ToxSci Advance Access originally published online on March 24, 2006
Toxicological Sciences 2006 91(2):467-475; doi:10.1093/toxsci/kfj174
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Metallothionein-1 and -2 Expression in Cadmium- or Arsenic-Derived Human Malignant Urothelial Cells and Tumor Heterotransplants and as a Prognostic Indicator in Human Bladder Cancer
Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, North Dakota 58202
1 To whom correspondence should be addressed at Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, 501 North Columbia Road, Grand Forks, ND 58202. Fax: (701) 777-3108. E-mail: ssomji{at}medicine.nodak.edu.
Received January 30, 2006; accepted March 22, 2006
| ABSTRACT |
|---|
|
|
|---|
The goal of this study was to determine if the expression of the metallothionein (MT)-1/2 proteins might serve as a biomarker for the development of bladder cancer. A retrospective analysis of MT-1/2 staining was performed on 343 tissue sections from patients referred for the diagnosis of bladder cancer. The specimens were subdivided into six categories: benign, dysplastic, low-grade cancer, high-grade cancer with no evidence of invasion, high-grade cancer with evidence of invasion, and carcinoma in situ. There was no expression of MT-1/2 in benign lesions and low-grade cancers, a low incidence of expression in dysplastic lesions and high-grade cancers with no evidence of muscle invasion, and a significantly increased incidence of MT-1/2 in high-grade cancers that had invaded the underlying matrix. The expression of MT-1/2 varied in intensity from sample to sample and was focal in its expression. It was concluded from these findings that MT-1/2 may be a prognostic marker for cancers that are progressing to invade the underlying stroma of the bladder wall. The expression of MT-1/2 was also determined in a cell culture model of human urothelium that had been malignantly transformed by Cd2+ and As3+ and shown to be capable of tumor formation in nude mice. It was demonstrated that the expression of MT-1/2 in the tumor heterotransplants was similar to the pattern found in archival specimens of high-grade bladder cancers. The MT-1/2 staining in the heterotransplants was focal in pattern, varied in intensity, and highest in the less differentiated cells of the tumor. These findings indicate that the cell culture model may serve to help define the role of MT-1/2 expression in bladder cancer invasion.
Key Words: bladder cancer; arsenic; cadmium; metallothionein; biomarker; prognosis.
| INTRODUCTION |
|---|
|
|
|---|
Historically, bladder cancer is the first cancer in which industrial carcinogens were found to play the major role in disease causation. There are several reports which show that the combined expression of the first and second isoforms of metallothionein (MT-1 and -2) are of prognostic significance for bladder cancer (Bahnson et al., 1991
A second goal of this study was to determine if a recently developed model of human bladder cancer would mimic the MT-1/2 expression pattern found in human bladder tumors. This model system was developed by the direct malignant transformation of an immortalized cell culture model of human urothelial cells with Cd2+ or As3+ (Rossi et al., 2001
). The resulting transformants were shown to form colonies in soft agar and tumors when injected subcutaneously in immunocompromised mice (Sens et al., 2004
). The histology of the tumor heterotransplants possessed features expected of human transitional cell carcinoma.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bladder specimens for the retrospective immunohistochemical analysis of MT-1 and -2 expression.
Tissue sections for the immunohistochemical analysis of MT-1/2 expression in the human bladder were obtained from archival paraffin blocks that originated from previously completed patient diagnostic procedures. The designation MT-1/2 is used to indicate that the E-9 antibody used in this study recognizes both the MT-1 and -2 protein isoforms of MT. The immunohistochemical expression of MT-1/2 was determined on tissue sections from 350 patients referred for diagnosis of possible transitional cell carcinoma of bladder. For analysis of MT-1/2 expression, these specimens were subdivided into six categories: benign, dysplastic, low-grade urothelial cancer, high-grade urothelial cancer with no evidence of invasion into the underlying muscular layer, high-grade urothelial cancer with evidence of invasion of the underlying muscle layer, and carcinoma in situ (CIS). Grading of the urothelial lesions was performed on hematoxylin and eosin (H&E)stained tissue sections and utilized the World Health Organization/International Society of Urological Pathology consensus conference classification (Epstein et al., 1998
Tumor heterotransplant tissues for the analysis of MT-1 and -2 gene expression.
The histology of the nude mouse heterotransplants produced by subcutaneous injection of UROtsa cell lines malignantly transformed with either 1µM Cd2+ or As3+ has been described previously (Sens et al., 2004
). In addition to tumor tissue harvested for histology, samples were also taken at this time for the preparation of total RNA and protein.
Immunostaining for MT-1/2 in human and tumor heterotransplants.
