ToxSci Advance Access originally published online on November 20, 2006
Toxicological Sciences 2007 96(1):83-91; doi:10.1093/toxsci/kfl172
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cellular Toxicity Induced by SRF-Mediated Transcriptional Squelching
Department of Biochemistry, SUNY at Buffalo, Buffalo, New York 14214
1 To whom correspondence should be addressed at Department of Biochemistry, SUNY at Buffalo, 3435 Main Street, Buffalo, NY 14214. Fax: (716) 829-3106. E-mail: chunglee{at}buffalo.edu.
Received September 25, 2006; accepted November 14, 2006
| ABSTRACT |
|---|
|
|
|---|
The transcriptional activator serum response factor (SRF) is a member of the immediate early gene family known to promote embryonic development, cell growth, and myogenesis through interaction with multiple nuclear protein factors. Previous studies have shown that SRF possesses potent transcriptional activation domains that can interfere with gene expression at artificially high expression levels through "transcriptional squelching." The current work sought to characterize toxicological aspects of SRF-mediated transcriptional squelching. An adenoviral expression system driven by the potent cytomegalovirus promoter was used to achieve up to a 50-fold increase in SRF protein levels. The overexpressed SRF is nuclear localized and interferes with gene expression independent of specific promoter interaction as expected for transcriptional squelching. SRF-mediated squelching elicits robust cell killing affecting multiple cell types including normal and abnormal proliferating cells as well as postmitotic cells such as cardiomyocytes in culture, and the cell killing is more pronounced than that mediated by the tumor suppressor protein p53. Although both the DNA-binding and transcriptional activation domains of SRF are normally required for the physiological roles of SRF, only the transcriptional activation domain is required for cell killing. Unlike c-mycinduced cell killing, squelching-induced cell death does not require serum withdrawal and cannot be effectively attenuated by blocking the caspase and calpain proteolytic pathways or by overexpression of the antiapoptotic gene bcl-xL. These findings suggest transcriptional squelching may be engineered for killing cancer cells, and the SRF gene may represent a novel molecular target for cancer therapeutics.
Key Words: SRF; squelching; cellular toxicity.
| INTRODUCTION |
|---|
|
|
|---|
Over the past decade, adenovirus-based gene expression vectors have been used extensively for gene toxicity studies, and genes explored toward tumor cell killing include tumor-suppressing genes, proapoptotic and suicide genes, and antiangiogenic genes (Cory and Adams, 2005
The transcription machinery functions through an intricate network of general and sequence-specific transcription factors forming dynamic highly regulated multiprotein complexes within the genome. Transcriptional activation in particular hinges on multiple protein interactions directed by DNA sequencespecific transcriptional activators and involving coactivators, basal transcription factors, and RNA polymerase (Ranish and Hahn, 1996
). It has been observed that experimental artifacts can arise from artificially introduced high levels of a potent transcriptional activator causing nonspecific transcriptional suppression, and this phenomenon is often referred to as transcriptional squelching (Gill and Ptashne, 1988
; Natesan et al., 1997
). Transcriptional squelching is thought to result from titration of one or more essential transcription factors present in limiting amounts by the abundance of the overexpressed transcriptional protein activation domain. Although transcriptional squelching can apparently interfere with gene expression and potentially affect normal cell function, little information exists regarding its cellular toxicity.
Serum response factor (SRF) is a potent transcriptional activator known to regulate numerous genes associated with cell growth and differentiation (Chai and Tarnawski, 2002
; Lee et al., 1991
, 1992
; Miano, 2003
). These diverse functions of SRF are mediated in part by the recruitment and activation of various members of the SRF coactivator family such as p62TCF and tissue-specific myocardin/megakaryoblastic leukemia (Cen et al., 2003
; Gille et al., 1992
; Wang et al., 2002
). In addition, SRF is known to interact with many general and sequence-specific transcription factors, highlighting the central role of protein interaction in transcriptional regulation by SRF (Moore et al., 2001
; Ramirez et al., 1997
; Sartorelli et al., 1990
). Indeed, high-level expression of SRF has been shown by us and others to cause abnormal gene suppression through transcriptional squelching (Lee et al., 1992
, 1998
; Prywes and Zhu, 1992
). The work presented here reveals for the first time that SRF-mediated transcriptional squelching exerts severe cytotoxicity, and the extent of cell killing is more pronounced than that mediated by high-level expression of the tumor suppressor gene p53. Consistent with this demonstration, squelching-mediated cytotoxicity is dependent on the transcription activation (or protein interaction) domain but not the DNA-binding domain of SRF. Additional experiments are presented showing that cytotoxicity caused by transcriptional squelching is largely independent of the caspase and calpain proteolytic pathways. Our study suggests that SRF-mediated transcriptional squelching may be engineered as a module for cell killing.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture.
