Skip Navigation


ToxSci Advance Access originally published online on July 19, 2006
Toxicological Sciences 2006 93(2):322-330; doi:10.1093/toxsci/kfl065
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
93/2/322    most recent
kfl065v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zhou, X. D.
Right arrow Articles by Sens, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, X. D.
Right arrow Articles by Sens, D. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Enhanced Expression of Metallothionein Isoform 3 Protein in Tumor Heterotransplants Derived from As+3- and Cd+2-Transformed Human Urothelial Cells

Xu Dong Zhou, Mary Ann Sens, Scott H. Garrett, Seema Somji, Seongmi Park, Volkan Gurel and Donald A. Sens1

Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, North Dakota 58202

1 To whom correspondence should be addressed at Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, 501 North Columbia Road, Grand Forks, ND 58202. Fax: (701) 777-3108. E-mail: dsens{at}medicine.nodak.edu.

Received June 5, 2006; accepted July 14, 2006


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This laboratory has proposed that the third isoform of the metallothionein gene family (MT-3) might be a biomarker for the development of human bladder cancer. Immunohistochemical staining of MT-3 on archival diagnostic specimens showed that only 2 of 63 (3.17%) benign bladder specimens had even weak reactivity for the MT-3 protein. In contrast, 103 of 107 (96.26%) high-grade urothelial cancers and 17 of 17 (100%) specimens of carcinoma in situ stained positive for the MT-3 protein. For low-grade bladder cancer it was shown that 30 of 48 specimens (62.5%) expressed the MT-3 protein. Using a cell culture model (UROtsa), it was demonstrated that expression of the MT-3 protein was not required for malignant transformation of urothelial cells by either Cd+2 or As+3. In contrast, it was shown that the cells transformed by Cd+2 and As+3 that did not express the MT-3 gene in cell culture, gained expression of MT-3 when grown as heterotransplants in nude mice. The gain in MT-3 expression when cells were grown as heterotransplants was also shown to occur for the MCF-7, T-47D, Hs 578t, MDA-MB-231 breast cancer, and the PC-3 prostate cancer cell lines. An analysis of MT-3 mRNA and protein expression suggested that a posttranscriptional mechanism was responsible for accumulation of the MT-3 protein. The results provide strong evidence that MT-3 could be a biomarker for the development of high-grade bladder cancer and that the expression of the MT-3 gene is not involved in the in vitro malignant transformation of UROtsa cells by Cd+2 and As+3.

Key Words: metallothionein, biomarker; bladder cancer; cadmium; arsenic; transformation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bladder cancer is the first cancer in which industrial exposure was shown to be the major factor in disease causation. This laboratory has proposed that the third isoform of the metallothionein gene family (MT-3) might be a biomarker for the development of human bladder cancer (Sens et al., 2000Go). A retrospective immunohistochemical analysis of MT-3 expression was performed on a modest sample set of archival paraffin-embedded diagnostic specimens composed of benign and cancerous lesions of the bladder. The cells of the normal bladder were shown to have no immunoreactivity for the MT-3 protein. In contrast, all specimens of bladder cancer were immunoreactive for the MT-3 protein and the intensity of staining correlated to tumor grade. An analysis of MT-3 messenger RNA (mRNA) and protein was also performed on samples obtained from surgically removed normal bladder tissue. Immunoblot analysis failed to detect MT-3 protein. The analysis of MT-3 mRNA expression by reverse transcriptase–PCR (RT-PCR) at an input of 500 ng total RNA and 40 reaction cycles showed no reaction product. These findings were in agreement with the negative immunostaining found using benign paraffin-embedded bladder tissue and it was concluded that the normal bladder expressed minimal, if any, MT-3 mRNA and protein. The goal of the present study was to confirm and extend these observations to a larger sample set divided on the diagnostic criteria of benign, dysplastic, low-grade carcinoma, and high-grade carcinoma of the bladder.