Archival bladder specimens were routinely fixed in 10% neutral buffered formalin for 1618 h. All tissues were transferred to 70% ethanol and dehydrated in 100% ethanol. Dehydrated tissues were cleared in xylene, infiltrated, and embedded in paraffin. Serial sections were cut at 35 µm for use in immunohistochemical protocols. Prior to immunostaining, sections were immersed in preheated Target Retrieval Solution (catalog No. S1699, Dako, Carpinteria, CA) and heated in a steamer for 20 min. The sections were allowed to cool to room temperature and immersed into Tris-buffered saline with Tween 20 for 5 min. The immunostaining was performed on a Dako Autostainer Universal Staining System. MT was localized using a monoclonal mouse anti-horse MT-1, MT-2 antibody (Dako-MT, E9) as the primary antibody. The primary antibody was localized using the DakoCytomation peroxidase-conjugated EnVision Dual Link System. Liquid diaminobenzidine (DAB) was used for visualization (DakoCytomation liquid DAB substrate chromogen system). Slides were rinsed in distilled water, dehydrated in graded ethanol, cleared in xylene, and coverslipped.
The immunostaining of tumor heterotransplants was performed manually and used the identical E-9 antibody as described above. The primary antibody was localized using the DakoCytomation ARK (Animal Research Kit) and Peroxidase. This system minimizes reactivity of secondary anti-mouse antibody with endogenous immunoglobulin that may be present in the specimen. Liquid DAB was used for visualization. Slides were rinsed in distilled water, dehydrated in graded ethanol, cleared in xylene, and coverslipped.
The degree of MT immunoreactivity in the specimens was judged by two pathologists using two evaluation criteria. Due to the focal nature of MT-1/2 staining within urothelium and urothelial lesions, immunoreactivity was judged as the percentage of immunoreactive cells in each specimen using the following scale: 0%, 14%, 59%, 1019%, 2050%, and > 50% MT-1/2positive cells. A second criterion was the intensity of the staining in MT-1/2positive specimens, and this was judged as weak, moderate, or intense.
Normal human bladder specimens for analysis of MT-1 and -2 mRNA expression.
Three independent samples of total RNA prepared from undiseased adult bladder were previously analyzed and shown to contain mRNA for the MT-1E, MT-1X, and MT-2A genes (Somji et al., 2001
). The other active MT-1 isoforms (MT-1A, MT-1B, MT-1F, MT-1G, and MT-1H) were shown not to be expressed in these samples. These samples were used in the present study to quantify the levels of expression of the MT-1E, MT-1X, and MT-2A isoformspecific mRNAs using real-time PCR. All specimens were obtained following completion of diagnostic protocols in surgical pathology, and the protocol for tissue acquisition was approved by the Institutional Review Board for Human Research. Only samples showing no evidence of tissue degradation, as judged by histochemical examination of H&E-stained sections, were used for molecular analysis.
Cell culture.
Stock cultures of the UROtsa cell lines malignantly transformed with either 1µM Cd2+ or As3+ were maintained in 75-cm2 tissue culture flasks in either serum or serum-free growth medium as described previously (Sens et al., 2004
). Briefly, the serum-containing growth medium was Dulbecco modified Eagles medium (DMEM) containing 5% (vol/vol) fetal calf serum. The serum-free growth medium was composed of a 1:1 mixture of DMEM and Ham F-12 supplemented with selenium (5 ng/ml), insulin (5 µg/ml), transferrin (5 µg/ml), hydrocortisone (36 ng/ml), triiodothyronine (4 pg/ml), and epidermal growth factor (10 ng/ml). Cultures in both media were incubated at 37°C in a 5% CO2:95% air atmosphere. The cells were fed fresh growth medium every 3 days, and when confluent, the cells were subcultured at a 1:20 ratio using trypsin-EDTA.
Real-time analysis of MT-1 and -2 isoform mRNA expression.
The measurement of MT isoform mRNA expression was assessed with real-time RT-PCR utilizing previously described MT isoformspecific primers (Mididoddi et al., 1996
). Total RNA was purified from As3+- and Cd2+-transformed UROtsa cells growing in 9.6-cm2 culture wells in triplicate and 1 µg was subjected to cDNA synthesis using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) in a total volume of 20 µl. Real-time PCR was performed utilizing the SYBR Green kit (Bio-Rad Laboratories) with 2 µl of cDNA, 0.2µM primers in a total volume of 20 µl in an iCycler iQ real-time detection system (Bio-Rad Laboratories). Amplification was monitored by SYBR Green fluorescence and compared to that of a standard curve of each MT isoform gene cloned into pcDNA3.1/hygro (+) and linearized with FspI. Cycling parameters consisted of denaturation at 95°C for 30 s and annealing at 65°C for 45 s which gave optimal amplification efficiency of each standard. The level of MT isoform expression was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) assessed by the same assay with the primer sequences being sense, TCCTCTGACTTCAACAGCGACAC, and antisense, CACCCTGTTGCTGTAGCCAAATTC, with a product size of 126 base pairs.