Porcine bone marrowderived mesenchymal stem cells (MSCs) were isolated as described (Vacanti et al., 2005
Recombinant adenovirus.
The recombinant adenovirus expressing the human SRF cDNA (Ad-SRF) was constructed using the pAdEasy-1 system (He et al., 1998
). A HindIII-NotI DNA fragment containing the full-length human SRF cDNA sequence was inserted into the pShuttle-cytomegalovirus (CMV) vector. The recombinant shuttle DNA and pAdEasy-1 DNA were recombined in HEK293 cells. The virus was amplified three rounds in HEK293 cells to yield
109 viral particles per milliliter culture medium. Three SRF deletion mutants (Lee et al., 1992
) were also expressed using the adenovirus system. The SRF DM1 mutant cDNA encoded by an NdeI (Klenow filled)-XbaI DNA fragment was inserted into pShuttle-CMV. The SRF DM3 and DM5 mutant cDNAs each encoded by a KpnI-XbaI DNA fragment were inserted into pShuttle-CMV. Recombinant virus was confirmed by reverse transcriptasepolymerase chain reaction and Western blotting analysis. Ad-p62TCF was constructed by inserting a KpnI-XbaI p62TCF cDNA into pShuttle-CMV. Ad-YAF2 was constructed by inserting a HindIII-EcoRV YAF2 cDNA into pShuttle-CMV. Ad-Hath1/green fluorescence protein (GFP) was provided by Richard Salvi (University at Buffalo). Ad-LacZ was provided by Kirk Hammond (University of California, San Diego). The reporter virus encodes a nuclear-localized ß-galactosidase (Giordano et al., 1996
). Ad-p53 was a gift from Bert Vogelstein (Johns Hopkins University). Ad-IC encodes rat calpastatin, an inhibitor of calpain (IC), and its construction was documented in our previous work (Lin et al., 2004
). Ad-Bcl-xL, which encodes the porcine antiapoptotic protein Bcl-xL, was constructed by inserting a SalI-NotI bcl-xL cDNA fragment into the shuttle vector. For cell infection, viral lysates were diluted 10-fold with serum-free MEM and added to adherent cells for 23 h with occasional agitation, following which cells were washed and maintained in the growth medium.
Plasmid construction.
The pVEGF-Luc vector was provided by Amit Maity (University of Pennsylvania), in which expression of the luciferase gene is driven by an 1.5-kb vascular endothelial growth factor (VEGF) promoter fragment from 1174 to + 338 (Maity et al., 2000
). The c-fos promoterluciferase reporter construct (pFos-Luc) contains a
400-bp c-fos promoter fragment isolated from pFos-Cat using SalI (Klenow filled) and HindIII; the promoter fragment was inserted into pGL2-Basic (Promega, Madison, WI) digested with SmaI and HindIII. The serum response element (pSRE)-Luc contains a synthetic SRE oligonucleotide flanked by KpnI and MluI, which was inserted into the corresponding sites upstream from the thymidine kinase promoter TATA box derived from the vector pBLCAT2 (Luckow and Schutz, 1987
). The top and bottom strands of the SRE oligonucleotides are CCCCTTACACAGGATGTCCATATTAGGACATCTGCGTCAGCAGGA and CGCGTCCTGCTGACGCAGATGTCCTAATATGGACATCCTGTGTAAGGGGGTAC, respectively.
Transient DNA transfection and luciferase assays.
Sol8 myoblasts were plated onto 35-mm dishes on the day before transfection. Cells were first exposed to the adenoviral lysate for 1 h, following which preformed calcium phosphateDNA crystals were added to the dishes. Cells were then incubated with both the virus and DNA crystals for an additional 3 h, following which cells were washed twice and refed with a regular growth medium. Calcium phosphateDNA crystals were prepared as described previously (Lee et al., 1998
). The crystals were allowed to form at room temperature for 1 h prior to being added to the cells. Luciferase assays were performed 20 h after transfection as described (Lee et al., 1998
). Typically 20 µl cell lysate was mixed with 100 µl luciferin solution, and relative light units (RLUs) were recorded for 10 s after mixing by Lumat LB9501. RLUs presented were normalized with total lysate protein concentrations.