A second goal of this study was to link the expression of MT-3 in bladder cancer with exposure to specific environmental agents. Toward this goal, the laboratory has employed a cell culture of human urothelium (UROtsa) that was immortalized using the SV40 large T-antigen (Petzoldt et al., 1994Go, 1995Go). The UROtsa cells retain a normal cytogenetic profile, grow as a contact inhibited monolayer, and possess an undifferentiated morphology consistent with basal epithelial cells. They are not tumorigenic as judged by the inability to form colonies in soft agar and tumors in nude mice. The UROtsa cells were also adapted to grow in a serum-free growth medium (Rossi et al., 2001Go). Under serum-free conditions, the cells have enhanced differentiation, displaying a stratified morphology consistent with the structural features associated with the intermediate layers of the urothelium. The cells grown in serum-free medium retained the properties of immortality, contact inhibition, and nontumorigenicity. Identical to that of normal urothelium, the UROtsa cells were shown to have no basal expression of MT-3 mRNA or protein. This laboratory has recently shown that exposure to either Cd+2 or As+3 can directly cause malignant transformation of the cells (Sens et al., 2004Go). The tumor heterotransplants produced by the Cd+2- and As+3-transformed cells had histologic features consistent with human transitional cell carcinoma of the bladder. In the present study, the Cd+2- and As+3-transformed UROtsa cell lines and the resulting tumor heterotransplants were characterized for their expression of MT-3 mRNA and protein. The expression of MT-3 mRNA and protein was also determined in tumor heterotransplants generated from breast cancer (MCF-7, T-47D, Hs 578t, MDA-MB-231) and prostate cancer (PC-3) cell lines.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bladder specimens for the retrospective immunohistochemical analysis of MT-3 expression.
Tissue sections for the immunohistochemical analysis of MT-3 expression in the human bladder were obtained from archival paraffin blocks that originated from previously completed patient diagnostic procedures. The immunohistochemical expression of MT-3 was determined on tissue sections from 241 patients referred for diagnosis of possible transitional cell carcinoma of bladder. For analysis of MT-3 expression, these specimens were subdivided into five categories; benign, dysplastic, low-grade urothelial cancer, high-grade urothelial cancer, and carcinoma in situ (CIS). The classification of benign was that of benign urothelium without neoplastic lesions in the surgical specimen and no report of ulcerating or papillary lesions grossly visible on cystoscopy. The majority of the specimens were from patients with a previous diagnosis of low-grade papillary urothelial carcinomas who were undergoing surveillance cystoscopy. This category included diagnostic samples with varying degrees of chronic inflammation, cystitis glandularis, and granulomatous Bacillus Calmette-Guerin (BCG) cystitis. The benign category also included specimens from patients without a previous diagnosis of urothelial carcinoma with a diagnosis of chronic cystitis. No specimens were from patients diagnosed with interstitial cystitis. The classification of "low grade" included all low-grade papillary neoplasms including papillomas, papillary lesions of low malignant potential and low-grade papillary carcinomas. The 17 cases of CIS specimens were all primary lesions. Grading of the urothelial lesions was performed on hematoxylin and eosin (H&E)–stained tissue sections and utilized the World Health Organization/International Society of Urological Pathology consensus conference classification (Epstein et al., 1998Go).

Cell culture.
Stock cultures of the UROtsa cell lines malignantly transformed with either 1µM Cd+2 or As+3 were maintained in 75-cm2 tissue culture flasks in either serum or serum-free growth medium as described previously (Sens et al., 2004Go). Briefly, the serum-containing growth medium was Dulbecco modified Eagles medium (DMEM) containing 5% vol/vol fetal calf serum. The serum-free growth medium was composed of a 1:1 mixture of DMEM and Ham's F-12 supplemented with selenium (5 ng/ml), insulin (5 µg/ml), transferrin (5 µg/ml), hydrocortisone (36 ng/ml), triiodothyronine (4 pg/ml), and epidermal growth factor (10 ng/ml). When confluent, the cells were subcultured at a 1:20 ratio using trypsin-ethylenediaminetetraacetic acid (EDTA). The MCF-7, T-47D, Hs 578t, and MDA-MB-231 breast cancer cell lines were obtained from the American Type Culture Collection (Rockville, MD), grown in DMEM supplemented with 5% (vol/vol) fetal calf serum, and routinely passaged at a 1:4 ratio upon attaining confluence as described previously (Friedline et al., 1998Go; Gurel et al., 2003Go). The PC-3 prostate cancer cell line was obtained from the American Type Culture Collection, grown in DMEM supplemented with 10% (vol/vol) fetal calf serum, and routinely passaged at a 1:4 ratio upon attaining confluence as described previously (Dutta et al., 2002Go; Garrett et al., 1999aGo). Cultures were incubated at 37°C in a 5% CO2:95% air atmosphere and fed fresh growth medium every 3 days.

Tumor heterotransplants.
Tumor heterotransplants of the MCF-7, T-47D, Hs 578t, MDA-MB-231, and PC-3 cell lines were prepared by inoculating 1 x 106 cells subcutaneously in the dorsal thoracic midline of nude (NCr-nu/nu) mice as described previously for Cd+2- and As+3-transformed UROtsa cell lines (Sens et al., 2004Go). Eight nude mice were utilized for each cell line. The production of nude mouse heterotransplants from the Cd+2- and As+3-transformed UROtsa cell lines has been previously described (Sens et al., 2004Go) and tissues taken from these tumors were utilized in the present study to determine the expression of MT-3 mRNA and protein.

Immunostaining for MT-3 in human diagnostic specimens and tumor heterotransplants.
Archival bladder specimens and tissue from tumor heterotransplants were routinely fixed in 10% neutral buffered formalin for 16–18 h. All tissues were transferred to 70% ethanol and dehydrated in 100% ethanol. Dehydrated tissues were cleared in xylene, infiltrated, and embedded in paraffin. Serial sections were cut at 3–5 µm for use in immunohistochemical protocols. Prior to immunostaining, sections were immersed in preheated Target Retrieval Solution (Dako, Carpinteria, CA) and heated in a steamer for 20 min. The sections were allowed to cool to room temperature and immersed into Tris-buffered saline with Tween 20 for 5 min. The immunostaining was performed on a Dako autostainer universal staining system. A primary anti-rabbit MT-3 antibody generated and characterized by this laboratory was used to localize MT-3 protein expression (Garrett et al., 1999bGo). The primary antibody was localized using the Dakocytomation Peroxidase conjugated EnVisionTM Dual link system. Liquid diaminobenzidine was used for visualization (Dakocytomation liquid Diaminobenzidine substrate chromogen system). Slides were rinsed in distilled water, dehydrated in graded ethanol, cleared in xylene, and coverslipped. The presence and degree of MT-3 immunoreactivity in the benign specimens was judged by two pathologists and that in malignant specimens by one pathologist.