MT protein determination.
The immunoblot protocol used for the determination of the coexpressed levels of the MT-1 and -2 proteins in cell lysates has been described previously by this laboratory (Garrett et al., 1998
). The MT-1/2 proteins were detected by immunoblotting using a mouse anti-horse antibody (Dako-MT, E9) as the primary antibody.
Statistical analysis.
All cell culture experiments were performed in triplicate, and the results are expressed as the standard error of the mean. Statistical analyses were performed using Systat software using separate variance t-tests, ANOVA with Tukey post hoc testing. Unless otherwise stated, the level of significance was 0.05.
| RESULTS |
|---|
|
|
|---|
Immunoreactivity of MT-1/2 in Benign, Dysplastic, and Malignant Human Urothelium
There were 350 archival patient specimens of potentially diseased urothelium available for the evaluation of MT-1/2 staining. Following H&E evaluation of the samples, seven were discarded from the study as not being primary cancers of the urothelium. The seven discarded cases were identified as a squamous cell carcinoma of the cervix, two metastatic urothelial cell cancers in lymph nodes, a metastatic urothelial cell cancer in the small intestine, a metastatic urothelial cell cancer in the brain, an adenocarcinoma of the bladder, and a prostate carcinoma. The remaining 343 samples were evaluated for MT-1/2 staining at an antibody dilution of 1:200. Of the 343 samples, 137 were evaluated as benign lesions, and of these, none were immunoreactive for MT-1/2 protein (Table 1, Fig. 1A). The examination consisted of an evaluation of the entire specimen under low (x10) and high (x40) magnification to rule out the possibility of a very low instance of focal staining. In addition, 50 cases of these benign lesions were reexamined at an antibody dilution of 1:50, and no additional staining was found for the MT-1/2 protein within the urothelium. Of the 13 dysplastic lesions available for examination, only one showed weak staining for MT-1/2, and the staining was in the lower one third of the transitional epithelium (Table 1, Fig. 1B). There were 14 cases of CIS, and two of these had focal MT-1/2 staining of weak to moderate intensity that comprised less than 10% of the cells (Table 1). There were 58 cases of low-grade urothelial cancer, and none were immunoreactive for the MT-1/2 protein (Table 1). Several of these specimens were also reexamined at an antibody dilution of 1:50, and no additional staining was found. There were 56 cases of high-grade urothelial cancer that showed no evidence of invasion into the underlying muscle layer. Of these, five specimens showed focal staining for MT-1/2 that was of moderate to strong intensity. Four of the five positive specimens had less than 10% MT-1/2positive cells and one specimen between 10 and 20% MT-1/2positive cells (Table 1). There were 65 cases of high-grade urothelial cancer that showed evidence of invasion into the underlying muscle layer, and 20 of these cases showed focal staining for MT-1/2 (Table 1). The MT-1/2 staining in these MT-1/2positive specimens ranged from specimens having less than 10% of the cells MT-1/2 positive (Fig. 1C) to specimens having greater that 50% positive cells (Fig. 1D). The intensity of MT-1/2 staining also varied with some specimens having weak staining for MT-1/2 and others intense staining. The increased incidence of MT-1/2 staining in high-grade urothelial cancers with evidence of muscle invasion was significant compared to all other groups.
|
|
Immunoreactivity of MT-1/2 in Nonmalignant Stromal Cells Associated with Benign and Malignant Human Urothelium
In the course of the examination of MT-1/2 staining in the urothelium, it was also observed that there were profiles of stromal cell staining in many of the specimens. Overall, approximately 30% of the samples had some stromal cell staining for MT-1/2. In some cases, scattered positivity was seen in the stroma underlying the benign epithelium (Fig. 1E) or papillary cores of urothelial carcinoma (Fig. 1F). The presence of the MT-1/2positive stromal cells was semiquantified as a function of the diagnostic grouping of the specimen (described above) and if the staining was associated with an identifiable structure or lesion. The identifiable lesions were the presence of: an inflammatory lesion, such as granuloma, ulcer, or necrotic area (benign urothelial ulcer, Fig. 1G); the papillary core of an urothelial carcinoma (Fig. 1F); and the invasive component of the urothelial carcinoma (Fig. 1H). A significant finding was that over 70% of the muscle-invasive areas of urothelial carcinoma had stromal cells with strong MT-1/2 immunostaining (Table 2). Furthermore, 80% of the stromal cell staining in muscle-invasive urothelial carcinoma was associated with the invasive component rather than an inflammatory lesion or papillary stromal core. The following combinations were observed: MT-1/2negative urothelium with MT-1/2positive stroma (Fig. 1H), MT-1/2positive urothelium with MT-1/2negative stroma (Fig. 1D), MT-1/2negative urothelium and stroma (Fig. 1I), and MT-1/2positive urothelium and stroma (not shown).