MTT cell viability and LDH release assays.
Cells were plated onto 24-well plates (2 x 104 cells/well) in regular growth media for the assays. Protocols for MTT and LDH release assays were as described previously (Chen et al., 1998
). In brief, growth medium containing 0.25 mg/ml MTT was added to each well, and cells were further incubated at 37°C for 20 min, following which the medium was replaced by 0.2 ml dimethyl sulfoxide (DMSO) per well. MTT reduction was determined by measuring the optical density (O.D.)540 nm of the DMSO extracts using DMSO as blank. Cell death as determined by lactic dehydrogenase (LDH) release was performed by mixing 20 µl collected culture medium with 50 µl LDH assay solution in a 96-well plate. The plate was incubated at 37°C for 3060 min, following which the assay was terminated by addition of 50 µl 5% acetic acid to each well. LDH activities in the media were measured at O.D.492 nm. Some error bars were too small to appear on the graph.
In situ staining.
Cells were plated onto glass cover slips placed in 35-mm dishes. Cells were infected after overnight plating and fixed 12 days after viral infection by 4% paraformaldehyde. Fixed cells were immersed in a phosphate-buffered saline (PBS) solution supplemented with 0.2% Triton X-100, 2% horse serum, and 1% bovine serum albumin (BSA) for 1 h at room temperature. Cells were then incubated with SRF antibody (MacLellan et al., 1994
) diluted 200-fold in PBS supplemented with 1% BSA at room temperature for 3 h. After washing, cells were probed with an FITC-conjugated secondary antibody for 1 h. X-gal staining of ß-galactosidase was performed by immersing fixed cells in the substrate solution (60mM Hepes, pH 7.4, 100mM NaCl, 3mM MgCl2, 3mM potassium ferricyanide, 3mM potassium ferrocyanide, and 0.5 mg/ml X-gal) at 37°C for several hours until the blue color appeared. Digital imaging was performed using a Nikon E600 fluorescence microscope.
Western blotting.
Total cellular proteins (typically 2030 µg per lane) were resolved by sodium dodecyl sulfatepolyacrylamide gel electrophoresis and electrotransferred to Immobilon-P membrane as described (Walowitz et al., 1998
). The membrane was first incubated with a 1000-fold diluted primary antibody solution for 3 h followed by washing with a PBS solution supplemented with 0.025% TW-20. Secondary antibodies conjugated with horse radish peroxidase were used to probe blotted membranes, and signals were developed using the chemiluminescent substrate luminol (Pierce Biotechnology, Rockford, IL) and imaged by Fuji imager. The LacZ antibody (clone GAL-40) was purchased from Sigma, St Louis, MO.
| RESULTS |
|---|
|
|
|---|
Adenoviral Expression of SRF
Adenovirus-based vectors have been used extensively for gene transfer and cancer gene therapy (Cory and Adams, 2005
|
Transcriptional Squelching by Adenovirus-Expressed SRF
We next determined whether the recombinant adenovirusintroduced high levels of SRF might interfere with promoter function through transcriptional squelching as observed in previous in vitro and transient transfection assays (Lee et al., 1992
|
Cellular Toxicity Caused by Transcriptional Squelching
We then examined whether SRF-mediated transcriptional squelching might lead to substantial cell death using the MTT cell viability assay (Vacanti et al., 2005
|
Cell Killing Requires the Transcription Activation Domain of SRF
Transcriptional squelching is mediated by protein-protein interaction and is not thought to require direct DNA-protein interaction (Gill and Ptashne, 1988
50-fold increase) for both wild-type and mutant SRF proteins (Fig. 4, middle panel). Secondary SRF protein bands associated with SRF overexpression were most likely caused by cellular protease activities generating proteolytic SRF subfragments.
|
MTT assays revealed that DM5 (lacking the activation domain) failed to elicit cell death as expected (Fig. 4, bottom panel). Interestingly, DM1 (lacking alanine- and glutamate-rich domains) also failed to induce cell death, suggesting the involvement of multiple SRF protein domains outside its DNA-binding domain in cell killing (Fig. 4, bottom panel). Consistent with the notion that transcriptional squelching does not require DNA-protein interaction, DM3 (lacking the DNA-binding domain) still retained its cytotoxicity, although at a reduced potency compared to the wild-type SRF. Thus, an intact DNA-binding domain of SRF appears dispensable for manifestation of cellular toxicity. Further supporting this notion of coupled transcriptional squelching and cell killing is the additional demonstration that DM3, like wild type (WT)-SRF, remained capable of transcriptional squelching (Fig. 5). DM1 and DM5, on the other hand, failed to exhibit transcriptional squelching along with their abolished cytotoxic effect.