Real-time analysis of MT-3 isoform mRNA expression.
The measurement of MT-3 mRNA expression was assessed with real-time RT-PCR utilizing a previously described MT-3 isoform-specific primer (Somji et al., 2005Go). Total RNA was purified from cells and tumor heterotransplant tissues using TRI REAGENTTM (Molecular Research Center, Inc., Cincinnati, OH) and 1 µg was subjected to complementary DNA (cDNA) synthesis using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) in a total volume of 20 µl. Real-time PCR was performed utilizing the SYBR Green kit (Bio-Rad Laboratories) with 2 µl of cDNA, 0.2 µM primers in a total volume of 20 µl in an iCycler iQ real-time detection system (Bio-Rad Laboratories). Amplification was monitored by SYBR Green fluorescence and compared to that of a standard curve of the MT-3 isoform gene cloned into pcDNA3.1/hygro (+) and linearized with Fsp I. Cycling parameters consisted of denaturation at 95°C for 30 s and annealing at 65°C for 45 s which gave optimal amplification efficiency of each standard. The level of MT-3 expression was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) assessed by the same assay with the primer sequences being sense, TCCTCTGACTTCAACAGCGACAC and antisense, CACCCTGTTGCTGTAGCCAAATTC with a product size of 126 base pairs.

MT protein determination.
The immunoblot protocol used for the determination of the levels of MT-3 protein in cell lysates has been described previously by this laboratory (Garrett et al., 1999aGo).

Statistical analysis.
All cell culture experiments were performed in triplicate and the results are expressed as the standard error of the mean. Statistical analyses were performed using Systat software using separate variance t-tests, analysis of variance with Tukey post hoc testing. Unless otherwise stated, the level of significance was 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Immunoreactivity of MT-3 in Benign, Dysplastic and Malignant Human Urothelium
There were 241 archival patient specimens of potentially diseased urothelium available for the evaluation of MT-3 staining. Tissue sections from these samples were evaluated for MT-3 staining using an antibody dilution of 1:200. Of the 241 samples, 63 were classified as benign lesions, and of these, only two were weakly immunoreactive for the MT-3 protein (Table 1, Fig. 1A). The examination consisted of an evaluation of the entire specimen by two pathologists under low (x10) and high (x40) magnification to rule out the possibility of a very low instance of focal staining. In addition, 50 cases of these benign lesions were reexamined at an antibody dilution of 1:50 and no additional staining was found for the MT-3 protein within the urothelium. Of the six dysplastic lesions available for examination, none showed any staining for MT-3 (Table 1). The examination of 48 specimens classified as low-grade bladder cancer disclosed 18 cases to be negative, 20 to have weak staining for MT-3, and 10 cases to have strong staining for MT-3 (Table 1, Fig. 1B and 1C). The examination of 17 cases of CIS of the bladder showed staining for MT-3 in all cases, with staining being weak in four cases and strong in 13 cases (Table 1). The examination of 107 cases of high-grade bladder cancer showed only four cases to be negative, 32 cases to be weakly positive, and 71 cases to be strongly positive for MT-3 (Table 1). The high-grade tumors were subdivided into two classes, those that had invaded the underlying smooth muscle layer and those that had not invaded the smooth muscle layer (58 and 49 cases, respectively). There was no difference in the occurrence or intensity of MT-3 staining between the two diagnostic categories (Fig. 1D and 1E). In all instances of positive staining, MT-3 was distributed diffusely throughout the cytoplasm and there were no instances where MT-3 staining was localized to the nucleus. The increased incidence of MT-3 staining in bladder cancer was significant compared to the benign lesions.


View this table:
[in this window]
[in a new window]

 
TABLE 1 Immunohistochemical Staining of Mt3 in Archival Patient Specimens of Bladder

 

Figure 1
View larger version (194K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 1. MT-3 staining in specimens of human bladder. (A) The absence of MT-1/2 staining in normal urothelium (x200). (B) An example of weak staining in a low-grade papillary urothelial carcinoma (x100). (C) An example of strong MT-3 staining in a low-grade papillary urothelial carcinoma (x100). (D) An example of strong MT-3 staining in a high-grade, noninvasive urothelial carcinoma (x200). (E) An example of strong MT-3 staining in a high-grade, muscle-invasive urothelial carcinoma (x200). All specimens were counter stained with H&E.