|
Immunoreactivity of MT-1/2 in Tumors Derived from Heterotransplanted As3+- and Cd2+-transformed UROtsa Cells
In a previous study, tumor heterotransplants were generated from an immortalized urothelial cell line (UROtsa) that had been transformed by exposure to Cd2+ and As3+ (Sens et al., 2004
|
Urothelial Cell Expression of MT-1 and -2 mRNAs and Protein
Real-time PCR was used to determine the levels of expression of the MT-1E, MT-1X, and MT-2 mRNAs relative to that of the G3PDH housekeeping gene in total RNA preparations from three samples of normal human bladder tissue. The mRNA expression level of the MT-1E gene was found to be 1.29 ± 0.68 transcripts, that of the MT-1X gene 0.21 ± 0.09 transcripts, and that of the MT-2A gene 0.15 ± 0.06 transcripts.
The expression of the MT-1E, MT-1X, and MT-2A mRNAs and the MT-1/2 protein levels was also determined for the parental UROtsa cells and for the cells after malignant transformation with Cd2+ and As3+. The determinations were performed on cells under the following conditions: the parental UROtsa cell line grown on serum-containing and serum-free growth medium; the UROtsa cells that had been exposed to either 1µM Cd2+ or 1µM As3+ continuously during the time course that resulted in the ability of the cells to proliferate in soft agar and form tumors in nude mice; and UROtsa cells that were known to be capable of tumor formation that had not been exposed to either Cd2+ or As3+ for an additional five passages at a 1:20 split ratio. The level of the MT-1/2 protein in the parental UROtsa cells was 1.6 ± 0.2 and 1.3 ± 0.2 for cells grown in serum-free and serum-containing medium, respectively (Fig. 3A).
|
The level of MT-1/2 protein in Cd2+-transformed UROtsa cells grown in the continued presence of 1µM Cd2+ was significantly increased compared to both parental cells and Cd2+-transformed cells passaged in the absence of Cd2+ (Fig. 3A).
The level of MT-1E mRNA in parental UROtsa cells was between 0.25 and 0.50 transcripts per number of G3PDH regardless of growth medium composition (Fig. 3B). There was no significant difference in MT-1E mRNA level compared to control for Cd2+-transformed UROtsa cells maintained in serum-containing growth medium in the presence or absence of Cd2+. This was also true for Cd2+-transformed cells in serum-free growth medium maintained in the absence of Cd2+. There was a significant increase in MT-1E mRNA level for Cd2+-transformed cells grown in serum-free medium in the continued presence of Cd2+ when compared to parental cells or the other Cd2+-transformed cells. The level of MT-1X mRNA in parental UROtsa cells was approximately 0.03 transcripts per G3PDH regardless of growth medium composition (Fig. 3C). The level of MT-1X mRNA was elevated compared to control in all four groups of Cd2+-transformed cells (Fig. 3C). In addition, the Cd2+-transformed cells grown on serum-free medium in the presence of Cd2+ also had significantly elevated levels of MT-1X mRNA compared to all other groups of Cd2+-transformed cells. The level of MT-2A mRNA in parental UROtsa cells was approximately 0.05 transcripts per G3PDH regardless of growth medium composition (Fig. 3D). There was no difference in the expression of MT-2A mRNA compared to control for Cd2+-transformed UROtsa cells grown in the absence of Cd2+ in both serum-containing and serum-free growth media. In contrast, there was a significant increase in the expression of MT-2A mRNA compared to control for Cd2+-transformed UROtsa cells grown in the presence of Cd2+ in both serum-containing and serum-free growth media.
The UROtsa cells that were transformed by As3+ in serum-free medium and grown in the absence of As3+ for five passages had significantly increased levels of MT-1/2 protein compared to both parental cell lines and all other UROtsa cell lines transformed by As3+ (Fig. 3A). All other As3+-transformed cell lines had MT-1/2 protein levels similar to those found in parental cells.
