ToxSci Advance Access originally published online on March 22, 2007
Toxicological Sciences 2007 97(2):520-532; doi:10.1093/toxsci/kfm062
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Time-Dependent and Compartment-Specific Effects of In Utero Exposure to Di(n-butyl) Phthalate on Gene/Protein Expression in the Fetal Rat Testis as Revealed by Transcription Profiling and Laser Capture Microdissection
* CXR Biosciences Ltd, James Lindsay Place, Dundee Technopole, Dundee DD1 5JJ, UK
Medical Research Council Human Reproductive Sciences Unit, Queen's Medical Research Institute, 47 Little France Crescent, Edinburgh EH16 4TJ, UK
1 To whom correspondence should be addressed. Fax: +44-1382432153. E-mail: simonplummer{at}cxrbiosciences.com.
Received December 21, 2006; accepted March 15, 2007
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
We undertook transcription profiling of fetal testis RNA on gestational days e15.5, 17.5, and 19.5 in offspring from dams treated daily from e12.5 with 500 mg/kg di(n-butyl) phthalate (DBP). At e17.5–19.5, reduced expression of genes involved in cholesterol uptake/metabolism and steroidogenesis was identified in DBP-exposed animals, including scavenger receptor B1 (SCARB1), HMGCoA synthase, steroidogenic acute regulatory protein, Cyp11a, and Cyp17. Genes encoding inhibin-
, phosphatidylethanolamine-binding protein (PEBP), and cellular retinoic acid–binding protein 2 (CRABP2) were also downregulated. Most of the aforementioned genes are regulated by steroidogenic factor 1 (SF1) but no consistent change in SF1 mRNA or protein expression was detected. Expression of the aforementioned genes was unaffected at e15.5, but expression of other genes was significantly altered (mostly upregulated). To gain further insight, RNA from interstitial (INT) and seminiferous cord (CORD) tissue obtained by laser capture microdissection (e19.5) was used for transcription profiling. This confirmed most gene expression changes identified for whole testes, but some were remarkably compartment specific. Inhibin-, PEBP, and CRABP2 gene expression were all downregulated in INT but not in CORD, as confirmed by immunohistochemistry; similarly, SCARB1 was downregulated 4.6-fold in INT but only 2.3-fold in CORD. DBP-induced gene expression changes specific to CORD involved small magnitude (less than twofold) reductions or upregulation. These results extend earlier findings and point to the Leydig cells as a primary target of DBP-induced dysfunction. The observed gene expression changes, and their compartmentalization, suggest a possible role for peroxisome proliferator-mediated alteration of cofactor availability as a mechanism underlying DBP-induced Leydig cell dysfunction. Key Words: testicular dysgenesis syndrome; di(n-butyl) phthalate; Leydig cell; Sertoli cell; microarray analysis.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Human males exhibit a high, and in some cases increasing, incidence of reproductive disorders (cryptorchidism, hypospadias, low sperm counts, testicular germ cell cancer) that are suggested to constitute a testicular dysgenesis syndrome (TDS), with a common origin in fetal life (Skakkebaek et al., 2001
). TDS disorders are hypothesized to result from dysfunction of the Leydig and/or Sertoli cells of the fetal testis, which in turn result from dysgenesis, which may have several causes. In laboratory rats, a TDS-like syndrome can be induced in male offspring by treatment in late pregnancy with high doses of certain phthalate esters, notably di(n-butyl) phthalate (DBP) or diethylhexyl phthalate (DEHP) (Barlow and Foster 2003; Fisher et al., 2003; Mylchreest et al., 1999; Parks et al., 2000). Such treatment causes profound inhibition of fetal testicular testosterone levels through downregulation of the expression of genes involved in cholesterol uptake, transport and conversion into testosterone (Barlow et al., 2003; Lehmann et al., 2004; Shultz et al., 2001). This effect is thought to underlie the development of hypospadias (Barlow and Foster 2003; Mylchreest et al., 1998, 2000), decrease in anogenital distance (Borch et al., 2003; Mylchreest et al., 1999; Parks et al., 2000), and nipple retention (Borch et al., 2003; Mylchreest et al., 1999; Parks et al., 2000) found in male offspring of DBP/DEHP-exposed dams. Suppression of testosterone, in combination with suppression of insulin-like factor 3 (Insl3), is also thought to account for the high incidence of cryptorchidism in rats exposed in utero to DBP or DEHP (Barlow and Foster, 2003; Fisher et al., 2003; Mylchreest et al., 1998, 1999; Wilson et al., 2004). However, other effects of fetal exposure to DBP/DEHP, such as induction of multinucleated gonocytes and formation of dysgenetic areas and germ cell–depleted tubules (Barlow and Foster, 2003; Borch et al., 2005; Fisher et al., 2003; Kleymenova et al., 2005; Parks et al., 2000) involve changes in the seminiferous cords (CORDs) which presumably result from dysfunction of the Sertoli cells and/or gonocytes (Fisher et al., 2003; Kleymenova et al., 2005). In vitro studies have demonstrated that phthalates can have a direct effect on adult Leydig cell function (Akingbemi et al., 2001), but it is unknown if the same applies to fetal Leydig cells. However, whether the primary effect of DBP/DEHP on the fetal rat testis is on Leydig cells, cells of the CORDs, or both compartments is still to be resolved.