 
UROtsa Cell Expression of MT-3 mRNA and Protein
The expressions of MT-3 mRNA and protein were determined for the parental UROtsa cells and for the cells after malignant transformation with Cd+2 and As+3. The parental UROtsa cells, grown on both serum-containing and serum-free growth medium, were shown previously to have no expression of either MT-3 mRNA or protein (Rossi et al., 2001Go). Since this previous study used relative RT-PCR to detect MT-3 mRNA, the analysis was repeated in the present study using real-time PCR. Using this more sensitive technique, the parental UROtsa cells were shown to express MT-3 mRNA, regardless of growth medium composition, at a level similar to that obtained using a no RNA input control (less than 1 x 10–4 transcript compared to the G3PDH housekeeping gene), confirming a very low or absent level of MT-3 mRNA expression (Table 2). An analysis of MT-3 protein also confirmed the earlier results that expression was below the detection limit of the assay (Table 2).


View this table:
[in this window]
[in a new window]

 
TABLE 2 Expression of Mt-3 in Cultured Cd+2- and As+3-Transformed UROtsa Cells

 
The levels of MT-3 mRNA and protein were determined on the UROtsa cells exposed to, and malignantly transformed by, 1µM Cd+2 and As+3 (Sens et al., 2004Go). In this study, four malignantly transformed cell lines were produced that were capable of generating tumor heterotransplants in nude mice: URO-ASSC for cells transformed with As+3 on serum-containing growth medium; URO-ASSF for cells transformed with As+3 on serum-free growth medium; URO-CDSC for cells transformed with Cd+2 on serum-containing growth medium; and, URO-CDSF for cells transformed with Cd+2 on serum-free growth medium. The UROtsa cells were malignantly transformed when grown on serum-free and serum-containing growth medium because it was previously shown that the growth medium influenced the degree of differentiation of the cells (Rossi et al., 2001Go). In the present study, the expression of MT-3 mRNA and protein was determined at three hallmark points of the transformation process. The first hallmark was an analysis of MT-3 mRNA and protein expression of the Cd+2 and As+3 exposed cells that regrew to confluency following the initial instance of cell toxicity and regrowth. This occurred between 30 and 48 days of exposure when approximately 95% of the cells in all four experimental groups died and detached from the growth surface. When the surviving cells in these cultures proliferated to confluency, subsequent subcultures were used for the analysis of MT-3 mRNA and protein. The second hallmark was an analysis of the cells that regrew to confluency following a second instance of cell toxicity. This occurred within 6–10 passages of the first instance of cell toxicity. This occurred in all four experimental groups after the initial instance of cell toxicity and was characterized by the very rapid regrowth of the cells to confluency. Subsequent subcultures were used for the analysis of MT-3 mRNA and protein. The third hallmark was an analysis of the cells following confirmation of growth in soft agar and immediately before successful heterotransplantation into the nude mice. These cultures were subcultured eight passages before testing in soft agar and injection into nude mice. At the time of injection, separate confluent cultures were used to prepare total RNA and protein lysates for the analysis of MT-3 mRNA and protein. The results of this analysis demonstrated that the level of MT-3 protein was below the limit of detection for Cd+2 and As+3 exposed UROtsa cells at all three hallmark time points of the transformation process regardless of growth medium composition (Table 2). The corresponding analysis of MT-3 mRNA demonstrated that there was a low, but measurable, level of MT-3 mRNA expression for the Cd+2 and As+3 exposed UROtsa cells at all three hallmark time points of the transformation process (Table 2). The values of MT-3 mRNA expression were near the limit of detection and varied between 1 and 9 x 10–3 transcripts when normalized to the expression of the housekeeping gene, G3PDH. While this low level of MT-3 mRNA expression was significantly elevated over the background level in control cells (1 x 10–4 transcripts), there was no significant difference in expression among or between the Cd+2- and As+3-treated UROtsa cell lines. Thus, exposure of the UROtsa cells to Cd+2 or As+3 did result in a small, but measurable elevation of MT-3 mRNA when compared to the parental cell culture controls, but MT-3 protein remained below the level of detection.

