Skip Navigation


ToxSci Advance Access originally published online on August 17, 2006
Toxicological Sciences 2006 94(1):38-45; doi:10.1093/toxsci/kfl081
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
94/1/38    most recent
kfl081v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wang, S.-L.
Right arrow Articles by Hong, J.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, S.-L.
Right arrow Articles by Hong, J.-Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

The Missense Genetic Polymorphisms of Human CYP2A13: Functional Significance in Carcinogen Activation and Identification of A Null Allelic Variant

Shou-Lin Wang*,{dagger}, Xiao-Yang He*, Jian Shen{ddagger}, Jia-Sheng Wang§ and Jun-Yan Hong*,1

* School of Public Health/Environmental and Occupational Health Sciences Institute, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854 {dagger} Institute of Toxicology, Nanjing Medical University, Nanjing 210029, China {ddagger} Sanofi-Aventis Pharmaceutical Inc., Bridgewater, New Jersey 08807 § Department of Environmental Toxicology/The Institute of Environmental and Human Health, Texas Tech University, Lubbock, Texas 79409

1To whom correspondence should be addressed at School of Public Health/Environmental and Occupational Health Sciences Institute, University of Medicine and Dentistry of New Jersey, Room 385, 683 Hoes Lane West, Piscataway, NJ 08854. Fax: (732) 235-4004. E-mail: jyhong{at}eohsi.rutgers.edu.

Received May 18, 2006; accepted July 24, 2006


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cytochrome P450 2A13 (CYP2A13), an enzyme predominantly expressed in human respiratory tissues, is highly efficient for the metabolic activation of two suspected human lung carcinogens 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and aflatoxin B1 (AFB1). Functional genetic polymorphisms of CYP2A13 may therefore be an important factor in human susceptibility to related lung cancers. Among the reported CYP2A13 polymorphisms with missense variations, only CYP2A13*2 variant (containing either a single or double variation of R25Q and R257C) was studied for its NNK-metabolizing activity. The present study demonstrated that there was no remarkable difference in AFB1- and NNK-induced toxicity between the Flp-In Chinese Hamster Ovary (CHO) cells stably expressing wild-type CYP2A13 and the cells expressing the individual polymorphic variants R25Q, D158E, R257C, R25Q/R257C, V323L, F453Y, and R494C. In contrast, cells transfected with R101Q variant complementary DNA (cDNA), same as the vector control cells, showed no significant death even at highest concentrations of AFB1 (10µM) and NNK (200µM). This result correlated with the lack of CYP2A13 protein in the R101Q-CHO cells, although the genomic integration of transfected R101Q cDNA and the expression of R101Q messenger RNA were clearly demonstrated in these stable transfectants. Consistent with the possibility that the variation might reduce the protein stability, R101Q variant protein expressed in insect cells showed a loss of P450 peak and coumarin 7-hydroxylase activity as well as an increased susceptibility to limited protein digestion. Thus, the R101Q polymorphic change results in a null allelic variant of CYP2A13. Our results should be useful in designing and interpreting molecular epidemiological studies related to CYP2A13 genetic polymorphisms.

Key Words: cytochrome P450 2A13; genetic polymorphism; metabolic activation; aflatoxin B1; 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cytochrome P450 2A13 (CYP2A13) is predominantly expressed in human respiratory tract with the highest level in the nasal mucosa, followed by the lung and trachea (Su et al., 2000Go). The human CYP2A13 gene is localized in a CYP2A-T gene cluster on the long arm of chromosome 19 (Wang et al., 2003aGo). CYP2A13, CYP2A6, and CYP2A7 are the three members in human CYP2A gene family. Although the CYP2A13 gene was first cloned in 1995 (Fernandez-Salguero et al., 1995Go) and the expression of its messenger RNA (mRNA) in human tissues was demonstrated later (Koskela et al., 1999Go), little studies were conducted on CYP2A13 as the gene was predicted to encode a nonfunctional protein based on the resemblance of amino acid sequences between CYP2A13 and the nonfunctional CYP2A7 and CYP2A6*2 (or CYP2A6v1), a genetic variant of CYP2A6 (Ding et al., 1995Go; Yamano et al., 1990Go). However, our study in 2000 demonstrated that CYP2A13 is not only catalytically active but also the most efficient human CYP enzyme for the metabolic activation of a major tobacco-specific carcinogen, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK). Compared to CYP2A6, which was previously believed to be the major human enzyme for NNK activation, the Km value of CYP2A13 in generating the carcinogenic NNK metabolites was approximately 10 times lower (~10µM for CYP2A13 vs. ~100µM for CYP2A6) and the catalytic efficiency (Vmax/Km) was ~30 times higher (Su et al., 2000Go). Our recent studies demonstrated that CYP2A13 is also highly efficient in metabolizing aflatoxin B1 (AFB1), another potent carcinogen with wide human exposure, to its carcinogenic/mutagenic epoxides, AFB1-8,9-epoxide, and AFM1-8,9-epoxide (He et al., 2006Go). The LC50 (50% lethal concentration) of AFB1 (48-h treatment) in Chinese Hamster Ovary (CHO) cells stably expressing CYP2A13 was ~800 times lower than that of the CHO cells expressing CYP2A6 (50nM for CHO-2A13 cells vs. 39µM for CHO-2A6 cells) (He et al., 2006Go). The catalytic efficiency of CYP2A13 for the metabolism of nicotine and cotinine was also higher than that of CYP2A6 (Bao et al., 2005Go), although the physiological significance of CYP2A13-mediated metabolism of nicotine and cotinine remains to be studied.