There was no significant difference in MT-1E mRNA levels compared to control for As3+-transformed UROtsa cells maintained in serum-containing growth medium in the presence or absence of As3+ (Fig. 3B). This was also true for As3+-transformed cells in serum-free growth medium maintained in the absence of As3+. There was a significant increase in MT-1E mRNA level for As3+-transformed cells grown in serum-free medium in the continued presence of As3+ when compared to parental cells or the other As3+-transformed cells. The level of MT-1X mRNA was significantly elevated for UROtsa cells transformed by As3+ in serum-free medium and grown in the continued presence of As3+ when compared to parental cells or other As3+-transformed cell lines (Fig. 3C). The other As3+-transformed cell lines had MT-1X mRNA levels similar to those found in parental cells. There was no significant difference in the level of expression of MT-2A mRNA for As3+-transformed cell lines when compared to parental cells or to one another (Fig. 3D).
Expression of MT-1 and -2 mRNAs and Protein in Tumor Heterotransplants
The expression of the MT-1E, MT-1X, and MT-2A mRNAs and the MT-1/2 protein levels was also determined on tumor heterotransplants that formed following the injection of the UROtsa cells that were malignantly transformed with Cd2+ and As3+ (Table 3). The tumors that resulted from UROtsa cells that were grown and transformed by Cd2+ in serum-containing medium were shown to express levels of MT-1/2 protein that were significantly higher than those generated from UROtsa cells grown and transformed by Cd2+ in serum-free growth medium (Table 3). A similar finding was found for the tumor heterotransplants formed from As3+-transformed cells, with cells transformed in serum-containing growth medium having a significant elevation of MT-1/2 protein levels (Table 3). There was no significant difference between the MT-1/2 protein levels in tumors that arose from UROtsa cells grown and transformed by Cd2+ and As3+ in serum-containing growth medium. The same was true for MT-1/2 protein levels in tumors arising from UROtsa cells grown and transformed by Cd2+ and As3+ in serum-free growth medium (Table 3).
|
All the tumor heterotransplants were shown to express MT-2A, MT-1E, and MT-1X mRNAs (Table 3). There was no significant difference in the expression of MT-2A and MT-1X mRNAs among any of the four sets of tumor heterotransplants. The expression of MT-1E mRNA was similar among three of the four sets of tumor heterotransplants, with only the tumors derived from UROtsa cells grown and transformed by Cd2+ in serum-free growth medium having significantly increased levels of expression (Table 3).
| DISCUSSION |
|---|
|
|
|---|
The overall goal of this study was to determine if the expression of the MT-1/2 protein might serve as a biomarker for the development of bladder cancer. This expectation was based on several factors. There is an extensive literature that defines the role of the MT-1 and -2 isoforms as mediators of environmental insult (Andrews, 2000
The results of the present study provide strong evidence that the expression of the MT-1/2 protein is not a biomarker for the development of bladder cancer. In the present analysis, 137 independent archival specimens of human bladder were examined for the expression of the MT-1/2 proteins by staining with the E-9 antibody, and no urothelial cells were found to be immunoreactive for the MT-1/2 protein. These archival specimens were obtained from suspected bladder cancer patients, and at least some would be expected to express MT-1/2, if expression was to be a biomarker for cancer development. This was further reinforced by the finding that none of the 58 cases of low-grade bladder cancer expressed MT-1/2 protein. Similarly, only one of 13 dysplastic lesions, two of 14 cases of CIS, and five of 56 cases of noninvasive high-grade bladder cancers were found to stain for the MT-1/2 protein. The results of the present study also reinforced the findings of earlier studies that indicated a limited occurrence of MT-1/2 staining in bladder cancer and, when present, focal in staining (Ioachim et al., 2001
; Siu et al., 1998
; Somji et al., 2001
). This is in contrast to other earlier studies that reported that a majority of human bladder tumors are immunoreactive for MT-1/2 (Bahnson et al., 1991
, 1994
; Katoh et al., 1994
; Lynn et al., 2003
). The present studies also reinforce the earlier observations that indicated no staining for MT-1/2 in normal or benign human bladder (Ioachim et al., 2001
; Siu et al., 1998
; Somji et al., 2001
). Thus, the present study shows that MT-1/2 protein expression is not increased during the early development of bladder cancer; therefore, MT-1/2 expression would not be a candidate biomarker indicating the development of bladder cancer.