One approach to elucidating the mechanisms via which DBP/DEHP perturbs fetal testis development and function is to undertake gene expression profiling using microarrays. A number of such studies have been undertaken in whole fetal testes from rats exposed in utero to DBP/DEHP (Barlow et al., 2003; Lehmann et al., 2004; Liu et al., 2005; Shultz et al., 2001). As well as confirming reduced expression of genes involved in cholesterol transport and steroidogenesis, referred to above, these have identified other gene expression changes, including changes in early response genes (Thompson et al., 2005). A recent study has indicated that the initial response of both fetal and prepubertal testis to phthalate exposure may share a common genetic mechanism (Lahousse et al., 2006). However, these studies have still not resolved whether the primary effect of DBP, when administered from e12.5, is on Leydig and/or Sertoli cells (or on germ cells) and, because the reported analyses have been restricted to e19.5 or later, it is possible that unique changes in gene expression earlier in gestation may have been missed. The present studies were undertaken to address these deficiencies in understanding by using gene expression profiling to (1) identify the earliest time point at which DBP-induced changes in gene expression in the fetal testis were detectable and then (2) utilize laser capture microdissection to delineate the compartment (interstitium or CORDs) in which these gene expression changes occurred. Real-time reverse transcription–polymerase chain reaction (RT-PCR) and/or Westerns/immunohistochemistry were used to confirm key changes in gene/protein expression, respectively. The results obtained from these combined approaches have yielded important new insights by demonstrating compartment-specific effects of DBP exposure on gene expression, leading to the construction of a mechanistic hypothesis by which DBP might induce Leydig cell dysfunction via sequestration of cofactors utilized by several key signaling pathways.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Animals, treatments, sample collection, and processing.
Wistar rats (Harlan UK Limited, Oxon, UK) were maintained at the University of Dundee's Biological Sciences Resource Unit according to U.K. Home Office guidelines and were fed a soy-free breeding diet (RM3; Special Diet Services Ltd., Essex, UK). Female rats were housed three per cage on sawdust in solid-bottom, polypropylene cages and were allowed to acclimatize for a period of at least 10 days before use. Time-mated females (n = 30) were treated with vehicle (control) or 500 mg/kg DBP (Sigma-Aldrich Co. Ltd, Dorset, UK) in 1 ml/kg corn oil administered daily by oral gavage from embryonic day e12.5 until the day prior to sample. The DBP administered was 99% pure according to the supplier.
Control and DBP-treated pregnant dams were killed by inhalation of carbon dioxide on e15.5 (n = 5 control, n = 5 DBP), e17.5 (n = 5, n = 5) and e19.5 (n = 5, n = 5). Fetuses were removed, decapitated, and placed in ice-cold phosphate-buffered saline (PBS; Sigma-Aldrich Co. Ltd). Testes were removed via microdissection and (1) snap frozen in liquid nitrogen, (2) immersed in RNAlater (Ambion Ltd, Huntington, UK) at 4°C, or (3) fixed for 4 h in Bouins, and then transferred to 70% ethanol and stored at 4°C. Bouins fixed tissue was processed into paraffin wax using standard methods. Representative fetuses from the aforementioned litters were subsequently used for the microarray and immunohistochemical studies detailed below.
Immunohistochemistry.
Specific proteins were detected by immunohistochemistry using standard methods that have been detailed previously (Fisher et al., 2003). Immunohistochemistry for CRABP2 used antigen retrieval by pressure cooking slides for 5 min in 0.05M glycine buffer containing 0.01% ethylenediaminetetraacetic acid (EDTA; VWR International, Leicestershire, UK) at pH 4.0. Antigen retrieval was also required for immunohistochemistry for both steroidogenic factor 1 (SF1) and inhibin-; however, for these antibodies, slides were pressure cooked for 5 min in 0.01M citrate buffer (pH 6.0). Nonspecific binding sites were blocked with an appropriate normal serum diluted 1:5 in tris-buffered saline (TBS) containing 5% bovine serum albumin (Sigma) before the addition of the primary antibody and overnight incubation at 4°C. The primary antibodies and their dilutions used in the present studies were as follows: rabbit anti-Cyp11a (1:200; Chemicon International Inc., Temecula, CA), rabbit anti-SF1 (1:500; Upstate, Milton Keynes, UK), goat anti–antimüllerian hormone (AMH) (1:80; Santa Cruz Biotechnology Inc., Santa Cruz, CA), mouse anti-Inhibin- (1:1000; gift from N. Groome, Oxford, UK), goat anti-CRABP2 (1:200; Santa Cruz Biotechnology Inc.), and rabbit anti-phosphatidylethanolamine-binding protein (PEBP) (1:100; gift from Y. Goumon, Strasbourg, France). For detection, the appropriate biotin-conjugated secondary antibody was added at a dilution of 1:500 (rabbit anti-goat, swine anti-rabbit, rabbit anti-mouse; Dako, Cambridgeshire, UK). The biotinylated antibody was linked to horseradish peroxidase (HRP) by 30 min incubation with avidin-biotin-HRP complex (Dako). Antibody localization was determined by application of diaminobenzidine (liquid DAB+; Dako) until staining in control sections was optimal, when the reaction was stopped by immersing slides in distilled water. Slides were counterstained with hematoxylin, dehydrated, and mounted using Pertex mounting media (Cell Path, Hemel Hempstead, UK). To ensure the reproducibility of findings, tissue sections from four to five animals at each age or treatment group were evaluated, and this was performed on at least two separate occasions.
Image capture.
Images were examined and photographed using a Provis microscope (Olympus Optical, London, UK) fitted with a DCS330 digital camera (Eastman Kodak, Rochester, NY). Images were compiled using Photoshop 7.0 (Adobe Systems Inc. Mountain View, CA).
Extraction of testis protein.
Protein was extracted from fetal testes from pups from control (n = 3) and DBP-exposed (n = 3) dams at e19.5 and snap frozen. Frozen tissue was transferred to 1.5-ml eppendorf tubes on ice, to which was added 200 µl ice-cold lysis buffer comprising 0.05M Tris-HCl (pH 7.4), 0.15M NaCl, 0.005M EDTA, 0.1% (wt/vol) sodium dodecyl sulphate (SDS), and 1% (wt/vol) sodium deoxycholate in which was dissolved one tablet of Complete protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany) per 10 ml. Tissue was homogenized and kept on ice for 60 min. The homogenate was then centrifuged at 10,000 rpm for 5 min at 4°C and the supernatant removed. Before storage at – 80°C, a small aliquot of supernatant was removed and protein concentration measured using the bicinchoninic acid protein assay (Pierce, Rockford, USA) according to manufacturer's instructions. All samples were assayed in triplicate.