Both NNK and AFB1 are suspected human lung carcinogens (Hayes et al., 1984Go; Hecht, 2002Go), although the importance of AFB1 inhalation in human lung cancer is less established. While Olsen et al. (1998)Go failed to find a positive relationship between lung cancer risk and occupational exposure to aflatoxins, several other studies reported that AFB1 inhalation exposure is associated with increased respiratory cancers. (Dvorackova, 1986Go; Hayes et al., 1984Go; Kelly et al., 1997Go; Sorenson et al., 1981Go). AFB1 also induces tumors in the lung and airway tissues of laboratory animals (Herzog et al., 2004Go; Stoner, 1991Go; Wieder et al., 1968Go). Nevertheless, the high catalytic efficiency of CYP2A13 in metabolizing NNK and AFB1 as well as the predominant expression of this enzyme in human respiratory tract strongly suggest that CYP2A13-catalyzed metabolic activation in situ may play a critical role in human lung carcinogenesis related to cigarette smoking and AFB1 inhalation exposure. It is reasonable to further speculate that functional genetic polymorphisms of CYP2A13 may have a significant impact on human susceptibility to lung cancers related to NNK or AFB1 exposure. So far, a total of nine single nucleotide polymorphisms have been identified in the protein coding sequence of human CYP2A13 (Table 1) (Cauffiez et al., 2004Go, 2005Go; Cheng et al., 2004Go; Fujieda et al., 2003Go; Zhang et al., 2002Go, 2003Go). Among them, two allelic variants CYP2A13*3, which has an insertional frame-shift mutation, and CYP2A13*7 (R101X, X = stop codon), which has a large protein truncation due to the substitution of a stop codon, are predicted to be lack of enzymatic function. The remaining seven allelic variants of CYP2A13 are all missense variants. Heterologously expressed R257C (CYP2A13*2) variant protein was reported to be less efficient than the wild-type enzyme in the metabolic activation of NNK (Zhang et al., 2002Go). This result appears to be consistent with a reported molecular epidemiological study in which the CYP2A13 R257C polymorphism was found to be associated with a substantial reduction in smoking-related lung cancer risk (Wang et al., 2003bGo). Functional significance of the other CYP2A13 missense variants, however, is unknown.


View this table:
[in this window]
[in a new window]

 
TABLE 1 Distribution Frequency of the Reported CYP2A13 Allelic Variations in Protein Coding Region

 
The present study was undertaken to determine the functional significance of the reported CYP2A13 missense polymorphisms. We first established Flp-In CHO cell lines with stable expression of all the reported missense CYP2A13 variants and compared CYP2A13-mediated NNK and AFB1 toxicity in theses cells with the cells expressing wild-type CYP2A13. We demonstrate a loss of function in the R101Q (CYP2A13*4) variant and conducted additional studies to elucidate the involved mechanisms.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals and reagents.
NNK (99% purity) was purchased from ChemSyn (Lenexa, KS). AFB1 (98% purity), coumarin, {delta}-aminolevulinic acid ({delta}-ALA), ferric citrate, and trypsin were obtained from Sigma-Aldrich (St Louis, MO). Proteinase K was from Roche Applied Science (Indianapolis, IN). PfuUltra HF DNA Polymerase was obtained from Stratagene (La Jolla, CA). Restriction enzymes and Quick T4 DNA ligase were from New England Biolabs (Beverly, MA). The iScript complementary DNA (cDNA) synthesis kit was purchased from Bio-Rad (Hercules, CA). The Wizard PCR Preps DNA purification system, Wizard Genomic DNA purification kit, the Cell Titer 96 AQueous nonradioactive cell proliferation assay kit for MTS assay, and cell lysis reagent were purchased from Promega (Madison, WI). BAC-TO-BAC baculovirus expression system (including pFASTBAC donor plasmid, MAX EFFICIENCY DH10BAC competent cells, and CELLFECTIN reagent), Flp-In CHO cells, Spodoptera frugiperda (Sf9) cells, pcDNA5 vector containing Flp Recombination Target (FRT site), pOG44, Lipofectamine 2000, trypsin-ethylenediaminetetraacetic acid (EDTA), RNase A, Ham's F-12 nutrient mixture, fetal bovine serum, Sf-900 II SFM serum-free medium, OPTI-MEM I reduced serum medium, Grace's Insect Medium, Pluronic F-68 reagent, penicillin-streptomycin-glutamine, and hygromycin B were purchased from Invitrogen (Carlsbad, CA). A monoclonal anti-human CYP2A6 antibody that cross-reacts with human CYP2A13 was obtained from BD Genetest (Woburn, MA). Anti-mouse IgG, horseradish peroxidase–linked whole antibody (from sheep), and the enhanced chemiluminescence (ECL) western blotting detection reagents were from Amersham Biosciences (Piscataway, NJ).