Expression of MT-3 in Tumors Derived from Heterotransplanted As+3- and Cd+2-Transformed UROtsa Cells
In the above-referenced study, tumor heterotransplants were generated from the immortalized urothelial cell lines (UROtsa) that had been transformed by exposure to Cd+2 and As+3 (Sens et al., 2004Go). As described above, four malignantly transformed cell lines were isolated that were capable of generating tumor heterotransplants in nude mice: URO-ASSC, URO-ASSF, URO-CDSC, and URO-CDSF. This previous study detailed the histology of the respective heterotransplants generated from these four cell lines, and tissue sections from these tissue blocks were used in the present study to determine the immunostaining of the MT-3 protein. The results showed that the tumors derived from all four cell lines displayed strong staining for MT-3. There was unquestionable strong staining for MT-3 in the Cd+2-transformed UROtsa cells that were transformed on both serum-containing (CDSC, Fig. 2A) and serum-free growth media (CDSF, Fig. 2B). The same was true for As+3-transformed UROtsa cells that were transformed on both serum-containing (ASSC, Fig. 2C) and serum-free growth media (ASSF, Fig. 2D). Multiple tumors generated from each transformation protocol were also examined for MT-3 staining (Table 3). These studies showed that there was some heterogeneity in MT-3 staining, but all tumor heterotransplants contained a majority of cells that were strongly immunoreactive for MT-3. The number of MT-3 positive cells was estimated to vary between 60 and 90% depending on the tumor examined and on the independent slides examined from each individual tumor (Table 3). The majority of tumors, and sections from each tumor, showed staining of MT-3 in over 80% of the tumor cells. However, while the MT-3-positive cells stained intensely for MT-3, all tumors contained a low, but readily visible number of cells that did not stain for MT-3. The analysis of MT-3 protein expression in tumor lysates showed an expression level of between 3.1 and 3.9 ng MT-3/µg total protein (Table 3). An analysis of MT-3 mRNA in total RNA preparations from each set of tumors showed a low level of expression which varied considerably within each set of tumors, but was elevated in expression over that found in the cell lines used to generate the tumor heterotransplants (Table 3). Because of the high variability of expression within each individual set of tumors, there were no significant differences in MT-3 mRNA expression between the four groups of tumor heterotransplants.


Figure 2
View larger version (163K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 2. MT-3 Staining in UROtsa cell tumor heterotransplants. (A) MT-3 staining of tumor cells in a heterotransplant resulting from the injection of UROtsa cells transformed by Cd+2 in a serum-containing growth medium. (B) MT-3 staining of tumor cells in a heterotransplant resulting from the injection of UROtsa cells transformed by Cd+2 in a serum-free growth medium. (C) MT-3 staining of tumor cells in a heterotransplant resulting from the injection of UROtsa cells transformed by As+3 in a serum-containing growth medium. (D) MT-3 staining of tumor cells in a heterotransplant resulting from the injection of UROtsa cells transformed by As+3 in a serum-free growth medium. Magnifications are x200 and all specimens were counter stained with H&E.

 

View this table:
[in this window]
[in a new window]

 
TABLE 3 MT-3 Expression in Tumor Heterotransplants

 
Immunoreactivity of MT-3 in Tumors Derived from Heterotransplanted Breast and Prostate Cancer Cell Lines
Tumor heterotransplants were generated from the MCF-7, T-47D, Hs 578t, MDA-MB-231 breast cancer cell lines, and PC-3 prostate cancer cell line. Previous studies from this laboratory demonstrated that these cells had no detectable MT-3 protein and that MT-3 mRNA was below the level of detection when RT-PCR was performed at 500 ng total RNA inputs and 40 reaction cycles (Dutta et al., 2002Go; Gurel et al., 2003Go). Tissue sections from these formalin fixed, paraffin-embedded specimens were used to determine the immunostaining of the MT-3 protein. At a primary antibody dilution of 1:50, tissue sections from all the independent tumors generated from the five heterotransplanted cell lines showed moderate immunoreactivity for the MT-3 protein (Fig. 3A–E). The staining for MT-3 was diffuse and localized to the cytoplasm in all five of the different tumor heterotransplants. The staining was uniform among the tumors and there were no areas within the tumors where tumor cells were not reactive for the MT-3 protein. There was no nuclear staining in any of the tumors. An analysis of MT-3 mRNA and protein from each set of tumors showed levels that were similar to the levels found in the UROtsa cell tumor heterotransplants (data not shown). The levels of MT-3 mRNA were low and highly variable in each set of tumors and the levels of MT-3 protein were between 1 and 2 ng MT-3/µg total protein for each set of tumor heterotransplants. There was no significant difference in the level of MT-3 mRNA or protein among the five tumor heterotransplants.