Western blotting.
Testis protein extracts from e19.5 control and DBP-exposed animals were boiled for 5 min in buffer comprising 50mM Tris-HCL (pH 6.8), 100mM dithiothreitol, 2% (wt/vol) SDS (all Sigma), 10% (vol/vol) glycerol (VWR), and 0.002% (wt/vol) Bromophenol blue (Bio-Rad Laboratories, Hemel Hempstead, UK) before loading 10 µg of protein per lane onto a 10% (vol/vol) NuPage gel (Invitrogen, Carlsbad, USA). Samples were electrophoresed using a Xcell Surelock Mini-Cell electrophoresis tank (Invitrogen) at 200 V for 35 min, and gels were then transferred into transfer buffer (Invitrogen) with 20% (vol/vol) methanol (VWR) and blotted onto a polyvinyl difluoride membrane (Immobilon-P; Millipore, Watford, UK) using a Xcell II Blot Module (Invitrogen) run at 45 V for 4 h. Membranes were blocked for 1 h at room temperature in TBS containing 0.1% (vol/vol) Tween 20 (TBST; Sigma) and 5% (wt/vol) skimmed milk powder and then incubated overnight at 4°C with SF1 antibody diluted 1:500 in the blocking mixture. The membranes were washed extensively in TBST and then incubated for 1 h at room temperature with peroxidase-conjugated anti-rabbit IgG diluted 1:2000 in TBST. After further washing in TBST, bound antibodies were detected using an ECLplus system and Hyperfilm exposure (both Amersham Biosciences, Little Chalfont, UK) according to manufacturer's instructions.
RNA extraction and quantification.
Whole fetal testes were homogenized for 2 min at high speed in a microcentrifuge using QIAshredder mini spin columns (Qiagen Ltd, West Sussex, UK). Total RNA was extracted from whole fetal testes using the RNeasy mini kit (Qiagen Ltd) according to manufacturer's instructions, incorporating a DNase treatment step to minimize genomic contamination. RNA from laser capture microdissected tissue was extracted using the RNeasy micro kit (Qiagen Ltd). RNA quality and concentration were determined by assays from the RNA 6000 Nano (whole testis RNA extracts) and Pico (microdissected RNA extracts) Labchip kits (Agilent technologies UK Ltd., Cheshire, UK) used with an RNA ladder (Ambion Ltd) and analyzed on an Agilent 2100 Bioanalyzer.
Laser capture microdissection.
Laser capture microdissection was performed at PALM Microlaser Technologies (Bernried, Germany). Snap-frozen e19.5 testes from control and DBP-exposed animals (n = 3 from three different litters in both cases) were mounted in optimal cutting temperature freezing medium (Medite GmbH, Burgdorf, Germany) in a Cryostat (Microm HM500, Walldorf, Germany). Sections of 12 µm were cut and mounted on RNase-free PALM membrane slides (PALM) and fixed in ice-cold 70% ethanol. Testis sections were then hydrated for 10 s in diethylpyrocarbonate-treated tap water, stained for 1 min in hematoxylin, washed for 1 min in tap water, dehydrated by dipping sequentially in ice-cold 70 and 100% ethanol and then air dried. Laser capture microdissection was then performed on a PALM Microbeam (PALM). Briefly, only microscopically clearly definable CORD or interstitial (INT) regions were outlined for laser microdissection and pressure catapulting (Fig. 1). The laser cutting power was set to physically separate wanted from unwanted tissue areas and therefore ensure pure samples. Samples were created by pooling the defined areas from up to 10 serial sections of single testes from one animal until the required amount was obtained. RNA was extracted from the laser capture microdissected samples as outlined above.
|
RNA labeling for microarray analysis.
RNA was labeled using the Agilent Low Input Linear Amplification Labeling Kit according to manufacturer's instructions. Briefly, 20–50 ng fetal testes RNA was used as a template to synthesize cDNA using T7 primer and MMLV-RT and a master mix cDNA synthesis buffer containing: 5x first strand buffer, 0.1M dithiothreitol, 10mM dNTPs, MMLV-RT, and RNaseOUT. Following inactivation of the MMLV-RT enzyme, the cDNA synthesis reaction was divided in two and labeled cRNA was generated by adding cyanine-3 cytidine triphospate (CTP) (Cy3) or cyanine-5 CTP (Cy5), T7RNA polymerase, and transcription master mix. The specific activity of the labeled cRNA was measured using the microarray analysis program on a NanoDrop ND1000 spectrophotometer (Montchanin, USA).
Microarray experimental procedure.
Microarray analysis used labeled RNA from whole testes at e15.5, 17.5, or 19.5 or laser-captured INT and CORD regions from e19.5 testes. RNA isolated from testes of three different pups from three different control or DBP-treated dams were used for the microarray analysis. A reference RNA sample comprising a pool of RNA isolated from three testes from different control litters, from whole testes (e15.5, 17.5, or 19.5), CORD or INT regions, was used for this analysis. RNA samples from three DBP-treated litters were hybridized against the corresponding reference RNA from control litters at each time point. The use of a pool of RNA samples from control animals is the optimal design for the detection of gene expression changes related to DBP treatment because it minimizes error caused by biological variation in the expression level of genes in the control group. A "dye swap" which involves switching labeling of the test and control RNAs with Cy3 or Cy5 in duplicates was also performed. This was necessary to control for bias toward greater incorporation of Cy3 (smaller molecule) than Cy5 when these dyes are included in labeling reactions. Microarray analysis with whole fetal testis RNA was performed using Agilent 22K rat oligonucleotide arrays (Agilent #G4110A). Regional microarray analysis on RNA isolated from laser capture microdissected fetal testis tissue was performed using Agilent 44K whole-rat genome oligonucleotide microarrays (Agilent #G4131A).