Construction of CYP2A13 variant cDNAs and transfection of Flp-In CHO cells.
The PCR primers for site-directed mutagenesis (Table 2) were designed using PrimerX software (http://bioinformatics.org/primerx) and synthesized by Integrated DNA Technologies (Skokie, IL). Using wild-type CYP2A13 cDNA in pcDNA5/FRT vector as a template, the PCR products containing a single mutation (R25Q, R101Q, D158E, R257C, V323L, and F453Y) or a double mutation (R25Q/R257C) were obtained by amplification with PfuUltra HF DNA Polymerase. The amplified full-length cDNAs were always completely sequenced to ensure that there were no extra mutations. To avoid possible extra mutations in the vector sequence produced during PCR-based mutagenesis, which may affect expression efficiency of the vectors, the variant CYP2A13 cDNA was excised from the original vector after PCR amplification by XhoI and NotI restriction enzymes and was reinserted into a new pcDNA5/FRT vector containing no mutations. Because the R494 is the last amino acid residue in the CYP2A13 protein, the R494C mutant cDNA was generated as follows: a KpnI site was introduced into the forward primer in front of the start codon of CYP2A13 cDNA, and the reverse primer contained the R494C mutation and the stop codon. The PCR-amplified R494C cDNA was first cloned into a pCR2.1-TOPO vector using the TOPO TA cloning kit and sequenced to ensure no extra PCR-induced mutations. Subsequently, the full-length cDNA was transferred into the pcDNA5/FRT vector using KpnI restriction site. Transfection of the Flp-In CHO cells with CYP2A13 cDNA was conducted as previously described (Wang et al., 2005Go). Briefly, the Flp-In CHO cells were cotransfected with pcDNA5/FRT vector containing CYP2A13 cDNA and pOG44 vector (for the expression of Flp recombinase) for 24 h by Lipofectamin 2000. The stable transfectant cells were selected by hygromycin B for 7–10 days as well-growing foci. The selected foci were allowed to grow for additional 7–10 days for expansion.


View this table:
[in this window]
[in a new window]

 
TABLE 2 Sequence of the Primers Used for Site-Directed Mutagenesis

 
Cytotoxicity assay.
Cell viability was determined by a modified MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) assay as previously described (Wang et al., 2005Go). Briefly, the cells were put into a 24-well plate (1 x 105 cells per well) and grown under 95% humidity and 5% CO2 at 37°C overnight. The cells were then treated with different concentrations of NNK (24 h) or AFB1 (48 h). After treatment, the medium in each well was replaced with 500 µl of MTS mixture and the cells were incubated in dark for 30 min. The plate was then read at 490 nm by a µQuant plate reader (Bio-Tek Instrument, Inc., Winooski, VT). In each group, the viability of cells incubated with vehicle dimethylsulfoxide only was set at 100%.

Immunoblot analysis.
Expression of CYP2A13 proteins in the stable transfectant cells were determined by immunoblotting using a monoclonal antibody against CYP2A6, which cross-reacts with CYP2A13 with the same binding efficiency. Sheep anti-mouse IgG conjugated with horseradish peroxidase was used as the secondary antibody. The immunoblot was visualized by ECL detection according to the manufacturer's protocol.

Detection of CYP2A13 R101Q variant cDNA and mRNA in stable transfectant cells.
The Wizard Genomic DNA purification kit was used to extract the genomic DNA from the stable transfectant Flp-In CHO cells that were transfected with wild-type CYP2A13 cDNA or R101Q variant cDNA. Total RNA was extracted from the same cells by TRIzol reagent and chloroform, and precipitated with ethanol. After washed once by 70% ethanol and dried in air, the RNA pellet was dissolved in RNase-free water. The RNA was reversed transcribed to cDNA using iScript cDNA synthesis kit according to the manufacturer's protocol. The presence of wild-type CYP2A13 or the variant R101Q sequence in the genomic DNA and mRNA of the stable transfectant cells was determined by direct PCR and reverse transcription–PCR (RT-PCR) (35 cycles for both PCR reactions), respectively, with a pair of CYP2A13-specific primers (forward: 5' ATGCTGGCCTCAGGGCT GCTTCTG 3'; reverse: 5' TCAGCGGGGCAGGAAGCTCATGGTGTAG 3'). A pair of ß-actin specific primers was used as an internal control for RT-PCR analysis.

Expression of R101Q variant protein in Sf9 insect cells.
The BAC-TO-BAC baculovirus/Sf9 insect cell expression system was used for the expression of R101Q variant protein according to the protocol described previously (He et al., 2004bGo). Briefly, the R101Q variant cDNA in pcDNA5/FRT vector was transferred into pFASTBAC donor plasmid using XhoI and NotI restriction enzymes and Quick T4 DNA quick ligase. The pFASTBAC plasmid was used to transform MAX EFFICIENCY DH10BAC cells (containing bacmid and helper) to generate the bacmid DNA containing R101Q variant cDNA. The bacmid DNA was then transfected into Sf9 cells by CELLFECTIN reagent to obtain the recombinant baculovirus particles. Sf9 cells were infected with the virus particles in the presence of {delta}-ALA and ferric citrate for the large-scale production of R101Q variant protein. After incubation for 72 h, the infected Sf9 cells were harvested, washed with phosphate buffered saline (PBS), and resuspended in PBS buffer containing 5mM imidazole, 20% glycerol. Microsomes were prepared by sonication and differential centrifugation as previously described (He et al., 2004bGo) and were stored at –80°C prior to use.