In contrast, the present study does suggest that the increased expression of MT-1/2 protein might be a candidate as a prognostic marker associated with disease progression in late stages of bladder cancer. This is based on the finding that 20 of 65 (30.7%) high-grade tumors with invasion of the underlying muscle stained positive for MT-1/2 protein. This is in contrast to MT-1/2 staining in only five of 56 (8.9%) high-grade tumors showing no evidence of invasion into the underlying muscle. The conclusion from this observation is that there is a significant association of MT-1/2 staining with bladder cancers that invade the underlying muscle. An analysis of the patient outcome associated with these specimens is underway to determine if MT-1/2 staining correlates with this important prognostic parameter. From these data, the next logical question one would like to address is if metastatic lesions arising from these or related bladder cancers overexpress the MT-1/2 protein. Unfortunately, such samples for this type of analysis are extremely rare. This is due to the fact that surgical resection of metastatic sites is rare, and thus, specimens for analysis are unavailable for study. It is also rare that tissue is available postmortem due to the low rate of such examinations on cancer patients. Thus, within the limitations imposed by the use of human samples, the staining of MT-1/2 appears to be a marker associated with bladder cancers that are invading the underlying muscle.
The analysis of the tumor heterotransplants produced by injection of UROtsa cells malignantly transformed with either Cd2+ or As3+ should compliment and extend the above findings that employ human specimens. The initial characterization of these subcutaneous heterotransplants showed tumor histology consistent with that of human transitional cell carcinoma (Sens et al., 2004
). The analysis of MT-1/2 expression in these heterotransplants was consistent with the findings noted in human bladder cancer. Similar to patient specimens, the staining of MT-1/2 in each of the heterotransplants was focal in nature with areas of negative, weak, moderate, and strong staining of MT-1/2. Additionally, the analysis of the staining in the heterotransplants showed that MT-1/2 staining was localized to cells in the undifferentiated areas of the tumors, with reduced or no expression in areas containing more differentiated cells. The association of MT-1/2 staining with undifferentiated tumor cells would be consistent with staining being associated with more aggressive areas of a tumor. The tumor heterotransplants were all also shown to express MT-1/2 protein by immunoblot and MT-1E, MT-1X, and MT-2A mRNAs using real-time PCR. The findings with the subcutaneous heterotransplants suggest that cell lines could be isolated from these tumors that do and do not express the MT-1/2 protein. It would then be possible to inject such tumors through the tail vein and left ventricle of nude mice to determine the metastatic potential and subsequent expression of MT-1/2. Similarly, the original transformed cell cultures can also be injected to determine if metastatic colonies express the MT-1/2 protein. Implantations under the renal capsule and in the bladder are related methods to study the differentiation, invasion, and spread of the tumor cells as it relates to the expression of MT-1/2. Such studies will also provide additional information on the characteristics of urothelial cells malignantly transformed by two major environmental toxicants. Thus, the heterotransplants should provide a means to compliment the human analysis that suggests a possible role of MT-1/2 expression in bladder cancer invasion and metastasis.
An unexpected observation in the present study was that some stromal cells stained positive for the MT-1/2 protein in the human archival specimens. Instances of stromal staining for MT-1/2 were the most frequent in high-grade tumors that had invaded the underlying matrix of the bladder. However, all tumor classes as well as benign lesions showed some specimens with staining of stromal cells. In benign lesions these were associated predominantly with areas of necrosis or inflammation, possibly suggesting a response associated with wound healing. In the tumor specimens, the majority of the MT-1/2positive stromal cells were found in areas of the tumor where new stroma had formed in association with the tumor cells and not in established areas of the underlying matrix of the bladder wall. The formation of new stroma at sites of active tumor invasion is a common event in human malignancy and the term "stromatogenesis" has been used to describe this process (Sivridis et al., 2004
, 2005
). What is new in the present study is that these stromal cells, or a subset thereof, can be identified through their immunoreactivity for MT-1/2. To the author's knowledge, the increased association of new stroma with invading bladder cancer is also a new observation for this disease. Stromal staining for MT-1/2 was also noted in association with the tumors formed by injection of the Cd2+- and As3+-transformed tumor cells subcutaneously in the nude mice. This would indicate that the heterotransplanted cells stimulate the recruitment of mouse stromal cells that express the MT-1/2 protein to the site of tumor growth.