|
Minor Role of Caspase and Calpain in Transcriptional SquelchingMediated Cytotoxicity
Cell death can be executed through caspase and/or calpain proteolytic pathways (Cohen, 1997
|
Serum Requirement and Cell-Type Sensitivity
Since serum withdrawal is required for cell death triggered by overexpression of c-myc (Evan et al., 1992
|
|
| DISCUSSION |
|---|
|
|
|---|
The current study documents a hitherto unrecognized mode of cell killing caused by SRF-mediated transcriptional squelching. Although the transcriptional squelching phenomenon was documented previously by others and us (Lee et al., 1992
We conclude that SRF-mediated transcriptional squelching induces potent cell killing by derailing the endogenous transcription machinery independent of promoter DNAbinding events. This squelching phenomenon is associated with introduction of high levels of a potent transcriptional activator into eukaryotic cells and is thought to result from titration of one or more essential transcription factors present in limiting amounts (Gill and Ptashne, 1988
; Natesan et al., 1997
). Along this line, we showed that adenovirus-expressed SRF suppressed rather than activated the activities of the c-fos promoter, and high levels of SRF could repress gene promoters independent of the promoter SRE/CArG element. The DNA-binding domain of SRF is not absolutely required for and multiple SRF protein domains are involved in cell killing. Interestingly, a proline- and glutamine-rich protein was found to promote neuronal cell death (Gomes et al., 1999
). The SRF DM5 mutant lacks the C-terminal transcriptional activation domain, which is also rich in proline and glutamine residues, concurrent with its greatly attenuated cell-killing effect. This transactivation domain of SRF has been shown to physically and functionally interact with the large subunit of TFIIF (Zhu et al., 1994
). We note that p53-mediated squelching has been documented and could be reversed by either excess TFIIB or TFIID (Liu and Berk, 1995
). It would be of interest to determine whether high levels of TFIIF might attenuate cell killing caused by SRF-mediated squelching.
Aside from the basal transcription machinery, numerous sequence-specific transcription factors have been shown to interact with SRF (Chai and Tarnawski, 2002
; Miano, 2003
). The SRF DM1 mutant, failing to kill cells at high-level expression, lacks an N-terminal domain containing tracts of consecutive alanine and glutamate residues, which can represent a unique structural target for protein interactions. The absence of this unique structural domain might weaken SRF-mediated protein interactions, thus also attenuating cell killing. Since the MADS box is sufficient for SRF protein dimerization, DNA binding, and recruitment of ternary complex factors (Norman et al., 1988
), we suggest that transcriptional squelching of ternary complex factors such as p62TCF and myocardin is unlikely to be involved in cell killing. Consistent with this notion, we found that cell death proceeded unabated when SRF and p62TCF were coexpressed in the cell.
Experimental modulation of intracellular SRF levels appears to bear therapeutic implications. For instance, we note that depletion of cardiac SRF by overexpression of antisense SRF sequences could improve the cardiac performance in transgenic mice (Chai and Tarnawski, 2002
). Depletion of SRF by RNA interference could enhance the proliferation and migration rates of vascular smooth muscle cells (Kaplan-Albuquerque et al., 2005
). Whether these observed beneficial effects of reduced SRF levels stem from thwarted transcriptional squelching remains unclear. On the other hand, artificially elevated SRF levels causing massive transcriptional squelching could represent a feasible module for killing cancer cells as demonstrated here. Unlike c-mycinduced cell death, which requires serum withdrawal (Evan et al., 1992
), squelching-induced cell death does not require serum withdrawal. Unlike p53-induced cell death, squelching-induced cell death does not affect expression of bcl-2 (data not shown) and appears more potent than that mediated by p53 overexpression. Squelching-mediated cell killing may be largely necrotic in nature since it could not be effectively intervened by blocking the caspase/calpain proteolytic pathways or fine-tuning the bcl-2 rheostat as shown here. Multiple genes have been explored for killing tumor cells including tumor-suppressing genes, proapoptotic genes, and antiangiogenic genes (Cory and Adams, 2005
; Kaplan, 2005
). We suggest that manipulation of intracellular SRF protein levels may be used as a cell-killing module mediated by transcriptional squelching.