P450 content determination and coumarin 7-hydroxylation assay.
Microsomal P450 content was determined by reduced Carbon monoxide (CO)-difference spectrum after solubilization (Omura and Sato, 1964Go). The CO-difference spectra were recorded using an ultraviolet (UV)/visible spectrophotometer (Shimadzu UV 160U, Japan). Coumarin 7-hydroxylase activity was assayed according to the protocol described previously (He et al., 2004bGo). The reaction was carried out at 37°C for 20 min in a 500 µl of 50mM Tris buffer (pH 7.4) consisting of microsomal proteins (50 µg), nicotinamide adenine dinucleotide phosphate (NADPH)-P450 oxidoreductase (30 units), 1mM NADPH, 10mM magnesium chloride, 150mM potassium chloride, and 50µM coumarin.

Limited proteolysis by proteinase K and trypsin.
Five micrograms of microsomal proteins containing expressed wild-type CYP2A13 or R101Q variant were digested by different concentrations of proteinase K or trypsin at 25°C for 30 min. The buffer for proteinase K digestion was 20mM Tris-HCl (pH 8.0) containing 5mM EDTA and 100mM NaCl, and the buffer for trypsin digestion was 20mM Tris-HCl (pH 7.5) containing 1mM EDTA and 200mM NaCl. After digestion, the samples were immediately placed in ice, then in boiling water bath for 10 min with added 2x sodium dodecyl sulfate (SDS) loading buffer to terminate the digestion. The samples were then subject to electrophoresis on 10% SDS-polyacrylamide gel and CYP2A13 protein was detected by immunoblotting. The bands were quantified using ImageJ software (http://rsb.info.nih.gov/ij/).

Statistical analysis.
The LC50 values for cell viability were calculated by a modified logit model. The data were analyzed by SPSS 10.0 for Windows (SPSS, Inc., Chicago, IL) and the differences in cell viability among groups were determined using one-way analysis of variance. A p value of < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Stable Expression of Human CYP2A13 and its Polymorphic Variants in Flp-In CHO Cells
The Flp-In CHO cells were preengineered to contain an FRT site in their genomic DNA. The transfected DNAs are ensured to be integrated as a single copy at the same chromosomal site with the help of Flp recombinase. This mechanism results in the same level of transgene transcription in all the stable transfectant cell clones. We have validated the Flp-In CHO cells system and successfully used it to express several human enzymes including wild-type CYP2A13 (He et al., 2006Go; Wang et al., 2005Go). To establish the stable Flp-In CHO cell lines expressing the CYP2A13 missense variants, we cotransfected the cells with CYP2A13 variant cDNA and an Flp recombinase expression vector (pOG44). The stable transfectant cells were then selected by their resistance to antibiotic hygromycin B. Immunoblot analysis demonstrated that CYP2A13 protein levels were the same in the stable transfectants expressing wild-type CYP2A13 and the variants R25Q, D158E, R257C, R25Q/R257C (containing double variations), V323L, F453Y, and R494C (Fig. 1A). As expected, there was no detectable CYP2A13 protein in the CHO cells transfected with the vector containing no CYP2A13 cDNA. These results are consistent with the working principle of Flp-In cell system as discussed above. However, there was no detectable CYP2A13 protein in the cells transfected with the R101Q variant cDNA (Fig. 1A). This result was confirmed by our repeated transfection experiments (data not shown). PCR analysis with CYP2A13-specific primers demonstrated that the R101Q variant cDNA was successfully integrated into the genomic DNA of the stable transfectant cells (Fig. 1B). The same integration also occurred in the stable transfectants expressing wild-type CYP2A13 but was absent in the cells transfected with vector alone (no CYP2A13 cDNA) (Fig. 1B). RT-PCR analysis further demonstrated that the mRNA of R101Q variant was also expressed in the corresponding stable transfectant cells (Fig. 1C). For comparison, expression of CYP2A13 mRNA was demonstrated in the cells expressing wild-type CYP2A13 (as a positive control) but was absent in the cells transfected with vector alone (as a negative control).


Figure 1
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 1 Expression of human CYP2A13 protein in stable transfectant Flp-In CHO cells. Cells transfected with expression vector alone (without CYP2A13 cDNA) were used as a negative control. (A) The expression of CYP2A13 protein was determined by immunoblot analysis. Cell lysate proteins (50 µg per lane) were prepared from the CHO cells expression wild-type CYP2A13 or the variants. Integration of the transfected CYP2A13 cDNA in the genomic DNA and expression of CYP2A13 mRNA in the stable transfectant cells were determined by PCR and RT-PCR analyses (B and C), respectively. DNA and RNA were prepared from the cells transfected with human wild-type CYP2A13 or R101Q variant cDNA. Expression of ß-actin mRNA in the same cells was determined as an additional control for RT-PCR analysis.