A question that cannot be answered by this study is if the increased MT-1/2 staining has any causal relationship with invasion of the underlying stroma and/or metastasis. The role of MT-1/2 as a major zinc-binding protein, whose overexpression might perturb cellular zinc status, would certainly provide an opportunity for its indirect participation in many processes associated with tumor invasion and metastasis. For example, the metalloproteinases are zinc-dependent endopeptidases collectively capable of degrading essentially all components of the extracellular matrix (Vihinen and Kahari, 2002
). However, the zinc proteome is extensive, with genes encoding only zinc finger domains exceeding 3% of the identified human genes (Clarke and Berg, 1998
; Maret, 2001
). The combination of comparing archival human specimens with a cell culturebased model that retains in situ properties and is capable of heterotransplantation should provide a platform to study the role of zinc and MT in tumor invasion and metastasis.
| ACKNOWLEDGMENTS |
|---|
The project described was supported by grant number R01 CA/ES94997 from the National Cancer Institute (NCI), National Institutes of Health (NIH). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NCI and National Institute of Environmental Health Sciences (NIEHS), NIH. Support to S.S. was also provided by the School of Medicine and Health Sciences Seed Grant Program.
| REFERENCES |
|---|
|
|
|---|
Andrews, G. K. (2000). Regulation of metallothionein gene expression by oxidative stress and metal ions. Biochem. Pharmacol. 59, 95104.[CrossRef][Web of Science][Medline]
Bahnson, R. R., Banner, B. F., Ernstoff, M. S., Lazo, J. S., Cherian, G. M., Banerjee, D., and Chin, J. L. (1991). Immunohistochemical localization of metallothionein in transitional cell carcinoma of the bladder. J. Urol. 146, 15181520.[Web of Science][Medline]
Bahnson, R. R., Becich, M., Ernstoff, M. S., Sandlow, J., Cohen, M. B., and Williams, R. D. (1994). Absence of immunohistochemical metallothionein staining in bladder tumor specimens predicts response to neoadjuvant cisplatin, methotrexate and vinblastine chemotherapy. J. Urol. 152, 22722275.[Web of Science][Medline]
Clarke, N. D., and Berg, J. M. (1998). Zinc fingers in Caenorhabditis elegans: Finding families and probing pathways. Science 282, 20182022.
Clavel, J., Cordier, S., Boccon-Gibod, L., and Hemon, D. (1989). Tobacco and bladder cancer in males: Increased risk for inhalers and smokers of black tobacco. Int. J. Cancer 44, 605610.[Web of Science][Medline]
Cousins, R. J. (1983). MetallothioneinAspects related to copper and zinc metabolism. J. Inherit. Metab. Dis. 6, 1521.
Epstein, J. I., Amin, M. B., Reuter, V. R., and Mostofi, F. K. (1998). The World Health Organization, International Society of Urologic Pathology consensus classification of urothelial (transitional cell) neoplasms of the urinary bladder. Bladder Consensus Conference Committee. Am. J. Surg. Pathol. 12, 14351438.
Garrett, S. H., Somji, S., Todd, J. H., and Sens, D. A. (1998). Exposure of human proximal tubule cells to Cd+2, Zn+2, and Cu+2 induces metallothionein protein accumulation, but not metallothionein isoform 2 mRNA. Environ. Health Perspect. 106, 587595.[Web of Science][Medline]
Goering, P. L., and Klaassen, C. D. (1983). Altered subcellular distribution of cadmium following cadmium pretreatment: Possible mechanism of tolerance to cadmium-induced lethality. Toxicol. Appl. Pharmacol. 70, 195203.[CrossRef][Web of Science][Medline]
Hamer, D. H. (1986). Metallothionein. Annu. Rev. Biochem. 55, 913951.[Web of Science][Medline]
Ioachim, E. E., Charchanti, A. V., Stavropoulos, N. E., Athanassiou, E. D., Michael, M. C., and Agnantis, N. J. (2001). Localization of metallothionein in urothelial carcinoma of the human urinary bladder: An immunohistochemical study including correlation with HLA-DR antigen, p53, and proliferation indices. Anticancer Res. 21, 17571762.[Web of Science][Medline]
Kägi, J. H. R. (1993). Evolution, structure and chemical activity of class I metallothioneins: An overview. In Metallothionein III. Biological Roles and Medical Implications (K. T. Suzuki, N. Imura, and M. Kimura, Eds.), pp. 2956. Birkhauser Verlag, Berlin.
Kägi, J. H. R., and Hunziker, P. (1989). Mammalian metallothionein. Biol. Trace Elem. Res. 21, 111118.[Web of Science][Medline]
Katoh, S., Naito, S., Sakamoto, N., Goto, K., and Kumazawa, J. (1994). Metallothionein expression is correlated with cisplatin resistance in transitional cell carcinoma of the urinary tract. J. Urol. 152, 12671270.[Web of Science][Medline]
Lynn, N. N. K., Howe, M. C., Hale, R. J., Collins, G. N., and O'Reilly, P. H. (2003). Over expression of metallothionein predicts resistance of transitional cell carcinoma of bladder to intravesical mitomycin therapy. J. Urol. 169, 721723.[CrossRef][Web of Science][Medline]
Maret, W. (2001). Zinc biochemistry, physiology, and homeostasisRecent insights and current trends. Biometals 14, 187190.