| ACKNOWLEDGMENTS |
|---|
We would like to thank Gail Willsky for providing HIIEC3 hepatoma cells, Kirk Hammond for providing Ad-LacZ, Bert Vogelstein for providing Ad-p53, and Richard Salvi for providing Ad-Hath1. This work was supported by American Heart Association and Biomedical Research Service Center of University at Buffalo.
| REFERENCES |
|---|
|
|
|---|
Bachman AN, Phillips JM, Goodman JI. (2006) Phenobarbital induces progressive patterns of GC-rich and gene-specific altered DNA methylation in the liver of tumor-prone B6C3F1 mice. Toxicol. Sci. 91:393405.
Browning CL, Culberson DE, Aragon IV, Fillmore RA, Croissant JD, Schwartz RJ, Zimmer WE. (1998) The developmentally regulated expression of serum response factor plays a key role in the control of smooth muscle-specific genes. Dev. Biol. 194:1837.[CrossRef][Web of Science][Medline]
Cen B, Selvaraj A, Burgess RC, Hitzler JK, Ma Z, Morris SW, Prywes R. (2003) Megakaryoblastic leukemia 1, a potent transcriptional coactivator for serum response factor (SRF), is required for serum induction of SRF target genes. Mol. Cell. Biol. 23:65976608.
Chai J and Tarnawski AS. (2002) Serum response factor: Discovery, biochemistry, biological roles and implications for tissue injury healing. J. Physiol. Pharmacol. 53:147157.[Web of Science][Medline]
Chen SJ, Bradley ME, Lee TC. (1998) Chemical hypoxia triggers apoptosis of cultured neonatal rat cardiac myocytes: Modulation by calcium-regulated proteases and protein kinases. Mol. Cell. Biochem. 178:141149.[CrossRef][Web of Science][Medline]
Cohen GM. (1997) Caspases: The executioners of apoptosis. Biochem. J. 326:116.
Cory S and Adams JM. (2005) Killing cancer cells by flipping the Bcl-2/Bax switch. Cancer Cell 8:56.[CrossRef][Web of Science][Medline]
Ekert PG, Silke J, Vaux DL. (1999) Caspase inhibitors. Cell Death Differ. 6:10811086.[CrossRef][Web of Science][Medline]
Evan GI, Wyllie AH, Gilbert CS, Littlewood TD, Land H, Brooks M, Waters CM, Penn LZ, Hancock DC. (1992) Induction of apoptosis in fibroblasts by c-myc protein. Cell 69:119128.[CrossRef][Web of Science][Medline]
Gill G and Ptashne M. (1988) Negative effect of the transcriptional activator GAL4. Nature 334:721724.[CrossRef][Medline]
Gille H, Sharrocks AD, Shaw PE. (1992) Phosphorylation of transcription factor p62TCF by MAP kinase stimulates ternary complex formation at c-fos promoter. Nature 358:414421.[CrossRef][Medline]
Giordano FJ, Ping P, McKirnan MD, Nozaki S, DeMaria AN, Dillmann WH, Mathieu-Costello O, Hammond HK. (1996) Intracoronary gene transfer of fibroblast growth factor-5 increases blood flow and contractile function in an ischemic region of the heart. Nat. Med. 2:534539.[CrossRef][Web of Science][Medline]
Gomes I, Xiong W, Miki T, Rosner MR. (1999) A proline- and glutamine-rich protein promotes apoptosis in neuronal cells. J. Neurochem. 73:612622.[CrossRef][Web of Science][Medline]
He T-C, Zhou S, Da Costa LT, Yu J, Kinzler KW, Vogelstein B. (1998) A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. U.S.A. 95:25092514.
Hockenbery D, Nunez G, Milliman C, Schreiber RD, Korsmeyer SJ. (1990) Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 348:334336.[CrossRef][Medline]
Johansen F-E and Prywes R. (1993) Identification of transcriptional activation and inhibitory domains in serum response factor (SRF) by using GAL4-SRF constructs. Mol. Cell. Biol. 13:46404647.
Kalenik JL, Chen D, Bradley ME, Chen SJ, Lee TC. (1997) Yeast two-hybrid cloning of a novel zinc finger protein that interacts with the multifunctional transcription factor YY1. Nucleic Acids Res. 25:843849.