 
AFB1- and NNK-Induced Toxicity in Flp-In CHO Cells Expressing Wild-Type or Variant CYP2A13
We used MTS assay to compare AFB1- and NNK-induced toxicity in Flp-In CHO cells stably expressing wild-type CYP2A13 and the variants. AFB1 (48 h) or NNK (24 h) treatment caused a significant increase (p < 0.01, in comparison with the vector control) in cell death in the cells expressing wild-type CYP2A13 (Fig. 2) with LC50 values of 23nM for AFB1 and of 44µM for NNK, respectively. In contrast, there was no significant cell death in the Flp-In CHO cells transfected with vector alone (without CYP2A13 cDNA) even at highest experimental concentrations of AFB1 (10µM) and NNK (200µM) (Fig. 2). These results are consistent with the important role of CYP2A13 in the metabolic activation of these two carcinogens (Su et al., 2000Go; He et al., 2006Go). Except for the R101Q variant, the stable transfectant cells expressing all the other CYP2A13 variant proteins showed a similar response to both AFB1 and NNK, and there was no remarkable difference in cell viability between the cells expressing these variants and the cells expressing wild-type CYP2A13 (Fig. 2). This result indicates that the capabilities of these CYP2A13 variant proteins in activating AFB1 and NNK were not significantly altered. In contrast, there was no significant AFB1- or NNK-induced death in the cells transfected with R101Q variant cDNA (Fig. 2), which is consistent with the lack of CYP2A13 protein in these stable transfectant cells.


Figure 2
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 2 AFB1- and NNK-induced toxicity in Flp-In CHO cells expressing human CYP2A13 (A and B). The cells were treated with different concentrations of AFB (48 h) or NNK (24 h) and cultured at 95% humidity and 5% CO2 at 37°C. Flp-In CHO cells transfected with vector alone (no. CYP2A13) were used as a negative control. Cell viability was determined by MTS assay. The values are mean ± SD of triplicate samples. {lozenge} vector control, {diamondsuit} wild-type, {Delta} R25Q, {blacktriangleup} R101Q, {circ} D158E, • R257C, ð R25Q/R257C, {blacksquare} V323L, + F453Y, x R494C.

 
Biochemical Characterization of R101Q Variant Protein
The demonstrated presence of R101Q cDNA and mRNA but lack of immunodetectable CYP2A13 protein in the cells transfected with R101Q cDNA suggests that the amino acid substitution at #101 position may lead to a loss of the antigenic site for immunoblot detection and/or a decrease in CYP2A13 protein stability within the CHO cells. To further explore the mechanisms involved, we expressed sufficient amount of R101Q variant proteins by the baculovirus/insect cell system for biochemical studies. Expression of R101Q variant protein in the microsomes of insect cells was confirmed by immunoblot analysis using the same antibody for CYP2A13 protein detection in the CHO cells. This result eliminates the possibility that the lack of detectable R101Q variant protein in the corresponding Flp-In CHO cells was due to an alteration in the antibody-binding site. As shown in Figure 3A, microsomes expressing wild-type CYP2A13 protein displayed a typical P450 absorption peak but such peak was not detectable in the microsomes expressing R101Q variant protein (Fig. 3B), suggesting that the heme in R101Q protein might be either lost or misincorporated. Consistent with the lack of P450 peak, microsomes containing R101Q variant protein showed no activity in coumarin 7-hydroxylation (Fig. 3C).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 3 Determination of microsomal P450 content (A and B) and coumarin 7-hydroxylation activity (C). Microsomes were prepared from the Sf9 cells expressing wild-type CYP2A13 or R101Q variant protein. For P450 content determination, 900 µg of microsomal proteins was used. Microsomes containing wild-type CYP2A13 protein showed a characteristic P450 peak (0.23 pmol P450/µg protein), while microsomes containing R101Q variant protein exhibited only an absorption peak at 420 nm. The P450 content determination was conducted with three different batches of Sf9 cell microsomes and a representative result is shown. For coumarin 7-hydroxylation assay, 50 µg of microsomal proteins was used. Microsomal proteins from Sf9 cells transfected with the vector alone (no CYP2A13 cDNA) were used as a negative control.

 
CYP proteins with heme loss or misincorporation are often unstable (Faletto et al., 1992Go; Hong et al., 2001Go). To determine the possible stability change of R101Q variant protein, both the microsomes containing wild-type CYP2A13 and R101Q variant proteins were subject to limited digestion by proteinase K or trypsin. As shown in Figure 4, R101Q variant proteins were much more susceptible to the digestion by these two proteinases. Compared with corresponding undigested control samples, only less than 5% of the R101Q variant proteins were remaining after a 30-min digestion with 20 ng/µl proteinase K while approximately 60% of the wild-type CYP2A13 proteins still remained (Fig. 4A). Similarly, approximately 90% of the R101 variant proteins were digested out by trypsin (25 ng/µl), while more than 60% of the wild-type CYP2A13 proteins remained (Fig. 4B).