Microarray data analysis and bioinformatics.
Genes that were significantly (p < 0.01) altered in their expression were selected by Agilent feature extraction (v7.1) software using an Agilent error model (Agilent Feature Extraction User Manual G2566-90012). Rosetta Luminator software (Rosetta Biosoftware, Kirkland, USA) was used to generate "signature" lists of significantly (p < 0.01) regulated genes from replicate microarray hybridizations by performing a one-way ANOVA on log fold change (log ratio) values in the replicates. This process removed dye swap artifacts. The compare biosets' function in Luminator was used to compare signature lists from different fetal testis regions. Signature gene lists including Genbank accession numbers and log fold change values were loaded into Ingenuity Pathways Analysis software for pathways analysis. The microaray data for this study is held publically in the Array Express database (http://www.ebi.ac.uk/arrayexpress) under accession numbers E-TABM-200 and E-TABM-201.
Real-time RT-PCR analysis.
Real-time RT-PCR analysis was performed on RNA from e19.5 testes using sequence-specific primers for SF1, steroidogenic acute regulatory protein (StAR), Cyp11a, and Insl3. The forward and reverse primers were as follows: SF1 forward primer (GCCTCTGGCTGGCTACCTCTA); SF1 reverse primer (GCGTAGGGCTGGCTACCTCTA); StAR forward primer (AGCCAGCAGGAGAATGGAGAT); StAR reverse primer (CACCTCCAGTCGGAACACCTT); Cyp11a forward primer (GGGCAACATGGAGTCAGTTTACA); Cyp11a reverse primer (GACCCTCGCAGGAGAAGAGA); Insl3 forward primer (TGGCCACCAACGCTGTG); and Insl3 reverse primer (ACCCAAAAGGTCTTGCTGGG).
PCR products were quantified using 3' TAMRA (tetramethylrhodamine) 5'FAM (6-FAM) end-labeled probes as follows: SF1, CCTGCCTTCTCTAACCGCACCATCAAG; StAR, AAGTGCTAAGTAAGGTGGTGCCAGGTGTGG; Cyp11a, CCTGGCCCCTAAGGACGCAGCGA; and Insl3, ACCGCTGCTGTCTCACTGGCTGC.
Statistical analysis.
Data for real-time RT-PCR of e19.5 fetal testes are expressed as mean ± SEM and were analyzed using one-way ANOVA followed by the Bonferroni posttest, using GraphPad Prism (Version 4, GraphPad Software Inc., San Diego, CA).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Effects of In Utero Exposure to DBP on Gene Expression in Whole Testes
In utero exposure to DBP caused significant changes in gene expression at e15.5, 17.5, and 19.5 (Table 1). Significantly altered genes (signature genes) identified by microarray analysis at e15.5 were involved in lipid metabolism, redox homeostasis, cellular proliferation, and apoptosis. Pathway analysis of significantly altered genes identified by microarray analysis at e17.5 and e19.5 indicated that DBP affected four main gene clusters: (1) steroidogenesis, (2) lipid metabolism, (3) cholesterol synthesis, uptake and transport, and (4) redox homeostasis. None of the genes involved in cholesterol uptake/metabolism or steroidogenesis that were downregulated in DBP-exposed animals at e17.5 and e19.5 were affected significantly at e15.5 (Table 1).
|
Effects of DBP Exposure on Gene Expression in Specific Testis Compartments at e19.5
To determine whether the effect of DBP on gene expression was targeted to a specific compartment of the testis, microarray analysis of RNA extracted from laser capture microdissected INT and CORD regions was evaluated.
Region-specific regulated genes were assigned to pathways relevant to the process of testicular development. Genes involved in steroidogenesis, cholesterol synthesis, fatty acid oxidation, testes morphogenesis, and descent were uniquely altered in the INT compartment (Table 2). In contrast, genes involved in chromatin bending, phagocytosis, and stress response were uniquely altered in the CORD region (Table 2). Genes that were commonly altered by DBP in both INT and CORD compartments of the testis were associated with steroidogenesis, cholesterol transport, cellular metabolism, and cell/tissue assembly (Table 2).
|
DBP Effects on SF1-Regulated Genes
Ten of the genes downregulated by DBP treatment, namely sterol carrier protein 2 (SCP2), scavenger receptor B1 (SCARB1), StAR, cytochrome P450 side chain cleavage enzyme (Cyp11a), cytochrome P450 17
-hydroxylase/17-20 lyase (Cyp17), 3-hydroxy-3-methylglutaryl-Coenzyme A synthase (HMGCS1), 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGCR1), sterol-C4-methyl oxidase (SC4MOL), inhibin- (INHA), nuclear receptor subfamily 0, group B, member 1 (NROB1/DAX1), and insulin-like factor 3 (Insl3) were all regulated by nuclear receptor subfamily 5, group A, member1 (NR5A1) also known as SF1. SF1 expression was also slightly downregulated at e19.5 only (Table 1). All the SF1-regulated genes that were downregulated, apart from Cyp17, were selectively affected in the INT region (Table 2). Downregulation of several SF1-regulated genes, including Cyp11a (data not shown), inhibin-, was shown by immunohistochemical staining to be markedly reduced at the protein level in Leydig cells, whereas expression in Sertoli cells/CORDs remained unchanged (Fig. 2). Cellular retinoic acid–binding protein 2 (CRAPB2) and PEBP, which were identified by regional microarray analysis to be selectively repressed at the RNA level, were also shown by immunohistochemistry to be downregulated at the protein level in a regionally selective manner (Fig. 2). In contrast, immunohistochemical staining for AMH, which is also SF1 regulated, showed a small increase in intensity (compared to control) at e19.5 in testes in Sertoli cells of testes from DBP-exposed males (Fig. 2).