Kaplan-Albuquerque N, Van Putten V, Weiser-Evans MC, Nemenoff RA. (2005) Depletion of serum response factor by RNA interference mimics the mitogenic effects of platelet derived growth factor-BB in vascular smooth muscle cells. Circ. Res. 97:427433.
Kaplan JM. (2005) Adenovirus-based cancer gene therapy. Curr. Gene Ther. 5:595605.[CrossRef][Web of Science][Medline]
Kositprapa C, Zhang B, Berger S, Canty JMJ, Lee TC. (2000) Calpain-mediated proteolytic cleavage of troponin I induced by hypoxia or metabolic inhibition in cultured neonatal cardiomyocytes. Mol. Cell. Biochem. 214:4755.[CrossRef][Web of Science][Medline]
Lee JE. (1997) Basic helix-loop-helix genes in neural development. Curr. Opin. Neurobiol. 7:1320.[CrossRef][Web of Science][Medline]
Lee TC, Bradley ME, Walowitz JL. (1998) Influence of promoter potency on the transcriptional effects of YY1, SRF and Msx-1 in transient transfection analysis. Nucleic Acids Res. 26:32153220.
Lee TC, Chow KL, Fang P, Schwartz RJ. (1991) Activation of skeletal
-actin gene transcription: The cooperative formation of serum response factor-binding complexes over positive cis-acting promoter serum response elements displaces a negative-acting nuclear factor enriched in replicating myoblasts and nonmyogenic cells. Mol. Cell. Biol. 11:50905100.
Lee TC, Shi Y, Schwartz RJ. (1992) Displacement of BrdUrd-induced YY1 by serum response factor activates skeletal
-actin transcription in embryonic myoblasts. Proc. Natl. Acad. Sci. U.S.A. 89:98149818.
Leri A, Liu Y, Malhotra A, Li Q, Stiegler P, Claudio PP, Giordano A, Kajstura J, Hintze TH, Anversa P. (1997) Pacing-induced heart failure in dogs enhances the expression of p53 and p53-dependent genes in ventricular myocytes. Circulation 97:194203.
Lin H, Risbood MP, Jain A, Vacanti V, Lee T. (2004) Role and differential expression of calpastatin mRNA and protein in cultured cardiomyocytes exposed to hypoxic stress. Mol. Cell. Biochem. 265:6370.[CrossRef][Web of Science][Medline]
Liu X and Berk AJ. (1995) Reversal of in vitro p53 squelching by both TFIIB and TFIID. Mol. Cell. Biol. 15:64746478.
Luckow B and Schutz G. (1987) CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res. 15:5490.
MacLellan WR, Lee TC, Schwartz RJ, Schneider MD. (1994) Transforming growth factor-ß response elements of the skeletal
-actin gene. J. Biol. Chem. 269:1675416760.
Maity A, Pore N, Lee J, Solomon D, O'Rourke DM. (2000) Epidermal growth factor receptor transcriptionally up-regulates vascular endothelial growth factor expression in human glioblastoma cells via a pathway involving phosphatidylinositol 3'-kinase and distinct from that induced by hypoxia. Cancer Res. 60:58795886.
Mampuru LJ, Chen SJ, Kalenik JL, Bradley ME, Lee TC. (1996) Analysis of events associated with serum deprivation-induced apoptosis in C3H/Sol8 muscle satellite cells. Exp. Cell Res. 226:372380.[CrossRef][Web of Science][Medline]
Miano JM. (2003) Serum response factor: Toggling between disparate programs of gene expression. J. Mol. Cell. Cardiol. 35:577593.[CrossRef][Web of Science][Medline]
Misra RP, Rivera VM, Wang JM, Fan PD, Greenberg ME. (1991) The serum response factor is extensively modified by phosphorylation following its synthesis in serum-stimulated fibroblasts. Mol. Cell. Biol. 11:45454554.
Miyashita T, Krajewski S, Krajewska M, Wang HG, Lin HK, Liebermann DA, Hoffman B, Reed JC. (1994) Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene 9:17991805.[Web of Science][Medline]
Moore ML, Wang GL, Belaguli NS, Schwartz RJ, McMillin JB. (2001) GATA-4 and serum response factor regulate transcription of the muscle-specific carnitine palmitoyltransferase I beta in rat heart. J. Biol. Chem. 276:10261033.