Mididoddi, S., McGuirt, J. P., Sens, M. A., Todd, J. H., and Sens, D. A. (1996). Isoform-specific expression of metallothionein mRNA in the developing and adult human kidney. Toxicol. Lett. 85, 1727.[CrossRef][Web of Science][Medline]
Morrison, A. S., Buring, J. E., Verhoeck, W. G., Aoki, K., Leck, I., Ohno, Y., and Obata, K. (1984). An international study of smoking and bladder cancer. J. Urol. 131, 650654.[Web of Science][Medline]
Rehn, L. (1895). Blasengeschwulte bei fuchsin-arbeitern. Arch. Klin. Chir. 50, 588.
Rossi, M. R., Masters, J. R. W., Park, S., Todd, J. H., Garrett, S. H., Sens, M. A., Somji, S., Nath, J., and Sens, D. A. (2001). The immortalized UROtsa cell line as a potential cell culture model of human urothelium. Environ. Health Perspect. 109, 801808.[Web of Science][Medline]
Sens, D. A., Park, S., Gurel, V., Sens, M. A., Garrett, S. H., and Somji, S. (2004). Inorganic cadmium- and arsenite-induced malignant transformation of human bladder urothelial cells. Toxicol. Sci. 79, 5663.
Siemiatycki, J., Dewar, R., Nadon, L., and Gerin, M. (1994). Occupational risk factors for bladder cancer: Results from a case control study in Montreal, Quebec, Canada. Am. J. Epidemiol. 140, 10611080.
Siu, L. L., Banerjee, D., Khurana, R. J., Pan, X., Pflueger, R., Tannock, I. F., and Moore, M. J. (1998). The prognostic role of p53, metallothionein, P-glycoprotein, and MIB-1 in muscle-invasive urothelial transitional cell carcinoma. Clin. Cancer Res. 4, 559565.[Abstract]
Sivridis, E., Giatromanolaki, A., and Koukourakis, M. I. (2004). "Stromatogenesis" and tumor progression. Int. J. Surg. Pathol. 12, 19.
Sivridis, E., Giatromanolaki, A., and Koukourakis, M. I. (2005). Proliferating fibroblasts at the invading tumor edge of colorectal adenocarcinomas are associated with endogenous markers of hypoxia, acidity, and oxidative stress. J. Clin. Pathol. 58, 10331038.
Somji, S., Sens, M. A., Lamm, D. L., Garrett, S. H., and Sens, D. A. (2001). Metallothionein isoform 1 and 2 gene expression in the human bladder: Evidence for up-regulation of MT-1X mRNA in bladder cancer. Cancer Detect. Prev. 25, 6275.[Web of Science][Medline]
Steinmaus, C., Moore, L., Hopenhayn-Rich, C., Biggs, M. L., and Smith, A. H. (2000). Arsenic in drinking water and bladder cancer. Cancer Investig. 18, 174182.[Web of Science][Medline]
Vihinen, P., and Kahari, V.-M. (2002). Matrix metalloproteinases in cancer: Prognostic markers and therapeutic targets. Int. J. Cancer 99, 157166.[CrossRef][Web of Science][Medline]
Waalkes, M. P. (2000). Cadmium carcinogenesis in review. J. Inorg. Biochem. 79, 241244.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Hester, Z Drobna, D. Andrews, J Liu, M. Waalkes, D. Thomas, and M Styblo Expression of AS3MT alters transcriptional profiles in human urothelial cells exposed to arsenite Human and Experimental Toxicology, January 1, 2009; 28(1): 49 - 61. [Abstract] [PDF] |
||||
![]() |
S. Somji, X. D. Zhou, S. H. Garrett, M. A. Sens, and D. A. Sens Urothelial Cells Malignantly Transformed by Exposure to Cadmium (Cd+2) and Arsenite (As+3) Have Increased Resistance to Cd+2 and As+3-Induced Cell Death Toxicol. Sci., December 1, 2006; 94(2): 293 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. D. Zhou, M. A. Sens, S. H. Garrett, S. Somji, S. Park, V. Gurel, and D. A. Sens Enhanced Expression of Metallothionein Isoform 3 Protein in Tumor Heterotransplants Derived from As+3- and Cd+2-Transformed Human Urothelial Cells Toxicol. Sci., October 1, 2006; 93(2): 322 - 330. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