|
To explore the effect of DBP on SF1-regulated genes, further real-time RT-PCR was used to quantify expression of SF1 and SF3 genes regulated by it in e19.5 testes from four DBP-exposed litters in comparison to four controls (Fig. 3). This confirmed that expression of StAR and Insl3 were significantly (p < 0.05) reduced in all four DBP-exposed litters at e19.5 while expression of Cyp11a was significantly reduced in three of the four litters. Although expression of SF1 mRNA was not itself significantly reduced by DBP exposure, fluctuations in SF1 RNA levels in individual litters correlated with those of the SF1-regulated genes StAR, Cyp11a, and Insl3 (Fig. 3). Western blot analysis of SF1 protein levels in whole e19.5 testes showed that the effect of DBP on SF1 RNA was not evident at the protein level and no consistent effect on SF1 protein expression in the nuclei of Sertoli or Leydig cells was detected by immunohistochemistry (Fig. 4).
|
|
In order to identify genes that were coordinately regulated by SF1 in a time-dependent manner, time plots of SF1-regulated gene expression were constructed using Luminator software. This indicated that expression of inhibin-
, SRB1, StAR, SCP2, HMGCS1, Cyp11a, and Cyp17 were coordinately downregulated between e15.5 and e19.5 in DBP-exposed animals in a time-dependent fashion (Fig. 5). There were also several SF1-regulated genes namely follicle-stimulating hormone receptor (FSHR), aromatase (Cyp19), and antimüllerian hormone receptor type 2 (AMHR2) that were not altered across the three time points (Fig. 5).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Fetal exposure of male rats to certain phthalates, such as DBP and DEHP, induces profound adverse effects on cell distribution and function in the testis, especially on the Leydig cells (see the introduction for references), but the primary sites and mechanisms of action of DBP remain unclear. The present studies used expression profiling across a 6-day period of DBP exposure coupled with laser capture microdissection at e19.5 to address these issues. Results obtained using this approach have largely confirmed earlier microarray analyses of gene expression changes in testes of rats exposed in utero to DBP (Barlow et al., 2003
; Lehmann et al. 2004; Liu et al., 2005; Shultz et al., 2001), in particular the downregulation of genes such as SCARB1, StAR, Cyp11a, and Cyp17, that are presumed to account for the DBP-induced suppression of steroidogenesis (Shultz et al., 2001; Thompson et al., 2004). Our data also confirm earlier studies in showing that DBP exposure also downregulates antioxidant genes and insulin-signaling genes (Barlow and Foster, 2003). However, the important new findings to have emerged from the present study are that expression of at least 10 SF1-regulated genes is downregulated following DBP exposure and that these changes selectively affect the INT compartment, presumably the Leydig cells. Our analyses suggest that this downregulation is indirect, perhaps involving cofactor starvation, as there was no major, consistent decrease in SF1 protein expression in Leydig cells/testes of DBP-exposed animals. Our microarray analyses also show that none of the DBP-induced changes in SF1-mediated gene expression evident at e17.5 and e19.5 were detectable at e15.5, indicating a time window of sensitivity. Other rat studies conducted at e19.5 have shown that some of the major DBP-induced gene changes can be induced in a matter of hours (Lehmann et al., 2004; Liu et al., 2005; Thompson et al., 2004).
Several earlier studies have used microarray-based gene expression profiling to investigate the potential mechanisms via which DBP exposure in rats impairs fetal testis development, in particular impairment of steroidogenesis (Barlow et al., 2003; Lehmann et al., 2004; Liu et al., 2005; Shultz et al., 2001; Thompson et al., 2004). Although our initial approach was similar to these earlier studies, in that we used whole fetal testes as our source of RNA for profiling, we also investigated an earlier age point (e15.5) and, at e19.5, used laser capture microdissection to investigate compartment-selective changes in gene expression, which have been particularly informative. Our studies also used Wistar rather than Sprague-Dawley rats as in the earlier studies, and this may be important as a recent study suggests that Wistars may be more susceptible to the testicular effects of DBP/DEHP than are Sprague-Dawley rats (Gray and Furr, 2006). The present study confirmed that the effects of DBP on incidence of cryptorchidism and fetal testis testosterone were consistent with results obtained in our earlier studies (Fisher et al., 2003) in Wistar rats (data not shown). In addition, our microarray analysis method differed in that we used 60mer oligo arrays and assessed changes in gene expression in the RNA samples on the basis of ratios, rather than absolute measurements of RNA expression intensity. Despite these differences, our findings largely confirm the earlier studies in terms of identifying that DBP exposure downregulates expression of several key genes involved in cholesterol uptake (SCARB1), transport (StAR), and conversion into testosterone (Cyp11a and Cyp17); we did not identify any change in expression of 3 beta-hydroxy steroid dehydrogenase (3ß-HSD) nor in its protein level as determined by Westerns and immunohistochemistry (data not shown), which contrasts with some of the earlier studies (Shultz et al., 2001). Consistent with an earlier report (Liu et al., 2005), our studies also identified two genes involved in cholesterol metabolism that were downregulated after DBP exposure, namely HMGCS1 and HMGCR1, the latter being rate limiting in the synthesis of cholesterol. Downregulation of HMGCR1 could indirectly inhibit steroidogenesis by limiting the capacity to synthesize cholesterol, a process that might be particularly important in Leydig cells of DBP-exposed animals in which there is impaired ability to import cholesterol because of suppression of SCARB1. It is noteworthy that both HMGCS1 and HMGCR1 are SF1-regulated genes (Mascaro et al., 2000). Our time-course analysis also showed for the first time that none of the changes to SF1-regulated genes that we identified at days e17.5 and e19.5 were altered significantly at e15.5, despite prior exposure to DBP for a 48-h period. At e19.5, it has been shown by others (Liu et al., 2005; Thompson et al., 2004) that expression of the genes involved in cholesterol uptake and conversion into testosterone are downregulated within 24 h, and probably within a few hours, of a single exposure to DBP. This contrast suggests that either the mechanisms via which expression of these genes are suppressed are inoperative at e15.5 or that their level of expression is very low at this age, perhaps, because steroidogenesis has only just been switched on in the Leydig cells.