Natesan S, Rivera VM, Molinari E, Gilman M. (1997) Transcriptional squelching re-examined. Nature 390:349350.[Medline]
Norman C, Runswick M, Pollock R, Treisman R. (1988) Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell 55:9891003.[CrossRef][Web of Science][Medline]
Peraza MA, Burdick AD, Marin HE, Gonzalez FJ, Peters JM. (2006) The toxicology of ligands for peroxisome proliferator-activated receptors (PPAR). Toxicol. Sci. 90:269295.
Prendergast GC. (1999) Mechanisms of apoptosis by c-Myc. Oncogene 18:29672987.[CrossRef][Web of Science][Medline]
Prywes R and Zhu H. (1992) In vitro squelching of activated transcription by serum response factor: Evidence for a common coactivator used by multiple transcriptional activators. Nucleic Acids Res. 20:513520.
Ramirez S, Ait-Si-Ali S, Robin P, Trouche D, Harel-Bellan A. (1997) The CREB-binding protein (CBP) cooperates with the serum response factor for transactivation of the c-fos serum response element. J. Biol. Chem. 272:3101631021.
Ranish JA and Hahn S. (1996) Transcription: Basal factors and activation. Curr. Opin. Genet. Dev. 6:151158.[CrossRef][Web of Science][Medline]
Sartorelli V, Webster KA, Kedes L. (1990) Muscle-specific expression of the cardiac alpha-actin gene requires MyoD1, CArG-box binding factor, and Sp1. Genes Dev. 4:18111822.
Shaw PE, Schroter H, Nordheim A. (1989) The ability of a ternary complex to form over the serum response element correlates with serum inducibility of the human c-fos promoter. Cell 56:563572.[CrossRef][Web of Science][Medline]
Soulez M, Rouviere CG, Chafey P, Hentzen D, Vandromme M, Lautredou N, Lamb N, Kahn A, Tuil D. (1996) Growth and differentiation of C2 myogenic cells are dependent on serum response factor. Mol. Cell. Biol. 16:60656074.
Spencer JA and Misra RP. (1999) Expression of the SRF gene occurs through a Ras/Sp/SRF-mediated-mechanism in response to serum growth signals. Oncogene 18:73197327.[CrossRef][Web of Science][Medline]
Squier MK, Miller AC, Malkinson AM, Cohen JJ. (1994) Calpain activation in apoptosis. J. Cell. Physiol. 159:229237.[CrossRef][Web of Science][Medline]
Vacanti V, Kong E, Suzuki G, Sato K, Canty JM Jr, Lee T. (2005) Phenotypic changes of adult porcine mesenchymal stem cells induced by prolonged passaging in culture. J. Cell. Physiol. 205:194201.[CrossRef][Web of Science][Medline]
Walowitz JL, Bradley ME, Chen SJ, Lee TC. (1998) Proteolytic regulation of the zinc finger transcription factor YY1, a repressor of muscle-restricted gene expression. J. Biol. Chem. 273:66566661.
Wang DZ, Li S, Hockemeyer D, Sutherland L, Wang Z, Schratt G, Richardson JA, Nordheim A, Olson EN. (2002) Potentiation of serum response factor activity by a family of myocardin-related transcription factors. Proc. Natl. Acad. Sci. U.S.A. 99:1485514860.
Zhang X, Azhar G, Chai J, Sheridan P, Nagano K, Brown T, Yang J, Khrapko K, Borras AM, Lawitts J, et al. (2001a) Cardiomyopathy in transgenic mice with cardiac-specific overexpression of serum response factor. Am. J. Physiol. Heart Circ. Physiol. 280:H1782H1792.
Zhang X, Chai J, Azhar G, Sheridan P, Borras AM, Furr MC, Khrapko K, Lawitts J, Misra RP, Wei JY. (2001b) Early postnatal cardiac changes and premature death in transgenic mice overexpressing a mutant form of serum response factor. J. Biol. Chem. 276:4003340040.
Zhu H, Joliot V, Prywes R. (1994) Role of transcription factor TFIIF in serum response factor-activated transcription. J. Biol. Chem. 269:34893497.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. Genin, R. Lin, J. Hiscott, and A. Civas Differential Regulation of Human Interferon A Gene Expression by Interferon Regulatory Factors 3 and 7 Mol. Cell. Biol., June 15, 2009; 29(12): 3435 - 3450. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