Figure 3
View larger version (175K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 3. MT-3 staining in tumor heterotransplants generated from breast and prostate cancer cell lines. (A) MT-3 staining of tumor cells in a heterotransplant generated by injection of T47D breast cancer cells. (B) MT-3 staining of tumor cells in a heterotransplant generated by injection of MCF-7 breast cancer cells. (C) MT-3 staining of tumor cells in a heterotransplant generated by injection of MDA-MB-231 breast cancer cells. (D) MT-3 staining of tumor cells in a heterotransplant generated by injection of Hs 578t breast cancer cells. (E) MT-3 staining of tumor cells in a heterotransplant generated by injection of PC-3 prostate cancer cells. Magnifications are x200 and all specimens were counterstained with H&E.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This laboratory has previously shown using a limited sample set that the MT-3 protein was not expressed in normal human urothelium, but was overexpressed in bladder cancer (Sens et al., 2000Go). The first goal of this study was to expand these initial observations and determine the extent of MT-3 overexpression in a larger set of human bladder cancers. An examination of 63 benign specimens originally submitted for the possible diagnosis of bladder cancer demonstrated that only two (3.17%) specimens stained weakly for the MT-3 protein. An examination of six dysplastic lesion showed that none stained for the MT-3 protein. The fact that the biopsies examined are not from symptomless controls, but were taken due to disease symptoms, reinforces the initial observation that MT-3 expression is absent, or at least highly restricted, in normal urothelium. An examination of 48 cases of low-grade bladder cancer demonstrated that 30 of 48 specimens (62.5%) expressed the MT-3 protein. In contrast, an examination of 107 cases of high-grade bladder cancer showed that 103 cases (96.26%) overexpressed the MT-3 protein. An examination of 17 cases of CIS, a diagnostically distinct high-grade lesion, showed that 100% of the specimens overexpressed the MT-3 protein. The expression pattern of the MT-1 and MT-2 family members has been examined by this laboratory using a similar set of diagnostic specimens (Zhou et al., 2006Go). A comparison of these results with those of the current study indicates that the pattern of MT-3 expression is distinct from that of the MT-1/2 isoforms. In this previous study, it was shown that there was no expression of MT-1/2 in benign lesions and low-grade bladder cancers, a low incidence of expression in dysplastic lesions and high-grade cancers with no evidence of muscle invasion, and a significantly increased incidence of MT-1/2 in high-grade bladder cancers that had invaded the underlying matrix. Furthermore, the expression of MT-1/2 varied in intensity from sample to sample and was focal in its pattern of expression. The high occurrence of MT-3 overexpression in high-grade bladder cancers, coupled with the very low level of expression in benign specimens, provides strong evidence that the expression of MT-3 could be developed as an environmental biomarker for the development of high-grade bladder cancer.

One of the important roles of a biomarker is to screen for the development or reoccurrence of disease within an at risk population. In the present case of MT-3 expression in bladder cancer, this would logically be by measurement of MT-3 in cells obtained through urinary cytology or by direct measurement of MT-3 in the urine. Urinary cytology and urine collection are also relatively noninvasive and inexpensive when compared to many other diagnostic procedures, both important issues in the development of a screening procedure for an at risk population. The other issue is specificity of the biomarker. The fact that MT-3 was overexpressed in 62.5% of low-grade cancers does not detract from the potential for the development of MT-3 as a biomarker for high-grade bladder cancer. Individuals with low-grade, noninvasive papillary tumors are at low risk for disease progression and are often treated adequately with transurethral resection (Borden et al., 2004Go). Furthermore, the low-grade bladder cancers are a distinct diagnostic entity and are not looked upon as a precursor lesion that can progress to a high-grade cancer. However, approximately 10–20% of low-grade bladder cancers do progress to muscle-invasive tumors and, for these tumors, there is a poor prognosis with less than 50% survival at 5 years when muscle invasion was present at diagnosis (Knowles, 2006Go). It is not known at this stage of data analysis if the MT-3 positive, low-grade tumors are associated with poor patient prognosis compared to the MT-3 negative tumors, but this is currently under investigation. The need for prognostic markers to identify aggressive low-grade tumors has been recently reviewed (Knowles, 2006Go). On the other hand, all high-grade tumors are considered life threatening due to their substantial risk for progression to muscle invasion and metastases. Thus, as a biomarker MT-3 would identify almost all high-grade cancers and some low-grade cancers, both of which would require medical intervention; it would miss some low-grade cancers. A second issue in specificity is if MT-3-positive cells from other organs might be "shed" into the urine. Previous studies by the laboratory have shown that the tubular elements of the human kidney express the MT-3 protein (Garrett et al., 1999bGo) as do some of the normal epithelial elements of the prostate gland (Garrett et al., 1999aGo). However, in both cases one would not expect a healthy individual to shed cells from either of these organ systems into the urine. The presence of tubular cells would indicate the presence of some form of renal insult where cells were detached and released into the urine, such as that shown to occur in diabetic nephropathy (Detrisac et al., 1983Go). Prostatic epithelial cells would presumably arise from a proliferative lesion. With these potential contributing organ sites in mind, there is not a benign reason for the urine to contain cells that express the MT-3 protein.

The metallothioneins are a well-known and highly studied cysteine-rich, low molecular weight family of intracellular proteins that bind transition metals with high affinity (Andrews, 2000Go; Hamer, 1986Go). The second goal of the study was to determine if there might be evidence for a causal relationship between the increased expression of MT-3 and the development of bladder cancer when urothelial cells are exposed to the environmental pollutants, cadmium, and arsenite. This hypothesis was tested using an immortalized cell culture model of human urothelium that retains features of human urothelium, retains a normal cytogenetic profile, does not form colonies in soft agar, is not tumorigenic in nude mice, and has no basal expression of MT-3 mRNA or protein (Petzolt et al., 1994Go, 1995Go; Rossi et al., 2001Go). The laboratory has previously detailed that exposure of the UROtsa cells to either Cd+2 or As+3 can directly malignantly transform the cells as evidenced by growth in soft agar and the formation of heterotransplants in nude mice (Sens et al., 2004Go). In the present study, this model system was employed to determine if either Cd+2 or As+3 induced the expression of MT-3 during the process of malignant transformation of the cells. The results of this determination clearly demonstrated that exposure to either Cd+2 or As+3 was without effect on the expression of MT-3. There was no expression of the MT-3 protein in the parental UROtsa cells and there was likewise no expression of MT-3 protein in the UROtsa cells that were malignantly transformed using Cd+2 and As+3 as judged by growth in soft agar and heterotransplantation into nude mice. Furthermore, evidence for induction of the MT-3 protein by the two pollutants was also assessed at an intermediate time point during the transformation process and no evidence was found for expression of the MT-3 protein. Thus, for this model system it can be concluded that there was no evidence for involvement of MT-3 in the cell culture–based malignant transformation of human urothelium by either Cd+2 or As+3.