One difference in results between the present and previous microarray studies in whole fetal testes at e19.5 is that we identified a small but significant downregulation of SF1 gene expression in DBP-exposed animals. A recent study investigating the effects of in utero DEHP exposure on fetal testes gene expression by RT-PCR also reported a downregulation of SF1 at the RNA level (Borch et al., 2006). We were intrigued by this observation because of the number of SF1-regulated genes that were downregulated in parallel in testes of DBP-exposed animals—namely SCARB1, StAR, Cyp11a, Cyp17, Insl3, inhibin-, HMGCS1, HMGCR1, SCP2, and DAX1. Moreover, our quantitative PCR analyses of RNA from pooled testes from animals in individual litters indicated that DBP-induced downregulation of at least three of these genes (StAR, Cyp11a, Insl3) appeared to be coordinated with downregulation of SF1 expression, though downregulation of SF1 itself did not reach statistical significance. However, neither change in SF1 gene expression was detected in subsequent INT samples from DBP-exposed animals nor could we detect any change in SF1 protein expression in whole testes by Westerns or immunohistochemistry. It has also been shown in cell transfection/reporter studies that DBP does not directly interfere with SF1 transactivation (Thompson et al., 2004). Nevertheless, the consistent downregulation of SF1-regulated genes in Leydig cells of DBP-exposed animals is remarkable and might indicate an indirect effect on the activity of this transcription factor. The present data suggest that this effect is mediated via factors which are either not present or are not limiting in the CORDs (Sertoli cells). This was most clearly demonstrated by the lack of change in inhibin- gene/protein expression in the Sertoli cells, in contrast to the major downregulation of this SF1-regulated gene in the Leydig cells. Similarly, another SF1-regulated gene in Sertoli cells, AMH, was unaffected or mildly upregulated by DBP exposure at the mRNA and protein levels, while SCARB1 gene expression was much more severely downregulated in the interstitium than in the CORDs.
DBP is a peroxisome proliterator activated receptor (PPAR) (a member of the nuclear hormone receptor [NHR] family) agonist (Hurst and Waxman, 2003). The regulation of NHRs including PPAR and SF1 is dependent on the presence of coactivators that are common to these receptors (Qi et al., 2000). This is exemplified by the inhibin- promoter which contains sites for the coactivator, cyclic adenosine monophosphate response element-binding protein (CBP), which is essential for transactivation via SF1 (Ito et al., 2000). CBP is also an essential coactivator for genes that are regulated by PPARs (Misra et al., 2002). PPAR and 
agonists have been found to repress the expression of genes that do not contain binding sites for PPAR receptors in their promoters via coactivator competition (Li et al., 2000). For example, PPAR agonists, which do not directly transrepress the StAR promoter, have been found to downregulate the expression of this gene in steroidogenic tissues (Toda et al., 2003). As DBP activates several PPAR-regulated genes (SCD, ACADS, FADS1) (Miller and Ntambi, 1996; Wang et al., 2005; Watanabe et al., 2000) in the fetal testis, it is possible that coactivator starvation of SF1-, PPAR- and RAR-regulated genes could contribute to the repression of these genes by DBP in this situation; this merits further investigation. The level of expression of PPAR in fetal rat Leydig cells is not known, but this receptor is expressed at the protein level in adult rat Leydig cells (Schultz et al., 1999) and, in postnatal mice, PPAR agonists can suppress Leydig cell steroidogenesis (Gazouli et al., 2002). Unfortunately, there are as yet no reports as to whether DBP or DEHP are able to suppress steroidogenesis by the fetal testis in PPAR-null mice.
To our knowledge, the present findings are the first to apply laser capture microdissection to the gene expression profiling of fetal testis cords versus interstitium. Based on morphology of the recovered tissue fragments, cross-contamination of cord and INT tissue was not a major problem. However, this was difficult to confirm directly (e.g., by evaluation of expression of compartment-specific genes such as AMH and 3ß-HSD) as the tissue fragments only yielded sufficient RNA for microarray studies, which involved comparison of "relative," as opposed to absolute, gene expression. The fact that these analyses largely confirmed, for the INT tissue fraction, changes in gene expression identified from whole testis RNA analysis, which target the Leydig cells (e.g., SCARB1, StAR, Cyp17, Insl3), suggests that the INT sample is relatively enriched in Leydig cells. In this regard, it is notable that every gene identified as being downregulated in the INT sample was decreased to a greater extent than in the corresponding whole testis sample at e19.5. Even more persuasive was the observation that analysis of laser-captured material showed that for three genes that are expressed in both cords and interstitium, namely inhibin-, CRABP2, and PEBP, expression was only altered in the INT fraction, as was confirmed by immunohistochemistry for each of these proteins. In addition, there were some unexpected observations. For example, Cyp17 was detected in both compartments, whereas our experience is that expression of the Cyp17 protein is restricted to fetal rat Leydig cells (Majdic et al., 1996). SCARB1 was also found to be repressed in the INT (–4.57) and cord samples (–2.33), whereas this gene has only been found previously to be expressed in adult Sertoli cells (Nakagawa et al., 2004). This raises the possibility that some cross-contamination of RNA from the different cellular compartments could have occurred. In this regard, it is noteworthy that the expression level of Cyp17, SCARB1, and SC4MOL in cord samples, as reflected by their rank values (Mutch et al., 2002), was an order of magnitude lower than that for these genes in the corresponding INT samples, consistent with a much lower RNA expression in the cord sample (Table 2). Hence, it is also possible that these proteins are not expressed at a detectable level in fetal Sertoli cells. Unexpectedly, no significant DBP-induced change in expression of Cyp11a was detected in laser-captured INT tissue, whereas expression of this gene has consistently been shown to be reduced in whole testis samples (Barlow et al., 2003; Shultz et al., 2001) as well as at the protein level in Leydig cells in situ (Lehmann et al., 2004). However, other than these few discrepancies, the comparative results for laser-captured INT and cord tissue were consistent with a high degree of enrichment.