Figure 4
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 4 Limited proteolysis by proteinase K (A) and trypsin (B). Microsomal proteins (5 µg) prepared from the Sf9 cells expressing wild-type CYP2A13 or R101Q variant were digested with different concentrations of proteinase K or trypsin at 25°C for 30 min. After digestion, the samples were subject to electrophoresis and immunoblotting. The bands were quantified using ImageJ software, and the integrated intensity of the corresponding controls (without proteinase K or trypsin digestion) was set at 100% for comparison. The result was reproducible in repeated digestion experiments (n = 3 for proteinase K and n = 2 for trypsin).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genetic polymorphism of human CYP enzymes has been recognized as an important determinant or modifier in human susceptibility to environmental carcinogenesis and has also been widely used as a biomarker in molecular epidemiological studies (Hong and Yang, 1997Go). However, it should be emphasized that only a very small percentage of genetic polymorphisms may have a significant impact on CYP enzyme expression/function. Therefore, identification and characterization of the functional genetic variants are critically important for the selection of appropriate biomarkers for molecular epidemiological studies. The present study characterized the functional significance of reported missense polymorphic variants of CYP2A13, a highly efficient enzyme for the metabolic activation of NNK and AFB1. Our results demonstrate that except for the R101Q variant there was no remarkable difference in AFB1- or NNK-induced toxicity between the stable transfectant CHO cells expressing wild-type CYP2A13 and the missense variants, suggesting that the AFB1- and NNK-metabolizing activity of CYP2A13 protein is not significantly altered by these variations. Therefore, these polymorphic alleles are unlikely to affect the susceptibility to AFB1- or NNK-related lung carcinogenesis. It is worth to mention that the human susceptibility to environmental carcinogens could also be influenced by nongenetic factors such as the inhibition of CYP2A13 activity by other chemicals including nicotine (Bao et al., 2005Go) and 8-methoxypsoralen (von Weyman et al., 2005Go).

The present study demonstrates that the R101Q polymorphic variation has a significant functional impact on CYP2A13 enzyme. The demonstrated expression of R101Q variant mRNA but lack of detectable CYP2A13 proteins in the corresponding stable transfectant cells, loss of catalytic activity and of appropriate heme binding in the enzyme, and increased susceptibility to proteinase digestion collectively suggest that the missense variation leads to a nonfunctional and unstable protein. However, a partial contribution of this missense variation on the mRNA stability and/or translation efficiency could not be totally excluded. Nevertheless, the R101Q variation represents a null allele. While the previously mentioned R101Stop polymorphism of CYP2A13 also represents a nonfunctional allele, the molecular mechanism involved in the latter is the premature termination of protein synthesis instead of single amino acid substitution. Nevertheless, the phenotypic consequence of R101Q and R101Stop should be the same. It would, therefore, be reasonable to combine the genotyping of these two null alleles in future molecular epidemiological studies to determine their influence on human lung cancer susceptibility related to NNK or AFB1 exposure.

A single amino acid substitution could have a profound effect on CYP protein structure, leading to the loss of appropriate heme binding and/or alteration in protein stability. Faletto et al. (1992)Go demonstrated that a Ser180 -> Cys substitution in rat cytochrome P450 2C13 did not appear to affect synthesis of the protein but decreased the protein stability significantly. We found that human CYP2A6 Leu160His variant protein also had a loss of appropriate heme binding and showed a drastic reduction in protein stability, which is the result of conformational change by introducing an extra charge at #160 position (Hong et al., unpublished results). The distinctive effect of R101Q variation on CYP2A13 protein, in comparison with the other missense changes, may be due to its strong interaction with the catalytic heme. Based on our CYP2A13 model (He et al., 2004aGo,bGo) and recently published x-ray structure of CYP2A6 (Yano et al., 2005Go), which is the most homologous x-ray structure to CYP2A13, R101 is the only amino acid residue in the present study that is located within 10 Å distance from the heme iron. In fact, the guanidine of R101 is H-bonded (~ 3 Å) to both propionates of the heme as shown in CYP2A6 structure. Our data suggest that the dual-salt-bridge interaction is very important for appropriate anchoring of the heme within the hydrophobic interior of the protein.

Our data on CYP2A13-mediated NNK and AFB1 cytotoxicity suggest that the R257C variation, either alone or combined with R25Q variation, is lack of functional significance. However, heterologously expressed R257C variant protein was previously reported to have a decreased catalytic efficiency in the metabolic activation of NNK (assayed as the formation of keto aldehyde and keto alcohol) (Zhang et al., 2002Go). For keto aldehyde formation, the Km values (µM) of wild-type CYP2A13 and R257C variant proteins were 4.6 and 6.2, respectively; and the Vmax values (nmol/min/nmol of P450) were 14.5 and 8.4, respectively. For keto alcohol formation, the Km values (µM) of wild-type CYP2A13 and R257C were 2.8 and 4.8, respectively; and the Vmax values (nmol/min/nmol of P450) were 5.7 and 3.2, respectively (Zhang et al., 2002Go). Although these differences were statistically significant, the changes may not be large enough to significantly impact on NNK activation in vivo and to be reliably detected in our cell system which has approximately 15–20% interassay variations. It should be noted that both the reported NNK metabolism by R257C variant protein and our data on NNK activation in the cells expressing R257C variant protein more resemble the homozygous situation in humans. The extent of change in CYP2A13 activity in the individuals who are heterozygous for R257C polymorphism is expected to be even smaller (50% less change in theory). These activity and cytotoxicity data suggest that R257C polymorphism of CYP2A13 is very unlikely to be an important determinant or modifier in human lung cancer risk related to NNK or AFB1 exposure. It would be extremely difficult in association studies with case-control design to identify a true relationship between human cancer risk and of the CYP genetic polymorphisms with minor functional changes.

