVito, M. J., Birnbaum, L. S., and Walker, N. J. (2003). Toxicology of dioxins and dioxinlike compounds. In Dioxins and Health, 2nd ed. (A. Schecter and T. Gasiewicz, Eds.), pp. 137158. John Wiley and Sons Inc., Hoboken, NJ.
McNulty, W. P. (1985). Toxicity and fetotoxicity of TCDD, TCDF and PCB isomers in rhesus macaques (Macaca mulatta). Environ. Health Perspect. 60, 7788.[ISI][Medline]
Murray, F. J., Smith, F. A., Nitschke, K. D., Humiston, C. G., Kociba, R. J., and Schwetz, B. A. (1979). Three-generation reproduction study of rats given 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in the diet. Toxicol. Appl. Pharmacol. 50, 241252.[CrossRef][ISI][Medline]
Ohsako, S., Miyabara, Y., Nishimura, N., Kurosawa, S., Sakaue, M., Ishimura, R., Sato, M., Takeda, K., Aoki, Y., Sone, H., et al. (2001). Maternal exposure to a low dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) suppressed the development of reproductive organs of male rats: Dose-dependent increase of mRNA levels of 5alpha-reductase type 2 in contrast to decrease of androgen receptor in the pubertal ventral prostate. Toxicol. Sci. 60, 132143.
Olson, J. R., and McGarrigle, B. P. (1992). Comparative developmental toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Chemosphere 25, 7174.
Prager, R., Abramovici, A., Liban, E., and Laron, Z. (1974). Histopathological changes in the placenta of streptozotocin induced diabetic rats. Diabetologia 10, 8991.[CrossRef][ISI][Medline]
Reynolds, L. P., and Redmer, D. A. (1995). Utero-placental vascular development and placental function. J. Anim. Sci. 73, 18391851.[Abstract]
Roberts, J. M., and Lain, K. Y. (2002). Recent insights into the pathogenesis of pre-eclampsia. Placenta 23, 359372.[CrossRef][ISI][Medline]
Rossant, J., and Cross, J. C. (2001). Placental development: Lessons from mouse mutants. Nat. Rev. Genet. 2, 538548.[ISI][Medline]
Sato, T. N., Tozawa, Y., Deutsch, U., Wolburg-Buchholz, K., Fujiwara, Y., Gendron-Maguire, M., Gridley, T., Wolburg, H., Risau, W., and Qin, Y. (1995). Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 376, 7074.[CrossRef][Medline]
Soares, M. J., Muller, H., Orwig, K. E., Peters, T. J., and Dai, G. (1998). The uteroplacental prolactin family and pregnancy. Biol. Reprod. 58, 273284.
Sparschu, G. L., Dunn, F. L., and Rowe, V. K. (1971). Study of the teratogenicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the rat. Food Cosmet. Toxicol. 9, 405412.[CrossRef][ISI][Medline]
Straszewski-Chavez, S. L., Abrahams, V. M., and Mor, G. (2005). The role of apoptosis in the regulation of trophoblast survival and differentiation during pregnancy. Endocr. Rev. 26, 877897.
Tijet, N., Boutros, P. C., Moffat, I. D., Okey, A. B., Tuomisto, J., and Pohjanvirta, R. (2006). Aryl hydrocarbon receptor regulates distinct dioxin-dependent and dioxin-independent gene batteries. Mol. Pharmacol. 69, 140153.
Waddell, B. J., Hisheh, S., Dharmarajan, A. M., and Burton, P. J. (2000). Apoptosis in rat placenta is zone-dependent and stimulated by glucocorticoids. Biol. Reprod. 63, 19131917.
Walker, J. J. (2000). Pre-eclampsia. Lancet 356, 12601265.[CrossRef][ISI][Medline]
Winick, M., and Noble, A. (1966). Quantitative changes in ribonucleic acids and protein during normal growth of rat placenta. Nature 212, 3435.[CrossRef][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||