In conclusion, microarray analysis of fetal testes together with laser capture isolation of specific testicular regions and immunohistochemistry has shown that Leydig cells are an important site of DBP toxicity in the fetal rat testis and that there is coordinated repression of genes in the Leydig cells (but not in Sertoli cells) that are regulated by the NHRs SF1, PPAR, and RAR. Based on what is known about control of these NHRs and regulation of the identified genes, our findings have generated a hypothesized mechanism of DBP action as the result of cofactor starvation. This should provide a suitable focus for future experimental studies.
|
ACKNOWLEDGMENTS |
|---|
This study was partly funded by the European Council for Plasticizers and Intermediates. We are grateful to Dr Ulrich Sauer, PALM Application Laboratory, for his advice and assistance with laser capture microdissection, and to Zoe Riches, Jillian Ross, Nerys Thomas, Barbara Elcombe, Alun Barton, and Andrew Brown for technical assistance. Conflicts of Interest: None declared.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Akingbemi BT, Youker RT, Sottas CM, Ge R, Katz E, Klinefelter GR, Zirkin BR, Hardy MP. Modulation of rat Leydig cell steroidogenic function by di(2-ethylhexyl)phthalate. Biol. Reprod. (2001) 65:1252–1259.
Barlow NJ, Foster PMD. Pathogenesis of male reproductive tract lesions from gestation through adulthood following in utero exposure to di(n-butyl)phthalate. Toxicol. Pathol. (2003) 31:397–410.[CrossRef][Web of Science][Medline]
Barlow NJ, Phillips SL, Wallace DG, Sar M, Gaido KW, Foster PM. Quantitative changes in gene expression in fetal rat testes following exposure to di(n-butyl) phthalate. Toxicol. Sci. (2003) 73:431–441.
Borch J, Dalgaard M, Ladefoged O. Early testicular effects in rats perinatally exposed to DEHP in combination with DEHA-apoptosis assessment and immunohistochemical studies. Reprod. Toxicol. (2005) 19:517–525.[CrossRef][Web of Science][Medline]
Borch J, Ladefoged O, Hass U, Vinggaard AM. Steroidogenesis in fetal male rats is reduced by DEHP and DINP, but endocrine effects of DEHP are not modulated by DEHA in fetal, prepubertal and adult male rats. Reprod. Toxicol. (2003) 18:53–61.[CrossRef][Web of Science]
Borch J, Metzdorff SB, Vinggaard AM, Brokken L, Dalgaard M. Mechanisms underlying the anti-androgenic effects of diethylhexyl phthalate in fetal rat testis. Toxicology (2006) 223:144–155.[CrossRef][Web of Science][Medline]
Fisher JS, Macpherson S, Marchetti N, Sharpe RM. Human ‘testicular dysgenesis syndrome’: a possible model using in-utero exposure of the rat to dibutyl phthalate. Hum. Reprod. (2003) 18:1383–1394.
Gazouli M, Yao ZX, Boujrad N, Corton JC, Culty M, Papadopoulos V. Effect of peroxisome proliferators on Leydig cell peripheral-type benzodiazepine receptor gene expression, hormone-stimulated cholesterol transport, and steroidogenesis: Role of the peroxisome proliferator-activator receptor alpha. Endocrinology (2002) 143:2571–2583.
Gray LE Jr, Furr J. Differential expression of the phthalate syndrome of reproductive tract malformations in mal Sprague-Dawley and Wistar rat strains. (2006) Program and Abstracts of U.S. Society for Study of Reproduction, July 29 and August 1, Omaha, NE. Abstract 2006-A41.
Hurst CH, Waxman DJ. Activation of PPARalpha and PPARgamma by environmental phthalate monoesters. Toxicol. Sci. (2003) 74:297–308.
Ito M, Park Y, Weck J, Mayo KE, Jameson JL. Synergistic activation of the inhibin alpha-promoter by steroidogenic factor-1 and cyclic adenosine 3',5'-monophosphate. Mol. Endocrinol. (2000) 14:66–81.
Kleymenova E, Swanson C, Boekelheide K, Gaido KW. Exposure in utero to Di(n-butyl) phthalate alters the vimentin cytoskeleton of fetal rat Sertoli cells and disrupts Sertoli cell-gonocyte contact. Biol. Reprod. (2005) 73:482–490.
Lahousse SA, Wallace DG, Liu D, Gaido KW, Johnson KL. Testicular gene expression profiling following prepubertal rat mono-(2-ethylhexyl)phthalate exposure suggests a common initial genetic response at fetal and prepubertal stages. Toxicol. Sci. (2006) 93:369–381.
Lehmann KP, Phillips S, Sar M, Foster PM, Gaido KW. Dose-dependent alterations in gene expression and testosterone synthesis in the fetal testes of male rats exposed to di (n-butyl) phthalate. Toxicol. Sci. (2004) 81:60–68.
Li M, Pascual G, Glass CK. Peroxisome proliferator-activated receptor gamma-dependent repression of the inducible nitric oxide synthase gene. Mol. Cell. Biol. (2000) 20:4699–4707.
Liu K, Lehmann KP, Sar M, Young SS, Gaido KW. Gene expression profiling following in utero exposure to phthalate esters reveals new gene targets in the etiology of testicular dysgenesis. Biol. Reprod. (2005) 73:180–192.
Majdic G, Sharpe RM, O'Shaughnessy PJ, Saunders PT. Expression of cytochrome P450 17alpha-hydroxylase/C17-20 lyase in the fetal rat testis is reduced by maternal exposure to exogenous estrogens. Endocrinology (1996) 137:1063–1070.[Abstract]
Mascaro C, Nadal A, Hegardt FG, Marrero PF, Haro D. Contribution of steroidogenic factor 1 to the regulation of cholesterol synthesis. Biochem. J. (2000) 350:785–790.[CrossRef][Web of Science][Medline]
Miller CW, Ntambi JM. Peroxisome proliferators induce mouse liver stearoyl-CoA desaturase 1 gene expression. Proc. Natl. Acad. Sci. USA (1996) 93:9443–9448.