In summary, we have characterized the functional significance of the reported missense genetic polymorphisms of CYP2A13 and demonstrated that the R101Q polymorphism represents a null allele. Our results provide important information for designing CYP2A13 polymorphism-related molecular epidemiological studies and for understanding structure-activity relationship of CYP2A13 protein.


    ACKNOWLEDGMENTS
 
This study was partially supported by National Institutes of Health grant RO1-ES10048 (J. Y. Hong) and The National Institute of Environmental Health Sciences Center grant ES-05022. We thank Jinfeng Han and Emerson Liu for their assistance in the manuscript preparation.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bao Z, He XY, Ding X, Prabhu S, Hong JY. (2005) Metabolism of nicotine and cotinine by human cytochrome P450 2A13. Drug Metab. Dispos 33:258–261.[Abstract/Free Full Text]

Cauffiez C, Lo-Guidice JM, Quaranta S, Allorge D, Chevalier D, Cenee S, Hamdan R, Lhermitte M, Lafitte JJ, Libersa C, et al. (2004) Genetic polymorphism of the human cytochrome CYP2A13 in a French population: Implication in lung cancer susceptibility. Biochem. Biophys. Res. Commun 317:662–669.[CrossRef][ISI][Medline]

Cauffiez C, Pottier N, Tournel G, Lo-Guidice JM, Allorge D, Chevalier D, Migot-Nabias F, Kenani A, Broly F. (2005) CYP2A13 genetic polymorphism in French Caucasian, Gabonese and Tunisian populations. Xenobiotica 35:661–669.[CrossRef][ISI][Medline]

Cheng XY, Chen GL, Zhang WX, Zhou G, Wang D, Zhou HH. (2004) Arg257Cys polymorphism of CYP2A13 in a Chinese population. Clin. Chim. Acta 343:213–216.[CrossRef][ISI][Medline]

Ding S, Lake BG, Friedberg T, Wolf CR. (1995) Expression and alternative splicing of the cytochrome P-450 CYP2A7. Biochem. J 306:161–166.

Dvorackova I. (1986) Aflatoxin inhalation and alveolar cell carcinoma. BMJ 1:691.

Faletto MB, Linko P, Goldstein JA. (1992) A single amino acid mutation (Ser180-Cys) determines the polymorphism in cytochrome P450g (P4502C13) by altering protein stability. J. Biol. Chem 267:2032–2037.[Abstract/Free Full Text]

Fernandez-Salguero P, Hoffman SM, Cholerton S, Mohrenweiser H, Raunio H, Rautio A, Pelkonen O, Huang JD, Evans WE, Idle JR. (1995) A genetic polymorphism in coumarin 7-hydroxylation: Sequence of the human CYP2A genes and identification of variant CYP2A6 alleles. Am. J. Hum. Genet 57:651–660.[Medline]

Fujieda M, Yamazaki H, Kiyotani K, Muroi A, Kunitoh H, Dosaka-Akita H, Sawamura Y, Kamataki T. (2003) Eighteen novel polymorphisms of the CYP2A13 gene in Japanese. Drug Metab. Pharmacokinet 18:86–90.[CrossRef][Medline]

Hayes RB, van Nieuwenhuize JP, Raatgever JW, ten Kate FJ. (1984) Aflatoxin exposures in the industrial setting: An epidemiological study of mortality. Food Chem. Toxicol 22:39–43.[CrossRef][ISI][Medline]

He XY, Shen J, Ding X, Lu AY, Hong JY. (2004a) Identification of critical amino acid residues of human CYP2A13 for the metabolic activation of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, a tobacco-specific carcinogen. Drug Metab. Dispos 32:1516–1521.[Abstract/Free Full Text]

He XY, Shen J, Hu WY, Ding X, Lu AY, Hong JY. (2004b) Identification of Val117 and Arg372 as critical amino acid residues for the activity difference between human CYP2A6 and CYP2A13 in coumarin 7-hydroxylation. Arch. Biochem. Biophys 427:143–153.[CrossRef][ISI][Medline]

He XY, Tang L, Wang SL, Cai QS, Wang JS, Hong JY. (2006) Efficient activation of aflatoxin B1 by cytochrome P450 2A13, an enzyme predominantly expressed in human respiratory tract. Int. J. Cancer 118:2665–2671.[CrossRef][ISI][Medline]

Hecht SS. (2002) Cigarette smoking and lung cancer: Chemical mechanisms and approaches to prevention. Lancet Oncol 3:461–469.[CrossRef][ISI][Medline]

Herzog CR, Bodon N, Pittman B, Maronpot RR, Massey TE, Anderson MW, You M, Devereux TR. (2004) Carcinogen-specific targeting of chromosome 12 for loss of heterozygosity in mouse lung adenocarcinomas: Implications for chromosome instability and tumor progression. Oncogene 23:3033–3039.[CrossRef][ISI][Medline]

Hong JY, Wang YY, Mohr SN, Bondoc FY, Deng C. (2001) Human cytochrome P450 isozymes in metabolism and health effects of gasoline ethers. Res. Rep. Health Eff. Inst 102:7–27.