Based on the above cell culture findings, it was very surprising to find moderate to heavy immunoreactivity for the MT-3 protein in the tumor heterotransplants generated from the UROtsa cells malignantly transformed with both As+3 and Cd+2. An analysis of MT-3 mRNA expression in the tumor heterotransplants demonstrated a small increase in the expression of MT-3 mRNA compared to the UROtsa cells used for initiation of the heterotransplant. A corresponding analysis of MT-3 protein demonstrated a large increase in MT-3 protein expression, increasing from nondetectable levels in the injected UROtsa cells to between 3 and 4 ng MT-3/µg total cell protein in the tumor heterotransplants. These observations would be consistent with hypothesizing a posttranscriptional mechanism for the increased expression of MT-3 protein in the tumor heterotransplants. A posttranscriptional mechanism would also be supported by the laboratory's previous observation that removal of the unique N-terminal sequence of MT-3 (as compared to other family members) is necessary to allow accumulation of MT-3 protein in UROtsa cells stably transfected with the MT-3 coding sequence (Garrett et al., 2005Go). The precise mechanism underlying the increased expression of MT-3 protein in the heterotransplants is presently unknown.

The finding that MT-3 protein was induced in the UROtsa cell tumor heterotransplants compared to the initiating cell cultures is also of practical importance in assessing the overall role of MT-3 expression in malignant epithelial cells and tumors. The laboratory has been concerned that despite showing MT-3 overexpression in patient specimens of bladder (Sens et al., 2000Go), breast (Sens et al., 2001Go), and prostate (Garrett et al., 1999aGo) cancer; many of the major cell lines used in research derived from such cancers have not been shown to have substantial expression of MT-3. Specifically, the laboratory has reported that the MCF-7, T-47D, Hs 578t, MDA-MB-231 breast cancer cell lines, and PC-3 prostate cancer cell line have no expression of MT-3 mRNA and protein (Dutta et al., 2002Go; Gurel et al., 2003Go). As shown in the present study, when these cells are heterotransplanted into nude mice, all five cell culture–derived heterotransplants were shown to overexpress the MT-3 protein. Furthermore, the profile of MT-3 mRNA and protein expression was similar to that found for the UROtsa cell heterotransplants. This is an important observation since it shows that the findings with the UROtsa cells regarding MT-3 expression are not an isolated oddity in one model system, but occur in cell lines that have widespread use in the study of breast and prostate cancer. Likewise, the findings of a possible posttranscriptional mechanism for MT-3 protein accumulation would also explain why MT-3 mRNA has not been consistently identified in microarrays as being upregulated in these cancers.

It is unknown at this time what role that the MT-3 protein might play in the establishment of the tumor heterotransplants. A major question under investigation is if the MT-3 protein is fully saturated with metals such as copper or zinc or if it is present in its apo metal-free form, or possibly, in a confirmation undersaturated with metals. If in the apo form, or undersaturated with metals, it is likely that essential zinc and copper ions are being sequestered away from the large and diverse group of proteins that require zinc and copper as cofactors for activity. Examples of such are the metalloproteases, p53, and the zinc finger transcription factors, an alteration in any of which could assist in establishing the conditions necessary to promote tumor cell heterotransplantation.


    ACKNOWLEDGMENTS
 
The project described was supported by grant numbers R01 CA094997 and R01 CA098832 from the National Cancer Institute (NCI), National Institutes of Health (NIH). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NCI, NIH. Project support was also provided to S.G. by the University of North Dakota faculty senate seed grant program.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Andrews, G. K. (2000). Regulation of metallothionein gene expression by oxidative stress and metal ions. Biochem. Pharmacol. 59, 95–104.[CrossRef][ISI][Medline]

Borden, L. S., Jr., Clark, P. E., and Hall, M. C. (2004). Bladder Cancer. Curr. Opin. Oncol. 16(3), 257–262.[CrossRef][ISI][Medline]

Detrisac, C. J., Mayfield, R. K., Colwell, J. A., Garvin, A. J., and Sens, D. A. (1983). In vitro culture of cells exfoliated in the urine by patients with diabetes mellitus. J. Clin. Invest. 71, 170–173.[ISI][Medline]

Dutta, R., Sens, D. A., Somji, S., Sens, M. A., and Garrett, S. H. (2002). Metallothionein isoform 3 expression inhibits cell growth and increases drug resistance of PC-3 prostate cancer cells. Prostate 52, 89–97.[CrossRef][ISI][Medline]

Epstein, J. I., Amin, M. B., Reuter, V. R., and Mostofi, F. K. (1998). The World Health Organization, International Society of Urologic Pathology consensus classification of urothelial (transitional cell) neoplasms of the urinary bladder. Bladder Consensus Conference Committee. Am. J. Surg. Pathol. 12, 1435–1438.