Misra P, Qi C, Yu S, Shah SH, Cao WQ, Rao MS, Thimmapaya B, Zhu Y, Reddy JK. Interaction of PIMT with transcriptional coactivators CBP, p300, and PBP differential role in transcriptional regulation. J. Biol. Chem. (2002) 277:20011–20019.
Mutch DM, Berger A, Mansourian R, Rytz A, Roberts M-A. The limit fold change model: A practical approach for selecting differentially expressed genes from microarray data. In: BMC Bioinformatics. (2002) Available at: http://www.biomedcentral.com/1471-2105/3/17. Accessed June 21, 2002.
Mylchreest E, Cattley RC, Foster PM. Male reproductive tract malformations in rats following gestational and lactational exposure to Di(n-butyl) phthalate: an antiandrogenic mechanism? Toxicol. Sci. (1998) 43:47–60.
Mylchreest E, Sar M, Cattley RC, Foster PMD. Disruption of androgen-regulated male reproductive development by di(n-butyl) phthalate during late gestation in rats is different from flutamide. Toxicol. Appl. Pharmacol. (1999) 156:81–95.[CrossRef][Web of Science][Medline]
Mylchreest E, Wallace DG, Cattley RC, Foster PM. Dose-dependent alterations in androgen-regulated male reproductive development in rats exposed to di(n-butyl) phthalate during late gestation. Toxicol. Sci. (2000) 55:143–151.
Nakagawa A, Nagaosa K, Hirose T, Tsuda K, Hasegawa K, Shiratsuchi A, Nakanishi Y. Expression and function of class B scavenger receptor type 1 on both apical and basolateral sides of the plasma membrane of polarized testicular Sertoli cells of the rat. Dev. Growth Differ. (2004) 46:283–298.[CrossRef][Web of Science][Medline]
Parks LG, Ostby JS, Lambright CR, Abbott BD, Klinefelter GR, Barlow NJ, Gray LE Jr. The plasticizer diethylhexyl phthalate induces malformations by decreasing fetal testosterone synthesis during sexual differentiation in the male rat. Toxicol. Sci. (2000) 58:339–349.
Qi C, Zhu Y, Reddy JK. Peroxisome proliferator-activated receptors, coactivators, and downstream targets. Cell Biochem. Biophys. (2000) 32:187–204.[CrossRef][Web of Science][Medline]
Sakai M, Matsushima-Hibiya Y, Nishizawa M, Nishi S. Suppression of rat glutathione transferase P expression by peroxisome proliferators: interaction between Jun and peroxisome proliferator-activated receptor alpha. Cancer Res. (1995) 55:5370–5376.
Schultz R, Yan W, Toppari J, Volkl A, Gustafsson JA, Pelto-Huikko M. Expression of peroxisome proliferator-activated receptor alpha messenger ribonucleic acid and protein in human and rat testis. Endocrinology (1999) 140:2968–2975.
Shultz VD, Phillips S, Sar M, Foster PM, Gaido KW. Altered gene profiles in fetal rat testes after in utero exposure to di(n-butyl) phthalate. Toxicol. Sci. (2001) 64:233–242.
Skakkebaek NE, Rajpert-De Meyts E, Main KM. Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects. Hum. Reprod. (2001) 16:972–978.
Thompson CJ, Ross SM, Gaido KW. Di(n-butyl) phthalate impairs cholesterol transport and steroidogenesis in the fetal rat testis through a rapid and reversible mechanism. Endocrinology (2004) 145:1227–1237.
Thompson CJ, Ross SM, Hensley J, Liu K, Heinze SC, Young SS, Gaido KW. Differential steroidogenic gene expression in the fetal adrenal gland versus the testis and rapid and dynamic response of the fetal testis to di(n-butyl) phthalate. Biol. Reprod. (2005) 73:908–917.
Toda K, Okada T, Miyaura C, Saibara T. Fenofibrate, a ligand for PPARalpha, inhibits aromatase cytochrome P450 expression in the ovary of mouse. J. Lipid. Res. (2003) 44:265–270.
Wang Y, Botolin D, Christian B, Busik J, Xu J, Jump DB. Tissue-specific, nutritional, and developmental regulation of rat fatty acid elongases. J. Lipid. Res. (2005) 46:706–715.
Watanabe K, Fujii H, Takahashi T, Kodama M, Aizawa Y, Ohta Y, Ono T, Hasegawa G, Naito M, Nakajima T, Kamijo Y, Gonzalez FJ, Aoyama T. Constitutive regulation of cardiac fatty acid metabolism through peroxisome proliferator-activated receptor alpha associated with age-dependent cardiac toxicity. J. Biol. Chem. (2000) 275:22293–22299.
Wilson VS, Lambright C, Furr J, Ostby J, Wood C, Held G, Gray LE Jr. Phthalate ester-induced gubernacular lesions are associated with reduced insl3 gene expression in fetal rat testis. Toxicol. Lett. (2004) 146:207–215.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  D. Rouquie, C. Friry-Santini, F. Schorsch, H. Tinwell, and R. Bars Standard and Molecular NOAELs for Rat Testicular Toxicity Induced by Flutamide Toxicol. Sci., May 1, 2009; 109(1): 59 - 65. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Kuhl, S. M. Ross, and K. W. Gaido CCAAT/Enhancer Binding Protein {beta}, But Not Steroidogenic Factor-1, Modulates the Phthalate-Induced Dysregulation of Rat Fetal Testicular Steroidogenesis Endocrinology, December 1, 2007; 148(12): 5851 - 5864. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||