Hong JY and Yang CS. (1997) Genetic polymorphisms of cytochromes P450 as a biomarker of susceptibility to environmental toxicity. Environ. Health Perspect 105:759–762.

Kelly JD, Eaton DL, Guengerich FP, Coulombe RA Jr. (1997) Aflatoxin B1 activation in human lung. Toxicol. Appl. Pharmacol 144:88–95.[CrossRef][ISI][Medline]

Koskela S, Hakkola J, Hukkanen J, Pelkonen O, Sorri M, Saranen A, Anttilas S, Fernandez-Salguero P, Gonzalez F, Raunio H. (1999) Expression of CYP2A genes in human liver and extrahepatic tissues. Biochem. Pharmacol 57:1407–1413.[CrossRef][ISI][Medline]

Olsen JH, Dragsted L, Autrup H. (1998) Cancer risk and occupational exposure to aflatoxins in Denmark. Br. J. Cancer 58:392–396.

Omura T and Sato R. (1964) The carbon monoxide-binding pigment of liver microsome. II. Solubilization, purification, and properties. J. Biol. Chem 239:2379–2385.[Free Full Text]

Sorenson WG, Simpson JP, Peach MJ, Thedell TD, Olenchock SA. (1981) Aflatoxin in respirable corn dust particles. J. Toxicol. Environ. Health 7:669–672.[ISI][Medline]

Stoner GD. (1991) Lung tumors in strain A mice as a bioassay for carcinogenicity of environmental chemicals. Exp. Lung Res 17:405–423.[ISI][Medline]

Su T, Bao Z, Zhang QY, Smith TJ, Hong JY, Ding X. (2000) Human cytochrome P450 CYP2A13: Predominant expression in the respiratory tract and its high efficiency metabolic activation of a tobacco-specific carcinogen, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone. Cancer Res 60:5074–5079.[Abstract/Free Full Text]

Wang H, Donley KM, Keeney DS, Hoffman SM. (2003a) Organization and evolution of the Cyp2 gene cluster on mouse chromosome 7, and comparison with the syntenic human cluster. Environ. Health Perspect 111:1835–1842.[ISI][Medline]

Wang H, Tan W, Hao B, Miao X, Zhou G, He F, Lin D. (2003b) Substantial reduction in risk of lung adenocarcinoma associated with genetic polymorphism in CYP2A13, the most active cytochrome P450 for the metabolic activation of tobacco-specific carcinogen NNK. Cancer Res 63:8057–8061.[Abstract/Free Full Text]

Wang SL, He XY, Hong JY. (2005) Human cytochrome p450 2S1: Lack of activity in the metabolic activation of several cigarette smoke carcinogens and in the metabolism of nicotine. Drug Metab. Dispos 33:336–340.[Abstract/Free Full Text]

Wieder R, Wogan GN, Shimkin MB. (1968) Pulmonary tumors in strain A mice given injections of aflatoxin B1. J. Natl. Cancer Inst 40:1195–1197.[ISI][Medline]

von Weyman LB, Zhang QY, Ding X, Hollenberg PF. (2005) Effects of 8-methoxypsoralen on cytochrome P450 2A13. Carcinogenesis 26:621–629.[Abstract/Free Full Text]

Yamano S, Tatsuno J, Gonzalez FJ. (1990) The CYP2A3 gene product catalyzes coumarin 7-hydroxylation in human liver microsomes. Biochemistry 29:1322–1329.[CrossRef][Medline]

Yano JK, Hsu MH, Griffin KJ, Stout CD, Johnson EF. (2005) Structures of human microsomal cytochrome P450 2A6 complexed with coumarin and methoxsalen. Nat. Struct. Mol. Biol 12:822–823.[CrossRef][ISI][Medline]

Zhang X, Chen Y, Liu Y, Ren X, Zhang QY, Caggana M, Ding X. (2003) Single nucleotide polymorphisms of the human cyp2a13 gene: Evidence for a null allele. Drug Metab. Dispos 31:1081–1085.[Abstract/Free Full Text]

Zhang X, Su T, Zhang QY, Gu J, Caggana M, Li H, Ding X. (2002) Genetic polymorphisms of the human CYP2A13 gene: Identification of single-nucleotide polymorphisms and functional characterization of an Arg257Cys variant. J. Pharmacol. Exp. Ther 302:416–423.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
B. D. Smith, J. L. Sanders, P. R. Porubsky, G. H. Lushington, C. D. Stout, and E. E. Scott
Structure of the Human Lung Cytochrome P450 2A13
J. Biol. Chem., June 8, 2007; 282(23): 17306 - 17313.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
94/1/38    most recent
kfl081v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wang, S.-L.
Right arrow Articles by Hong, J.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, S.-L.
Right arrow Articles by Hong, J.-Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?