Friedline, J. A., Garrett, S. H., Somji, S., Todd, J. H., and Sens, D. A. (1998). Differential expression of the MT-1E gene in estrogen receptor positive and negative human breast cancer cell lines. Am. J. Pathol. 152, 23–28.[Abstract]

Garrett, S. H., Park, S., Sens, M. A., Somji, S., Singh, R. K., Namburi, V. B. R. K., and Sens, D. A. (2005). Expression of metallothionein isoform 3 is restricted at the post-transcriptional level in human bladder epithelial cells. Toxicol. Sci. 87, 66–74.[Abstract/Free Full Text]

Garrett, S. H., Sens, M. A., Shukla, D., Nestor, S., Somji, S., Todd, J. H., and Sens, D. A. (1999a). Metallothionein isoform 3 expression in the human prostate and cancer-derived cell lines. Prostate 41, 196–202.[CrossRef][ISI][Medline]

Garrett, S. H., Sens, M. A., Todd, J. H., Somji, S., and Sens, D. A. (1999b). Expression of MT-3 protein in the human kidney. Toxicol. Lett. 105, 207–214.[CrossRef][ISI][Medline]

Gurel, V., Sens, D. A., Somji, S., Garrett, S. H., Nath, J., and Sens, M. A. (2003). Stable transfection and overexpression of metallothionein isoform 3 inhibits the growth of MCF-7 and Hs578T cells but not that of T-47D or MDA-MB-231 cells. Breast Cancer Res. Treat. 80, 181–191.[CrossRef][ISI][Medline]

Hamer, D. H. (1986). Metallothionein. Annu. Rev. Biochem. 55, 913–951.[ISI][Medline]

Knowles, M. A. (2006). Molecular subtypes of bladder cancer: Jekyll and Hyde or chalk and cheese? Carcinogenesis 27, 361–373.[Abstract/Free Full Text]

Petzoldt, J. L., Leigh, I. M., Duffy, P. G., and Masters, J. R. W. (1994). Culture and characterization of human urothelium in vivo and in vitro. Urol. Res. 22, 67–74.[CrossRef][ISI][Medline]

Petzoldt, J. L., Leigh, I. M., Duffy, P. C., Sexton, C., and Masters, J. R. W. (1995). Immortalization of human urothelial cells. Urol. Res. 23, 377–380.[CrossRef][ISI][Medline]

Rossi, M. R., Masters, J. R. W., Park, S., Todd, J. H., Garrett, S. H., Sens, M. A., Somji, S., Nath, J., and Sens, D. A. (2001). The immortalized UROtsa cell line as a potential cell culture model of human urothelium. Environ. Health Perspect. 109, 801–808.[ISI][Medline]

Sens, D. A., Park, S., Gurel, V., Sens, M. A., Garrett, S. H., and Somji, S. (2004). Inorganic cadmium- and arsenite-induced malignant transformation of human bladder urothelial cells. Toxicol. Sci. 79, 56–63.[Abstract/Free Full Text]

Sens, M. A., Somji, S., Garrett, S. H., and Sens, D. A. (2001). Metallothionein isoform 3 (MT-3) overexpression is associated with breast cancers having a poor prognosis. Am. J. Pathol. 159, 21–26.[Abstract/Free Full Text]

Sens, M. A., Somji, S., Lamm, D. L., Garrett, S. G., Slovinsky, F., Todd, J. H., and Sens, D. A. (2000). Metallothionein isoform 3 as a potential biomarker for human bladder cancer. Environ. Health Perspect. 108, 413–418.[ISI][Medline]

Somji, S., Garrett, S. H., Sens, M. A., and Sens, D. A. (2005). The unique N-terminal sequence of metallothionein-3 is required to regulate the choice between apoptotic or necrotic cell death of human proximal tubule cells exposed to Cd+2. Toxicol. Sci. 90, 369–376.

Zhou, X. D., Sens, D. A., Sens, M. A., Namburi, V. B., Singh, R. K., Garrett, S. H., and Somji, S. (2006). Metallothionein-1 and -2 expression in cadmium and arsenite derived human malignant urothelial cells and tumor heterotransplants and as a prognostic indicator in human bladder cancer. Toxicol. Sci. 91(2), 467–475.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Toxicol SciHome page
S. Somji, X. D. Zhou, S. H. Garrett, M. A. Sens, and D. A. Sens
Urothelial Cells Malignantly Transformed by Exposure to Cadmium (Cd+2) and Arsenite (As+3) Have Increased Resistance to Cd+2 and As+3-Induced Cell Death
Toxicol. Sci., December 1, 2006; 94(2): 293 - 301.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
93/2/322    most recent
kfl065v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zhou, X. D.
Right arrow Articles by Sens, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, X. D.
Right arrow Articles by Sens, D. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?